Molecular Medicine Reports Molecular Medicine Reports 1791-2997 1791-3004 D.A. Spandidos 10.3892/mmr.2023.13139 MMR-29-1-13139 Articles Notoginsenoside R1 ameliorates the inflammation induced by amyloid‑β by suppressing SphK1‑mediated NF‑κB activation in PC12 cells WangXiaonan LiBei YuXiaohong ZhouYe WangKaile GaoYue Department of Geriatric Medicine, Affiliated Hangzhou First People's Hospital, Zhejiang University School of Medicine, Hangzhou, Zhejiang 310006, P.R. China Correspondence to: Dr Yue Gao, Department of Geriatric Medicine, Affiliated Hangzhou First People's Hospital, Zhejiang University School of Medicine, 261 Huansha Road, Shangcheng, Hangzhou, Zhejiang 310006, P.R. China, E-mail: yuegao6715@163.com 01 2024 01 12 2023 29 1 16 14042023 25102023 Copyright: © Wang et al. 2023 This is an open access article distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivs License, which permits use and distribution in any medium, provided the original work is properly cited, the use is non-commercial and no modifications or adaptations are made.

Alzheimer's disease (AD) is the most common type of age-related dementia, and causes progressive memory degradation, neuronal loss and brain atrophy. The pathological hallmarks of AD consist of amyloid-β (Aβ) plaque accumulation and abnormal neurofibrillary tangles. Amyloid fibrils are constructed from Aβ peptides, which are recognized to assemble into toxic oligomers and exert cytotoxicity. The fibrillar Aβ-protein fragment 25–35 (Aβ25-35) induces local inflammation, thereby exacerbating neuronal apoptosis. Notoginsenoside R1 (NGR1), one of the primary bioactive ingredients isolated from Panax notoginseng, exhibits effective anti-inflammatory and anti-oxidative activities. However, NGR1 pharmacotherapies targeting Aβ-induced inflammation and cell injury cascade remain to be elucidated. The present study investigated the effect and mechanism of NGR1 in Aβ25-35-treated PC12 cells. NGR1 doses between 250 and 1,000 µg/ml significantly increased cell viability suppressed by 20 µM Aβ25-35 peptide treatment. Notably, the present study demonstrated that Aβ25-35 peptide-induced sphingosine kinase 1 (SphK1) signaling activation was reduced after NGR1 treatment, further inhibiting the downstream NF-κB inflammatory signaling pathway. In addition, administration of SphK1 inhibitor II (SKI–II), a SphK1 inhibitor, also significantly reduced Aβ25-35 peptide-induced apoptosis and the ratio of NF-κB p-p65/p65. Furthermore, SphK1 knockdown in PC12 cells using small interfering RNA alleviated Aβ-induced cell apoptosis and inflammation, suggesting a pivotal role of SphK1 signaling in the anti-inflammatory effect of NGR1. In summary, NGR1 alleviated inflammation and apoptosis stimulated by Aβ25-35 by inhibiting the SphK1/NF-κB signaling pathway and may be a promising agent for future AD treatment.

 notoginsenoside R1 amyloid-β inflammation sphingosine kinase 1 Alzheimer's disease Science and Technology Program of Zhejiang Traditional Chinese Medicine 2014ZB077 Hangzhou Science and Technology development program 20150733Q13 Zhejiang Provincial Key Laboratory of Traditional Chinese Medicine for the Prevention and Treatment of Major Chronic Diseases of the Elderly, and the Construction Fund of Key Medical Disciplines of Hangzhou OO20200055 The present study was supported by the Science and Technology Program of Zhejiang Traditional Chinese Medicine (grant no. 2014ZB077), Hangzhou Science and Technology development program (grant no. 20150733Q13), Zhejiang Provincial Key Laboratory of Traditional Chinese Medicine for the Prevention and Treatment of Major Chronic Diseases of the Elderly, and the Construction Fund of Key Medical Disciplines of Hangzhou (grant no. OO20200055). Introduction

The prevalence of neurodegenerative diseases, such as Parkinson's disease and Alzheimer's disease (AD) among elderly individuals, is increasing yearly (1). AD has been considered a global public health threat, and is the most common cause of dementia. The Global Burden of Disease study recently forecasted that the number of individuals with dementia would increase from 57.4 million cases globally in 2019 to 152.8 million cases in 2050 (2). The classical neuropathological hallmarks of AD include amyloid-β (Aβ) plaque accumulation and neuro-fibrillary tangles aggregated by hyperphosphorylated tau protein (3). In general terms, amyloid precursor protein (APP) is cleaved by β-secretase, and γ-secretase can support the generation and maturation of Aβ peptides, which range between 38 and 43 amino acids (4). Prospective studies have reported that accumulation of different species of Aβ peptides contributed to glial activation and increased release of pro-inflammatory cytokines, chemokines and reactive oxygen species, all of which induce subsequent pathological events in AD, such as neuroinflammation and oxidative stress (5,6). Aβ triggers a cascade that causes neuron death, synapse loss and further cognitive decline (7). However, the validity of advanced or ongoing anti-amyloid therapies for AD is controversial due to the inefficiency in ameliorating cognitive outcomes in patients with AD (8).

Glia and immune cell-activated neuroinflammation is initiated by Aβ deposition, leading to neuron loss and cell apoptosis (9). Sphingosine kinase (SphK) is the predominant isoform responsible for the phosphorylation of sphingosine to produce sphingosine 1-phosphate (S1P), which acts as a pivotal lipid signaling regulator in the process of cell apoptosis, senescence and inflammation (10,11). SphK1 and SphK2 are well-identified isoforms of SphK and exhibit different properties and biological outcomes due to their different intracellular localization and tissue distribution (12). Notably, activation of intracellular SphK1 promotes the generation of S1P, which is necessary for the phosphorylation of IκB kinase and activation of the canonical NF-κB inflammatory signaling pathway (13). Emerging research has indicated underlying mechanisms and pathways of the SphK1/S1P axis involving neuroinflammation within different neurological disorders (14,15). One study revealed that SphK1 and its product S1P promoted the M1 microglia polarization and enhanced the production of pro-inflammatory cytokines in injured spinal cord tissue of rats, which ultimately amplificated the inflammation cascade, including nuclear phosphorylation of p38 MAPK and NF-κB p65 (14). However, another study demonstrated that elevated SphK1 activity in neurons restored Aβ phagocytosis of microglia and resolution of neuroinflammation via acetylation of cyclooxygenase 2 (COX2) (15). Therefore, the role and underlying mechanism of SphK1 in Aβ-related neuroinflammation remain to be fully elucidated.

Panax notoginseng is a traditional Chinese medicine with beneficial functions in promoting blood circulation and alleviating limb swelling (16). In addition, it has been used in several clinical trials to treat vascular dementia, cognitive decline and brain disorders in acute stroke (17,18). Notoginsenoside R1 (NGR1), one of the ingredients isolated from P. notoginseng saponins (PNSs), has been reported to possess anti-inflammatory and anti-oxidative stress properties (19,20). Chen et al (19) demonstrated that NGR1 alleviated IL-1β-induced inflammation and oxidative stress in vivo and in vitro by activating the nuclear factor erythroid 2-related factor 2/heme oxygenase 1 signaling pathway. In addition, NGR1 attenuated isoflurane-induced neurological disorders, including cognitive decline, memory loss and neuroinflammation, in rats (20). Notably, NGR1 exhibited a neuroprotective effect, including increasing memory function, improving learning ability and alleviating neuronal hyperexcitability via the regulation of voltage-gated sodium channels (Nav) proteins, in a mouse model of AD (21). These existing results implied that NGR1 might exert a neuroprotective effect on AD-related neuroinflammation and other neurological injuries. However, to the best of our knowledge, the specific mechanism of NGR1 in Aβ-induced neuroinflammation in AD progression remains unclear.

Given the beneficial role of NGR1 in ameliorating AD-related neurological disorders, the present study assessed whether NGR1 treatment protects against Aβ25-35-induced neuron apoptosis and inflammation and the underlying mechanism. The present study first examined Aβ-protein fragment 25–35 (Aβ25-35)-induced cell apoptosis and NF-κB inflammatory signaling pathway activation in PC12 rat adrenal chromaffin cell tumor cells co-incubated with Aβ25-35 and different concentrations of NGR1. In addition, the present study used small interfering RNA (siRNA/si) to knock down SphK1 to indicate how neuroinflammation improvement by NGR1 depended on the regulation of the SphK1/NF-κB signaling axis in PC12 cells.

 Materials and methods <sec> <title>Experimental reagents

NGR1 (batch number B21099; purity ≥98%) was acquired from Shanghai Yuanye Biotechnology Co., Ltd. For cell treatment, NGR1 was dissolved in DMSO (MilliporeSigma) and diluted in cell culture medium to keep the DMSO content below 0.1% of the total volume of the cell culture medium The preparation of Aβ25-35 (MilliporeSigma) has been described in our previous study (22). Briefly, Aβ25-35 was first dissolved to a concentration of 1 mM in deionized water and then aged for 72 h at 37°C in a humidified chamber to induce its aggregation. When apparent white flocculent aggregation occurred after incubation for 72 h, the aggregated solution was dissolved in DMSO to a concentration of 250 µM and stored at −20°C before being added to the culture medium to examine the cell viability at the final desired concentration (range, 5–30 µM), and to perform related molecular experiments at a final concentration of 20 µM. The final concentration of DMSO in the culture medium was <0.01% (vol/vol).

 Cell experiments

PC12 rat pheochromocytoma cells (The Cell Bank of Type Culture Collection of The Chinese Academy of Sciences) were maintained in Ham's F-12 medium (Gibco; Thermo Fisher Scientific, Inc.) with 5% (vol/vol) heat-inactivated FBS (Gibco; Thermo Fisher Scientific, Inc.), 15% (vol/vol) horse serum (Gibco; Thermo Fisher Scientific, Inc.) and 1% penicillin-streptomycin solution (100 U/ml penicillin and 100 µg/ml streptomycin; Gibco; Thermo Fisher Scientific, Inc.) in a humidified incubator (5% CO2; 95% air; 37°C). For analysis of the effects of NGR1 on Aβ25-35-induced cell injury, PC12 cells were stimulated with 20 µM Aβ25-35 peptide alone or combined with different concentrations of NGR1 (50, 100, 250, 500 and 1,000 µg/ml) for 24 h at 37°C. For analysis of the effects of SphK1 inhibitor II (SKI–II) on Aβ25-35-induced cell injury, PC12 cells were cultured with 20 µM Aβ25-35 peptide alone or combined with 10 µM SKI–II (HY-13822; MedChemExpress) with or without NGR1 (1,000 µg/ml) for 24 h at 37°C based on previous studies (23,24). PC12 cells incubated at 37°C for 24 h with only culture medium were used as the control group. A schematic diagram of cell treatments is shown in Fig. 1A. Cell viability was examined using an MTT assay according to the manufacturer's instructions as previously described (25).

 RNA extraction and quantitative PCR (qPCR)

Total RNA from PC12 cells was isolated using Biozol reagent (Biomiga), and cDNA was synthesized using a cDNA Reverse Transcriptase Kit (Vazyme Biotech Co., Ltd.) according to the manufacturer's instructions. The temperature protocol for reverse transcription was as follows: 37°C for 15 min and 98°C for 5 min. qPCR was performed using SYBR Green Real-time PCR Master Mix (Vazyme Biotech Co., Ltd.) on an Eppendorf Master Cycler ep RealPlex4 (Eppendorf SE) as previously described (26). The reaction conditions were as follows: 2-min pre-denaturation at 95°C, followed by 40 cycles of 15 sec at 95°C and 30 sec at 60°C. GAPDH was used as a housekeeping gene for data standardization. The gene expression was calculated using the 2−ΔΔCq method as described previously (27). The primer sequences are listed in Table I.

 TUNEL staining

A TUNEL BrightGreen apoptosis detection kit (Vazyme Biotech Co., Ltd.) was used to detect apoptotic cells as described in our previous study (22). Briefly, PC12 cells were cultured on coverslips until they reached 70–80% confluence. Subsequently, the PC12 cells were treated with 20 µM Aβ25-35 peptide alone or co-incubated with different concentrations of NGR1 ranging between 50 and 1,000 µg/ml for 24 h at 37°C. After fixation with 4% paraformaldehyde at room temperature for 15 min and permeabilization with 0.2% Triton X-100 (MilliporeSigma) for 10 min at room temperature, the apoptotic cell nuclei were stained with green fluorescein, while all cell nuclei were labeled with blue DAPI, as observed by confocal microscopy (IX83; Olympus Corporation). The fluorescence data were analyzed and quantified using ImageJ Fiji 2.9.0 (National Institutes of Health). The apoptotic cell rate was measured as the ratio of TUNEL-positive nuclei over DAPI-stained nuclei as follows: Apoptotic rate (%)=[(number of TUNEL-positive nuclei)/(number of DAPI-stained nuclei)] ×100 (%).

 Immunoblotting

Proteins from PC12 cells were extracted in RIPA lysis buffer (MilliporeSigma) containing protease and phosphatase inhibitors (Roche Diagnostics). According to the manufacturer's instructions, protein concentrations were quantified using a BCA protein assay kit (Thermo Fisher Scientific, Inc.). The proteins (10 µg/lane) were equally loaded onto 10% SDS gels and transferred to methanol-prewetted PVDF membranes (MilliporeSigma). The membranes were blocked for 1 h at room temperature with a 0.2% KPL detector block (SeraCare Life Sciences; LGC Limited) and then incubated with primary antibodies at 4°C overnight. The primary antibodies used were anti-SphK1 (cat. no. abs135525; Absin Bioscience, Inc.), anti-phospho-NF-κB p65 (Ser536) (cat. no. 3033), anti-NF-κB p65 (cat. no. 3034), GAPDH (cat. no. 2118) and β-actin (cat. no. 3700) (Cell Signaling Technology, Inc.) at a dilution of 1:1,000. After washing with tris-buffered saline with 0.1% Tween® 20 detergent, the membrane was incubated with HRP anti-rabbit or -mouse antibody at a dilution ratio of 1:10,000 at room temperature for 1 h (cat. no. 7074 and 7076, Cell Signaling Technology, Inc.). The band visualization was performed used an ECL chemiluminescence kit according to the manufacturer's instructions (E422, Vazyme Biotech Co., Ltd.). The procedures of western blotting were described previously (28). The intensity of the bands in the autoradiograms was examined using ImageJ Fiji 2.9.0 (National Institutes of Health).

 siRNA-mediated gene silencing and transfection

PC12 cells were maintained in 6- or 12-well plates until the cells were ~70% confluent. For SphK1 siRNA interference, the cells were transfected with 50 nM si-SphK1 or si-Control (Sangon Biotech Co., Ltd.) for 6 h at 37°C and then incubated with 20 µM Aβ25-35 peptide alone or co-cultured with 1,000 µg/ml NGR1 for 24 h at 37°C. The cells in the negative control group were maintained at 37°C for 30 h without any treatment and transfection. The si-SphK1 target sequences were as follows: 5′-GGACUUGGAGAGUGAGAAATT-3′ (sense) and 5′-UUUCUCACUCUCCAAGUCCTT-3′ (antisense). The scrambled si-Control sequences were as follows: 5′-UUCUCCGAACGUGUCACGUTT-3′ (sense) and 5′-ACGUGACACGUUCGGAGAATT-3′ (antisense). Transfection of PC12 cells with the specific siRNA against SphK1 and scrambled si-Control was performed using Lipofectamine® 3000 reagent (Invitrogen; Thermo Fisher Scientific, Inc.) in Opti-MEM (Gibco; Thermo Fisher Scientific, Inc.) as described previously (22,29).

 Statistical analysis

All data are presented as the mean ± SEM. Differences among the mean values were assessed using one-way ANOVA followed by the Tukey's post hoc test using Prism 9 (Dotmatics). P<0.05 was considered to indicate a statistically significant difference.

 Results <sec> <title>Effects of varying concentrations of NGR1 on the viability of PC12 cells

Previous studies have reported the cell toxicity of Aβ25-35 peptide (10–30 µM) in PC12 and SH-SY5Y cells (30–32). Our previous study demonstrated that treatment with Aβ25-35 peptide (10–30 µM) alone reduced the cell viability at 24, 48 and 72 h (22). Consistently, the present study demonstrated that Aβ25-35 peptide administration contributed to a significant decrease of cell viability in the dose range of 10–30 µM at 24 h compared with the control group (Fig. S1A). No significant cell toxicity was detected in PC12 cells treated with NGR1 at concentrations ranging between 50 and 1,500 µg/ml. By contrast, 2 mg/ml NGR1 treatment for 24 h significantly decreased the cell viability (Fig. S1B). Notably, addition of NGR1 increased the suppressed cell viability caused by 20 µM Aβ25-35 administration in a dose-dependent manner from 250 to 1,000 µg/ml after 24 h (Fig. 1B). Thus, NGR1 concentrations ranging between 250 and 1,000 µg/ml were used in subsequent experiments.

 NGR1 decreases apoptosis in Aβ<sub>25-35</sub>-treated PC12 cells

The influence of NGR1 on apoptosis-related gene expression in PC12 cells was analyzed by reverse transcription-qPCR. As shown in Fig. 1C, 20 µM Aβ25-35 treatment significantly increased the mRNA expression levels of Bax and Caspase-3, which are classical apoptosis promoters. By contrast, the mRNA expression levels of Bcl-2, an essential regulator in cell apoptosis inhibition, were decreased in the Aβ25-35-treated group compared with the control group; however, this difference was not significant (Fig. 1C). However, NGR1 supplementation (250–1,000 µg/ml) reduced the mRNA expression levels of Bax and Caspase-3 but increased the mRNA expression levels of Bcl-2 in the PC12 cells co-incubated with 20 µM Aβ25-35 peptide at 24 h in a dose-dependent manner (Fig. 1C). In addition, TUNEL staining was performed to further verify the effect of NGR1 on apoptosis (Fig. 1D and E). Aβ25-35 administration (20 µM) increased the percentage of TUNEL-positive cells compared with the control group (Fig. 1D and E). By contrast, NGR1 treatment (500–1,000 µg/ml) dose-dependently decreased the apoptotic cells labeled by TUNEL in the PC12 cells co-treated with Aβ25-35 peptide (Fig. 1D and E).

 NGR1 inhibits Aβ<sub>25-35</sub>-induced SphK1/NF-κB signaling activation in PC12 cells

Intracellular SphK1 is considered to modulate NF-κB activation and is responsible for the inflammatory cascade following different inflammatory stimuli (33,34). To elucidate the anti-inflammatory mechanism of NGR1 in Aβ25-35-treated PC12 cells, the present study examined the gene and protein expression levels of SphK1 and the ratio of NF-κB p-p65/p65 in PC12 cells co-incubated with 20 µM Aβ25-35 and different concentrations of NGR1 (Fig. 2). As shown in Fig. 2A, Aβ25-35 treatment increased the mRNA expression levels of SphK1 compared with the control group, whereas NGR1 supplementation (ranging between 250 and 1,000 µg/ml) significantly reduced SphK1 gene expression in PC12 cells. Furthermore, in a dose-dependent manner, NGR1 treatment (250–1,000 µg/ml) significantly decreased the protein levels of SphK1 and decreased the ratio of p-p65/p65 in PC12 cells compared with the 20 µM Aβ25-35-treated group (Fig. 2B and C). Additionally, MMP-3 and MMP-9 are pivotal inflammatory components in the progression of AD, as they promote the aggregation of Aβ and tau proteins in the brain (35). Consistently, Aβ25-35 treatment increased the mRNA expression levels of MMP-3 and MMP-9 in vitro, while NGR1 administration (250–1,000 µg/ml) prominently decreased the mRNA expression levels of MMP-3 and MMP-9 in a dose-dependent manner (Fig. 2A).

 SphK1/NF-κB signaling is involved in the anti-inflammatory effect of NGR1 in Aβ<sub>25-35</sub>-treated PC12 cells

To clarify the role of SphK1/NF-κB signaling in the anti-inflammatory effect of NGR1 in Aβ25-35-treated PC12 cells, 10 µM SKI–II, a SphK1 inhibitor, was co-administrated with 20 µM Aβ25-35 peptide and 1,000 µg/ml NGR1 for 24 h (Fig. 3). SphK1 inhibition also significantly decreased the mRNA expression levels of Bax and Caspase-3 but increased the mRNA expression levels of Bcl-2 in PC12 cells to a similar extent compared with 1,000 µg/ml NGR1 supplementation compared with Aβ25-35 treatment alone (Fig. 3A). At the same time, a decreased percentage of TUNEL-positive apoptotic cells was observed in the SKI–II-treated group and SKI–II and NGR1 group compared with the 20 µM Aβ25-35 peptide treatment group in PC12 cells (Fig. 3B).

SphK1 inhibition by SKI–II treatment decreased the mRNA expression levels of MMP-3 and MMP-9 in PC12 cells compared with the Aβ25-35 peptide-treated group (Fig. 3C). Similar to treatment with 1,000 µg/ml NGR1 and Aβ25-35, western blotting demonstrated that SKI–II treatment significantly decreased the protein levels of SphK1 and decreased the ratio of p-p65/p65 in PC12 cells compared with those of the 20 µM Aβ25-35 peptide-treated group (Fig. 3D and E). However, 1,000 µg/ml NGR1 and 10 µM SKI–II combined treatment did not further inhibit the activation of the NF-κB signaling pathway (Fig. 3D and E). Overall, these data illustrated the involvement of SphK1 in the inhibitory effect of NGR1 on inflammation induced by Aβ25-35 in PC12 cells.

 Knockdown of SphK1 relieves inflammation induced by Aβ<sub>25-35</sub> in PC12 cells

To further verify whether the activation of SphK1 mediates NGR1-alleviated inflammation, scrambled siRNA and si-SphK1 were transfected into PC12 cells separately, and an untreated and untransfected negative control group was established (Figs. 4 and S2), and SphK1 was knocked down (Fig. S2). As shown in Fig. 4A, SphK1 knockdown decreased mRNA expression levels of Bax and Caspase-3, and increased mRNA expression levels of Bcl-2 in PC12 cells compared with cells treated with Aβ25-35 alone in the si-Control group, which indicated that SphK1 knockdown abolished the apoptosis induced by Aβ25-35. Consistently, a decreased proportion of TUNEL-labeled apoptotic cells was observed in the 20 µM Aβ25-35-treated si-SphK1 group when compared with the 20 µM Aβ25-35-treated si-Control group (Fig. 4B). In addition, SphK1 knockdown significantly decreased the mRNA expression levels of MMP-3 and MMP-9 and decreased the ratio of p-p65/p65 in PC12 cells compared with the 20 µM Aβ25-35-treated si-control group (Fig. 4C-E). However, knockdown of SphK1 combined with Aβ25-35 and NGR1 treatment did not exert an effect on mRNA expression levels of Bax, Caspase-3 and Bcl-2, and the proportion of TUNEL-stained apoptotic cells compared with combination treatment of NGR1 and Aβ25-35 in the si-control groups (Fig. 4A and B). In addition, knockdown of SphK1 combined with Aβ25-35 and NGR1 treatment also decreased the mRNA level of MMP-3 and MMP-9 and inhibited NF-κB p65 activation compared with those of the PC12 cells treated with Aβ25-35 alone in the si-Control group, but to a similar extent compared with combined treatment with NGR1 and Aβ25-35 in the si-control group (Fig. 4C-E). However, these data demonstrated that knockdown of SphK1 could effectively suppress Aβ-induced apoptosis and inflammation in PC12 cells.

 Discussion

The principal cellular characteristic of AD is Aβ-related neurotoxicity that prompts apoptosis, which is responsible for extensive neuronal degeneration and loss in the brain (36). Although ongoing clinical trials for AD therapies that target the degradation of Aβ deposition have been unsatisfactory, widespread research has indicated high toxicity of soluble Aβ oligomers (37). In general, Aβ1-40 and Aβ1-42 are the most abundant species of Aβ peptides, of which Aβ1-42 has been detected as the primary component in amyloid plaque depositions in patients with AD (38). Among the Aβ fragments available at present, the Aβ25-35 peptide consisting of 11 amino acid residues has been found in the in the brain of patients with AD (39). In addition, a comparison study demonstrated that both Aβ1-42 and Aβ25-35 induced similar cell toxicity in organotypic hippocampal slices. Nevertheless, the authors highlighted that synthetic Aβ25-35 peptide was convenient for clarifying the neurotoxic mechanisms involved in the pathogenesis of AD (40). Aβ25-35 peptide is a cheap and convenient alternative in the pathological investigations of AD, since this smaller peptide retains the toxicity of the full-length peptide and induces a vast amount of neuron death (41). Furthermore, the Aβ25-35 peptide forms a series of β-barrel aggregates and a dominant hexamer structure, the C terminus region of which provides the most potent interactions between two Aβ25-35 monomers (42). Notably, aging aggravates the release of soluble Aβ1-40 from plaques and Aβ1-40 is converted by proteolysis to toxic Aβ25-35/40, which causes detrimental damage in the hippocampal CA1 neurons to promote neurotoxicity in AD (39). Collectively, the present study used the Aβ25-35 peptide as a potent inducer to simulate cell toxicity and apoptosis, effectively mimicking the pathological conditions associated with AD in vitro.

PC12 cells are derived from the adrenal medulla of a rat with pheochromocytoma and are widely utilized as a neuronal precursor cell line in neuroscience research (43). PC12 cells exhibit morphological and physiological traits resembling those of adrenal gland cells in the undifferentiated state (43). These cells are commonly employed in numerous studies to investigate the neurotoxic effects of various substances (44,45). For instance, PC12 cells are frequently used to study Aβ-induced neurotoxicity, as an in vitro model simulating aspects of AD (46). Our previous study revealed that the Aβ25-35 peptide markedly contributed to severe apoptosis and oxidative stress in PC12 cells (22). A recent study also revealed that Aβ25-35 administration enhanced apoptosis and activated the NF-κB signaling pathway in an APP/presenilin 1 double-transgenic mouse model of AD and BV2 microglia cell line (47). Consistent with these previous findings, the present study used Aβ25-35 peptide to establish AD-related phenotypes in PC12 cells, including cellular apoptosis and neuroinflammation. In the present study, 20 µM Aβ25-35 treatment for 24 h was used and significantly induced apoptosis, as demonstrated by the decrease in cell viability, increased mRNA expression levels of pro-apoptotic markers (Bax and Caspase3) and increased percentage of TUNEL-labeled apoptotic cells. In addition, Aβ25-35 markedly activated the NF-κB inflammatory signaling pathway associated with the increased levels of Sphk1 signaling in PC12 cells. Notably, the present study demonstrated that NGR1 blocked the NF-κB inflammatory pathway by inhibiting SphK1 signaling, thereby reversing Aβ25-35-induced apoptosis and inflammatory damage in PC12 cells. However, a limitation of the present study was the absence of protein detection of cleaved caspase3, necessitating further investigations to conclusively ascertain the impact of NGR1 on apoptosis.

Prospective studies have demonstrated the advantages of P. notoginseng in alleviating inflammation, inhibiting cell apoptosis and reducing thrombosis (48,49). As the bioactive component of P. notoginseng, PNS exhibits neuroprotective effects on the progression of AD by inhibiting Aβ production and aggregation and alleviating inflammation (50). Notably, NGR1, a primary active ingredient of PNSs, has also been reported to have beneficial effects on neuronal activity repairment in AD development (51,52). For instance, oral administration of NGR1 effectively improved Aβ-induced synaptic plasticity deficits in brain slices and reduced Aβ neurotoxicity by recovering Aβ1-42 oligomer-induced long-term potentiation impairment (51). Hu et al (21) demonstrated that NGR1 treatment restored cell viability of primary cultured mouse neurons after Aβ1-42 administration and reduced neuronal hyperexcitability via the reallocation of Nav1.1α and prevention of excessive cleavage of Navβ2. The present findings demonstrated that NGR1 supplementation increased viability in a dose-dependent manner after incubation of PC12 cells with Aβ25-35 and decreased apoptosis. Another study also demonstrated that NGR1 counteracted the cell damage induced by Aβ25-35 by increasing cell viability, alleviating cellular oxidative damage and normalizing mitochondrial membrane potential via the suppression of the MAPK signaling pathway in PC12 cells (52). Therefore, we hypothesized that NGR1 exerted neuroprotective effects against Aβ25-35-induced cell injury by alleviating apoptosis in PC12 cells.

Extracellular Aβ deposition indicates neurotoxicity resulting in neuronal death, microglia activation and excessive production of pro-inflammatory cytokines, which are mediated through binding to neurotrophic factors, such as N-methyl-D-aspartate receptor and insulin receptor (53). The present study revealed activation of the NF-κB inflammatory signaling pathway in Aβ25-35-treated PC12 cells. In addition, in the present study, Aβ25-35 treatment markedly increased the mRNA expression levels of MMP-3 and MMP-9, which are located around amyloid plaques and elevated in the brain of patients with AD (54,55). In the Ra2 microglia cell line, excessive Aβ accumulation elevated the activity of MMP-3 and subsequently activated PI3K/Akt signaling inflammatory cascades (56). In addition, the simultaneous accumulation of cortical MMP-9 may be recognized as a pathological marker of the early onset of AD (57), and MMP-3 has been demonstrated to activate MMP-9 effectively and to indirectly facilitate AD pathology (58). The present study revealed inhibition of phosphorylation of NF-κB p65 and decreased mRNA expression levels of MMP-3 and MMP-9 in NGR1-treated groups compared with the group treated with only Aβ25-35. Although the substantial role and mechanism of MMP-3 and MMP-9 in the Aβ-induced inflammatory response remain elusive, the present data suggested that MMP-3 and MMP-9 were involved in the Aβ25-35-related neurotoxicity and inflammation. Therefore, further investigation is required to examine the potential role and possible mechanism of MMPs in the Aβ neurotoxicity during AD progression.

In addition to the downregulation of NF-κB activation, the present study also revealed a marked decrease in SphK1 mRNA and protein expression in NGR1-treated groups. SphK1 is one of the rate-limiting enzymes catalyzing S1P generation, which subsequently binds to a series of intracellular S1P receptors and is involved in various inflammatory diseases (11). One study reported that SphK1 and its product S1P acted as viable therapeutic targets for mediating neuroinflammation via the phosphorylation of p38 MAPK and ultimate activation of NF-κB p65 (14). Conversely, treatment with PF543, a validated inhibitor of SphK1, reversed pro-inflammatory M1-type microglia-facilitated neuron apoptosis and NF-κB p65 activation in PC12 cells (14). Consistently, the present data demonstrated that NGR1 decreased the mRNA and protein levels of SphK1 and inhibited the phosphorylation level of NF-κB p65. The present study used 10 µM SKI–II as an effective SphK1 inhibitor (23,24). It demonstrated that pharmacological inhibition of SphK1 markedly decreased apoptosis and decreased the ratio of p-p65/p65 in PC12 cells. A prior study of the pharmacokinetics of SKI–II suggested a pro-inflammatory effect in atherosclerosis-prone mice (59). However, to the best of our knowledge, the role of the SphK1-triggered inflammatory signaling pathway in Aβ toxicity has not been fully elucidated. In the present study, pharmacological inhibition by SKI–II administration and siRNA-mediated SphK1 knockdown were performed in PC12 cells. Notably, the present study revealed significant alleviation of Aβ25-35-induced apoptosis and the NF-κB inflammatory response when SphK1 was inhibited or knocked down. However, the underlying mechanism of SphK1 signaling appears to be complicated and controversial in Aβ neurotoxicity (24). In APP-transfected PC12 cells, the presence of endogenous Aβ peptides led to a reduction in SphK1 activity, and treatment with SKI–II decreased cell viability (24). In addition, a reduction of SphK1 activity was observed in the neurons of patients with AD and mice (60), while COX2 acetylated by the activated SphK1 signaling contributed to the resolution of neuroinflammation and Aβ phagocytosis by microglia in AD (15). Furthermore, glial cells, mainly microglia, and astrocytes are involved in the pathogenesis of AD by regulating the phagocytosis of Aβ proteins and the release of pro-inflammatory cytokines (61). Therefore, further investigations involving the concrete mechanism regarding NGR1 and Aβ25-35-activated neuroinflammation and subsequent glial cell activation via SphK1 signaling are required. Notably, the increased mRNA expression levels of MMP-3 and MMP-9 following treatment with Aβ25-35 were decreased when SphK1 was inhibited or knocked down. Although few studies have focused on the role of SphK1 in Aβ25-35-related neurotoxicity via the regulation of MMP-3 and MMP-9, the activity of S1P, a downstream product of SphK1, elevated the levels of MMP-3 and subsequently promoted the progression of osteoarthritis (62). In addition, N, N-dimethylsphingosine, a potent SphK1 inhibitor, also decreased the levels of MMP-9 and other pro-inflammatory cytokines in the cellular junctions between Jurkat-U937 cells and rheumatoid arthritis human peripheral blood mononuclear cells (63). Therefore, SphK1-regualted MMP-3 and MMP-9 may be a potential mechanism for investigating Aβ25-35-related neurotoxicity and the inflammatory response. Notably, the inhibition of SphK1 in PC12 cells did not result in any alterations in the mRNA expression levels of MMP-3 or MMP-9, nor did it affect the ratio of p-p65/p65 compared with those of cells treated with NGR1 and Aβ25-35. These findings suggested that the SphK1-mediated activity of MMP-3 and MMP-9 may serve a role in the NGR1-related neuroprotective effect on Aβ25-35-induced neurotoxicity and inflammation.

Taken together, the present study revealed that NGR1 supplementation increased the viability and protected PC12 cells against Aβ25-35-induced apoptosis in a dose-dependent manner. Furthermore, NGR1 treatment alleviated the Aβ25-35-activated inflammatory response by inhibiting SphK1-mediated NF-κB signaling pathway activation. These findings highlighted the neuroprotective role of NGR1 in Aβ25-35-related neurological impairment and provided a theoretical basis for further understanding the mechanism of NGR1 in Aβ neurotoxicity.

However, a major limitation of the present study was its focus on detecting changes of apoptosis markers at the gene level without considering alterations at the protein level, which could have been detected by western blotting. Therefore, further investigations involving protein analyses are required to confirm the validity of these results. Further studies using an in vivo AD model and corresponding primary neuron cells are required to identify the exact role and mechanism of the SphK1 signaling in the NGR1-mediated anti-inflammatory effects during the progression of AD.

 Supplementary Material Supporting Data Acknowledgements

Not applicable.

 Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

 Authors' contributions

XW, BL, XY, YZ, KW and YG collected samples, and acquired and analyzed data. XW wrote the manuscript. XW and YG contributed to the study concept, and drafted and revised the manuscript. XW and YG confirm the authenticity of all the raw data. All authors read and approved the final version of the manuscript.

 Ethics approval and consent to participate

Not applicable.

 Patient consent for publication

Not applicable.

 Competing interests

The authors declare that they have no competing interests.

 References WeintraubSKarpouzian-RogersTPeipertJDNowinskiCSlotkinJWortmanKHoERogalskiECarlssonCGiordaniBARMADA: Assessing reliable measurement in Alzheimer's disease and cognitive aging project methodsAlzheimers Dement1814491460202210.1002/alz.1249734786833 GBD 2019 Dementia Forecasting CollaboratorsEstimation of the global prevalence of dementia in 2019 and forecasted prevalence in 2050: An analysis for the global burden of disease study 2019Lancet Public Health7e105e125202210.1016/S2468-2667(21)00249-834998485 ZetterbergHMattssonNUnderstanding the cause of sporadic Alzheimer's diseaseExpert Rev Neurother14621630201410.1586/14737175.2014.91574024852227 LengFEdisonPNeuroinflammation and microglial activation in Alzheimer disease: Where do we go from here?Nat Rev Neurol17157172202110.1038/s41582-020-00435-y33318676 Del BoRAngerettiNLuccaEDe SimoniMGForloniGReciprocal control of inflammatory cytokines, IL-1 and IL-6, and beta-amyloid production in culturesNeurosci Lett1887074199510.1016/0304-3940(95)11384-97783982 AkiyamaHBargerSBarnumSBradtBBauerJColeGMCooperNREikelenboomPEmmerlingMFiebichBLInflammation and Alzheimer's diseaseNeurobiol Aging21383421200010.1016/S0197-4580(00)00124-X10858586 BuscheMAHymanBTSynergy between amyloid-β and tau in Alzheimer's diseaseNat Neurosci2311831193202010.1038/s41593-020-0687-632778792 HaassCSelkoeDIf amyloid drives Alzheimer disease, why have anti-amyloid therapies not yet slowed cognitive decline?PLoS Biol20e3001694202210.1371/journal.pbio.300169435862308 ThakurSDhapolaRSarmaPMedhiBReddyDHNeuroinflammation in Alzheimer's disease: Current progress in molecular signaling and therapeuticsInflammation46117202310.1007/s10753-022-01721-135986874 HofmannLPRenSSchwalmSPfeilschifterJHuwilerASphingosine kinase 1 and 2 regulate the capacity of mesangial cells to resist apoptotic stimuli in an opposing mannerBiol Chem38913991407200810.1515/BC.2008.16018783337 KunkelGTMaceykaMMilstienSSpiegelSTargeting the sphingosine-1-phosphate axis in cancer, inflammation and beyondNat Rev Drug Discov12688702201310.1038/nrd409923954895 SpiegelSMilstienSSphingosine-1-phosphate: An enigmatic signalling lipidNat Rev Mol Cell Biol4397407200310.1038/nrm110312728273 AlvarezSEHarikumarKBHaitNCAllegoodJStrubGMKimEYMaceykaMJiangHLuoCKordulaTSphingosine-1-phosphate is a missing cofactor for the E3 ubiquitin ligase TRAF2Nature46510841088201010.1038/nature0912820577214 WangCXuTLachanceBBZhongXShenGXuTTangCJiaXCritical roles of sphingosine kinase 1 in the regulation of neuroinflammation and neuronal injury after spinal cord injuryJ Neuroinflammation1850202110.1186/s12974-021-02092-433602274 LeeJYHanSHParkMHSongISChoiMKYuEParkCMKimHJKimSHSchuchmanEHN-AS-triggered SPMs are direct regulators of microglia in a model of Alzheimer's diseaseNat Commun112358202010.1038/s41467-020-16080-432398649 LiuHLuXHuYFanXChemical constituents of Panax ginseng and Panax notoginseng explain why they differ in therapeutic efficacyPharmacol Res161105263202010.1016/j.phrs.2020.10526333127555 ChangDLiuJBilinskiKXuLSteinerGZSetoSWBensoussanAHerbal medicine for the treatment of vascular dementia: An overview of scientific evidenceEvid Based Complement Alternat Med20167293626201610.1155/2016/729362628115971 FengLHanFZhouLWuSDuYZhangDZhangCGaoYEfficacy and safety of Panax notoginseng saponins (Xueshuantong) in patients with acute ischemic stroke (EXPECT) trial: Rationale and designFront Pharmacol12648921202110.3389/fphar.2021.64892133967788 ChenMZhouSQLiuLWenYXChenLBNotoginsenoside R1 alleviates the inflammation of osteoarthritis by activating the Nrf2/HO-1 signalling pathway in vitro and in vivoJ Funct Foods85104666202110.1016/j.jff.2021.104666 WangMLiuHXuLLiMZhaoMThe protective effect of notoginsenoside R1 on isoflurane-induced neurological impairment in the rats via regulating miR-29a expression and neuroinflammationNeuroimmunomodulation297076202210.1159/00051821534515180 HuTLiSLiangWQLiSSLuMNChenBZhangLMaoRDingWHGaoWWNotoginsenoside R1-induced neuronal repair in models of Alzheimer disease is associated with an alteration in neuronal hyperexcitability, which is regulated by NavFront Cell Neurosci14280202010.3389/fncel.2020.0028033088260 WangXLiBYuXZhouYGaoYThe neuroprotective effect of GM-1 ganglioside on the amyloid-beta-induced oxidative stress in PC-12 cells mediated by Nrf-2/ARE signaling pathwayNeurochem Res4724052415202210.1007/s11064-022-03635-835635605 CieślikMCzapskiGAStrosznajderJBThe molecular mechanism of amyloid β42 peptide toxicity: The role of sphingosine kinase-1 and mitochondrial sirtuinsPLoS One10e0137193201510.1371/journal.pone.013719326334640 GassowskaMCieslikMWilkaniecAStrosznajderJBSphingosine kinases/sphingosine-1-phosphate and death signalling in APP-transfected cellsNeurochem Res39645652201410.1007/s11064-014-1240-324452756 WangXWeiLZhuJHeBKongBJinYFuZTetrabromoethylcyclohexane (TBECH) exhibits immunotoxicity in murine macrophagesEnviron Toxicol35159166202010.1002/tox.2285231696622 NiLZhugeFYangSMaLZhengAZhaoYHuLFuZNiYHydrolyzed chicken meat extract attenuates neuroinflammation and cognitive impairment in middle-aged mouse by regulating M1/M2 microglial polarizationJ Agric Food Chem6998009812202110.1021/acs.jafc.1c0354134404209 LivakKJSchmittgenTDAnalysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) methodMethods25402408200110.1006/meth.2001.126211846609 NiYNiLMaLWangZZhaoYHuLZhengLFuZNeuroprotective effects of ProBeptigen/CMI-168 on aging-induced cognitive decline and neuroinflammation in mice: A comparison with essence of chickenActa Biochim Biophys Sin (Shanghai)53419429202110.1093/abbs/gmab00933637986 MaLNiYWangZTuWNiLZhugeFZhengAHuLZhaoYZhengLFuZSpermidine improves gut barrier integrity and gut microbiota function in diet-induced obese miceGut Microbes12119202010.1080/19490976.2020.183285733151120 QiaoLChenYDouXSongXXuCBiogenic selenium nanoparticles attenuate Aβ25-35-induced toxicity in PC12 cells via Akt/CREB/BDNF signaling pathwayNeurotox Res4018691881202210.1007/s12640-022-00590-836435923 MengXLLiuSYXueJSGouJMWangDLiuHSChenCLXuCBProtective effects of liensinine, isoliensinine, and neferine on PC12 cells injured by amyloid-βJ Food Biochem46e14303202210.1111/jfbc.1430335762411 LiLXLiuMYJiangXXiaZHWangYXAnDWangHGHengBLiuYQMetformin inhibits Aβ25-35-induced apoptotic cell death in SH-SY5Y cellsBasic Clin Pharmacol Toxicol125439449201910.1111/bcpt.1327931220411 AvniDHarikumarKBSanyalAJSpiegelSDeletion or inhibition of SphK1 mitigates fulminant hepatic failure by suppressing TNFα-dependent inflammation and apoptosisFASEB J35e21415202110.1096/fj.202002540R33566377 EtemadiNChopinMAndertonHTanzerMCRickardJAAbeysekeraWHallCSpallSKWangBXiongYTRAF2 regulates TNF and NF-κB signalling to suppress apoptosis and skin inflammation independently of Sphingosine kinase 1Elife4e10592201510.7554/eLife.1059226701909 WangXXTanMSYuJTTanLMatrix metalloproteinases and their multiple roles in Alzheimer's diseaseBiomed Res Int2014908636201425050378 LaFerlaFMTinkleBTBieberichCJHaudenschildCCJayGThe Alzheimer's A beta peptide induces neurodegeneration and apoptotic cell death in transgenic miceNat Genet92130199510.1038/ng0195-217704018 ViolaKLKleinWLAmyloid β oligomers in Alzheimer's disease pathogenesis, treatment, and diagnosisActa Neuropathol129183206201510.1007/s00401-015-1386-325604547 MasliahEAlfordMAdameARockensteinEGalaskoDSalmonDHansenLAThalLJAbeta1-42 promotes cholinergic sprouting in patients with AD and Lewy body variant of ADNeurology61206211200310.1212/01.WNL.0000073987.79060.4B12874400 KuboTNishimuraSKumagaeYKanekoIIn vivo conversion of racemized beta-amyloid [(D-Ser 26)A beta 1–40] to truncated and toxic fragments [(D-Ser 26)A beta 25–35/40] and fragment presence in the brains of Alzheimer's patientsJ Neurosci Res70474483200210.1002/jnr.1039112391608 FrozzaRLHornAPHoppeJBSimãoFGerhardtDComiranRASalbegoCGA comparative study of beta-amyloid peptides Abeta1-42 and Abeta25-35 toxicity in organotypic hippocampal slice culturesNeurochem Res34295303200910.1007/s11064-008-9776-818686032 VaradarajanSKanskiJAksenovaMLauderbackCButterfieldDADifferent mechanisms of oxidative stress and neurotoxicity for Alzheimer's A beta(1–42) and A beta(25–35)J Am Chem Soc12356255631200110.1021/ja010452r11403592 LiuXGangulyPJinYJhatroMJSheaJEBurattoSKBowersMTTachykinin neuropeptides and amyloid β (25–35) assembly: Friend or foe?J Am Chem Soc1441461414626202210.1021/jacs.2c0384535917596 WiatrakBKubis-KubiakAPiwowarABargEPC12 cell line: Cell types, coating of culture vessels, differentiation and other culture conditionsCells9958202010.3390/cells904095832295099 GaoXHanZHuangCLeiHLiGChenLFengDZhouZShiQChengLZhouXAn anti-inflammatory and neuroprotective biomimetic nanoplatform for repairing spinal cord injuryBioact Mater18569582202235845318 ChanghongKPengYYuanZCaiJGinsenoside Rb1 protected PC12 cells from Aβ25-35-induced cytotoxicity via PPARγ activation and cholesterol reductionEur J Pharmacol893173835202110.1016/j.ejphar.2020.17383533359145 GengXDWangWWFengZLiuRChengXLShenWJDongZYCaiGYChenXMHongQWuDIdentification of key genes and pathways in diabetic nephropathy by bioinformatics analysisJ Diabetes Investig10972984201910.1111/jdi.1298630536626 GaoJMZhangXShuGTChenNNZhangJYXuFLiFLiuYGWeiYHeYQTrilobatin rescues cognitive impairment of Alzheimer's disease by targeting HMGB1 through mediating SIRT3/SOD2 signaling pathwayActa Pharmacol Sin4324822494202210.1038/s41401-022-00888-535292770 GaoJYaoMZhangWYangBYuanGLiuJXZhangYPanax notoginseng saponins alleviates inflammation induced by microglial activation and protects against ischemic brain injury via inhibiting HIF-1α/PKM2/STAT3 signalingBiomed Pharmacother155113479202210.1016/j.biopha.2022.11347936271540 LiuYLiuTDingKLiuZLiYHeTZhangWFanYMaWCuiLSongXPhospholipase Cγ2 signaling cascade contribute to the antiplatelet effect of notoginsenoside FcFront Pharmacol91293201810.3389/fphar.2018.0129330459626 DuYFuMWangYTDongZNeuroprotective effects of ginsenoside Rf on amyloid-β-induced neurotoxicity in vitro and in vivoJ Alzheimers Dis64309322201810.3233/JAD-18025129865080 YanSLiZLiHArancioOZhangWNotoginsenoside R1 increases neuronal excitability and ameliorates synaptic and memory dysfunction following amyloid elevationSci Rep46352201410.1038/srep0635225213453 MaBMengXWangJSunJRenXQinMSunJSunGSunXNotoginsenoside R1 attenuates amyloid-β-induced damage in neurons by inhibiting reactive oxygen species and modulating MAPK activationInt Immunopharmacol22151159201410.1016/j.intimp.2014.06.01824975829 FrickerMTolkovskyAMBorutaiteVColemanMBrownGCNeuronal cell deathPhysiol Rev98813880201810.1152/physrev.00011.201729488822 YoshiyamaYAsahinaMHattoriTSelective distribution of matrix metalloproteinase-3 (MMP-3) in Alzheimer's disease brainActa Neuropathol999195200010.1007/PL0000742810672313 BackstromJRLimGPCullenMJTökésZAMatrix metalloproteinase-9 (MMP-9) is synthesized in neurons of the human hippocampus and is capable of degrading the amyloid-beta peptide (1–40)J Neurosci1679107919199610.1523/JNEUROSCI.16-24-07910.19968987819 ItoSKimuraKHanedaMIshidaYSawadaMIsobeKIInduction of matrix metalloproteinases (MMP3, MMP12 and MMP13) expression in the microglia by amyloid-beta stimulation via the PI3K/Akt pathwayExp Gerontol42532537200710.1016/j.exger.2006.11.01217198748 LorenzlSBuergerKHampelHBealMFProfiles of matrix metalloproteinases and their inhibitors in plasma of patients with dementiaInt Psychogeriatr206776200810.1017/S104161020700579017697439 NüblingGLevinJBaderBIsraelLBötzelKLorenzlSGieseALimited cleavage of tau with matrix-metalloproteinase MMP-9, but not MMP-3, enhances tau oligomer formationExp Neurol237470476201210.1016/j.expneurol.2012.07.01822890115 PotiFCeglarekUBurkhardtRSimoniMNoferJRSKI–II-a sphingosine kinase 1 inhibitor-exacerbates atherosclerosis in low-density lipoprotein receptor-deficient (LDL-R-/-) mice on high cholesterol dietAtherosclerosis240212215201510.1016/j.atherosclerosis.2015.03.02025801013 LeeJYHanSHParkMHBaekBSongISChoiMKTakuwaYRyuHKimSHHeXNeuronal SphK1 acetylates COX2 and contributes to pathogenesis in a model of Alzheimer's diseaseNat Commun91479201810.1038/s41467-018-03674-229662056 UddinMSLimLWGlial cells in Alzheimer's disease: From neuropathological changes to therapeutic implicationsAgeing Res Rev78101622202210.1016/j.arr.2022.10162235427810 CherifiCLatourteAVettorazziSTuckermannJProvotSEaHKLedouxACasasJCuvillierORichettePInhibition of sphingosine 1-phosphate protects mice against chondrocyte catabolism and osteoarthritisOsteoarthritis Cartilage2913351345202110.1016/j.joca.2021.06.00134144150 LaiWQIrwanAWGohHHHoweHSYuDTValle-OñateRMcInnesIBMelendezAJLeungBPAnti-inflammatory effects of sphingosine kinase modulation in inflammatory arthritisJ Immunol18180108017200810.4049/jimmunol.181.11.801019017993

Effects of NGR1 on cell viability and apoptosis in PC12 cells. (A) Cell experiment design. (B) Viability of PC12 cells treated with 20 µM Aβ25-35 and different concentrations of NGR1 for 24 h as examined using an MTT assay. n=6. (C) mRNA expression levels of Bax, Bcl-2 and Caspase3 in PC12 cells. n=6. (D) Representative confocal images of TUNEL-positive (green) apoptotic cells and DAPI-labeled nuclei (blue) of PC12 cells. Scale bar, 50 µm. n=3. (E) Apoptotic rate quantification. Data are presented as the mean ± SEM. *P<0.05, **P<0.01 vs. untreated control group; #P<0.05, ##P<0.01 vs. 20 µM Aβ25-35 group. Aβ25-35, amyloid-β-protein fragment 25–35; NGR1, notoginsenoside R1.

Effects of NGR1 on the inflammatory response in PC12 cells. (A) mRNA expression levels of SphK1, MMP-3 and MMP-9 in PC12 cells incubated with 20 µM Aβ25-35 and different concentrations of NGR1 for 24 h. n=6. (B) Protein levels of SphK1, NF-κB p-p65 and total NF-κB p65 and their corresponding loading controls in PC12 cells. (C) Semi-quantification of the protein levels of SphK1, NF-κB p-p65 and total NF-κB p65 in PC12 cells. n=4. Data are presented as the mean ± SEM. *P<0.05, **P<0.01 vs. untreated control group; #P<0.05, ##P<0.01 vs. 20 µM Aβ25-35 group. Aβ25-35, amyloid-β-protein fragment 25–35; NGR1, notoginsenoside R1; p-, phosphorylated; SphK1, sphingosine kinase 1.

Effects of pharmacological inhibition of Sphk1 on Aβ25-35-induced apoptosis and inflammation in PC12 cells. (A) mRNA expression levels of Bax, Bcl-2 and Caspase3 in PC12 cells treated with 20 µM Aβ25-35 and 1,000 µg/ml NGR1 with or without 10 µM SKI–II. n=6. (B) Representative confocal images and apoptotic rate quantifications of TUNEL-positive (green) apoptotic cells and DAPI-labeled nuclei (blue) of PC12 cells. Scale bar, 50 µm. n=3. (C) mRNA expression levels of SphK1, MMP-3 and MMP-9 in PC12 cells. n=6. (D) Protein levels of SphK1, NF-κB p-p65 and total NF-κB p65 in PC12 cells. (E) Semi-quantification of the protein levels of SphK1, NF-κB p-p65 and total NF-κB p65 and their corresponding loading controls in PC12 cells. n=4. Data are presented as the mean ± SEM. *P<0.05, **P<0.01 vs. untreated control group; #P<0.05, ##P<0.01 vs. 20 µM Aβ25-35 group. Aβ25-35, amyloid-β-protein fragment 25–35; NGR1, notoginsenoside R1; ns, not significant; p-, phosphorylated; SKI–II, SphK1 inhibitor II; SphK1, sphingosine kinase 1.

Effects of siRNA-mediated knockdown of Sphk1 on Aβ25-35-induced apoptosis and inflammation in PC12 cells. (A) mRNA expression levels of Bax, Bcl-2 and Caspase3 in PC12 cells transfected with si-Control and si-Sphk1. N=6. (B) Representative confocal images and apoptotic rate quantifications of TUNEL-positive (green) apoptotic cells and DAPI-labeled nuclei (blue) of PC12 cells. Scale bar, 50 µm. N=3. (C) mRNA expression levels of SphK1, MMP-3 and MMP-9 in PC12 cells. N=6. (D) Protein levels of SphK1, NF-κB p-p65 and total NF-κB p65 and their corresponding loading controls in PC12 cells. (E) Semi-quantification of the protein levels of SphK1, NF-κB p-p65 and total NF-κB p65 in PC12 cells. n=4. Data are presented as the mean ± SEM. *P<0.05, **P<0.01 vs. negative control (no treatment or transfection); #P<0.05, ##P<0.01 vs. si-control + 20 µM Aβ25-35 group; &&P<0.01 vs. si-control + 20 µM Aβ25-35 + 1,000 µg/ml NGR1group. Aβ25-35, amyloid-β-protein fragment 25–35; NGR1, notoginsenoside R1; ns, not significant; p-, phosphorylated; siRNA/si, small interfering RNA; SphK1, sphingosine kinase 1.

Primer sequences.

Name Forward primer (5′-3′) Reverse primer (5′-3′)
r. Bax GAACTGGACAACAACATGGA GCAAAGTAGAAAAGGGCAAC
r. Bcl-2 GGGTCATGTGTGTGGAGAG AGCCAGGAGAAATCAAACAG
r. Caspase3 GAGCTTGGAACGCGAAGAAAA ACACAAGCCCATTTCAGGGTA
r. SphK1 CGCCTGGGCAACACCGATAA GGCTACATAGGGGTTTCTGG
r. MMP-3 ACCTATTCCTGGTTGCTGCT CAGGTCTGTGGAGGACTTGT
r. MMP-9 AGTGCCCTTGAACTAAGGCT GCCTCCACTCCTTCCTAGTC
r. GAPDH ATGGAGAAGGCTGGGGCTCACCT AGCCCTTCCACGATGCCAAAGTTGT

r., rat; SphK1, sphingosine kinase 1.