Human VSMCs (T/G HA-VSMC cell line; passage 2) were purchased from Shanghai Jinyuan Biotechnology Co., Ltd. (cat. no. JY524) and cultured in Dulbecco's modified Eagle's medium (DMEM; Gibco; Thermo Fisher Scientific, Inc.) containing 10% fetal bovine serum (FBS; Gibco; Thermo Fisher Scientific, Inc.) and 100 U/ml penicillin and 0.1 mg/ml streptomycin (Gibco; Thermo Fisher Scientific, Inc.) at 37˚C with 5% CO₂. VSMCs were passaged at 1:2, and passages 3-5 were used for the experiments. A concentration of 20 ng/ml PDGF-BB (MilliporeSigma) was used to stimulate the VSMCs at 37˚C for 24 h. In addition, in certain experiments the cells were pre-treated with the Akt activator SC79 (MilliporeSigma) at 10 µM for 2 h (19).

Total RNA was extracted from the cells using VeZol reagent (cat. no. R411; Vazyme Biotech Co., Ltd.). The HiScript II 1st Strand cDNA synthesis kit (cat. no. R211; Vazyme Biotech Co., Ltd.) was used to reverse transcribe the isolated RNA into cDNA according to the manufacturer's protocols. qPCR was then performed using synthetic primers and AceQ^® qPCR SYBR Green Master Mix (cat. no. Q111-02; Vazyme Biotech Co., Ltd.) with a Stepone™ Software v2.3 Detection System (Thermo Fisher Scientific, Inc.). The conditions were 95˚C for 30 sec, and 40 cycles of 95˚C for 5 sec, 55˚C for 10 sec and 72˚C for 15 sec. The mRNA levels of CNPY2 were normalized to those of GAPDH and calculated using the 2^-ΔΔCq method (20). The primer sequences (5'-3') were as follows: CNPY2, forward, TAGTGGGCCGGAATGGAGAA and reverse, AAACTTGAGGGTGCCGCTAA; GAPDH, forward, GACTCATGACCACAGTCCATGC and reverse, AGAGGCAGGGATGATGTTCTG.

Proteins were extracted from the cells (5x10⁶) using RIPA lysis buffer (Beyotime Institute of Biotechnology). The protein concentration of the extract was determined using a BCA kit (Beyotime Institute of Biotechnology). A total of 30 µl protein/lane was then separated using 10% SDS-PAGE and transferred to PVDF membranes (SEQ00010; MilliporeSigma). After blocking the membranes with bovine serum albumin (BSA; 5%, v/v; Elabscience Co., Ltd.) at room temperature for 2 h, the membranes were incubated overnight at 4˚C with primary antibodies against CNPY2 (PA5-100135; 1:1,000; Invitrogen; Thermo Fisher Scientific, Inc.), OPN (22952-1-AP; 1:2,000; Proteintech), smooth muscle actin (SMA; 14395-1-AP; 1:3,000; Proteintech), F-actin (MA1-80729; 1:500; Invitrogen; Thermo Fisher Scientific, Inc.), phosphorylated (p-)Akt (66444-1-Ig; 1:20,000; Proteintech), Akt (60203-2-Ig; 1:20,000; Proteintech), p-mTOR (67778-1-Ig; 1:5,000; Proteintech), mTOR (28273-1-AP; 1:5,000; Proteintech), p-GSK-3β (67558-1-Ig; 1:5,000; Proteintech), GSK-3β (22104-1-AP; 1:4,000; Proteintech) and GAPDH (PA1-16777; 1:5,000; Invitrogen; Thermo Fisher Scientific, Inc.). The membranes were washed with TBST (0.05% Tween 20), and then incubated for 120 min at room temperature with secondary antibodies (cat. nos. 31460 and 31430; 1:100,000; Invitrogen; Thermo Fisher Scientific, Inc.). Enhanced chemiluminescence Western Blotting Substrate (32109; Pierce; Thermo Fisher Scientific, Inc.) was used to visualize the bands, and the density of the protein bands was semi-quantified using ImageJ software version 1.8.0 (National Institutes of Health).

To inhibit CNPY2, the two human CNPY2-targeting pRNAT-U6.1/Neo short hairpin RNAs (shRNAs; 1 µg; sh-CNPY2#1 and sh-CNPY2#2; Guangzhou Ribobio Co., Ltd.) were respectively transfected into cells using Lipofectamine 2000^® (Invitrogen; Thermo Fisher Scientific, Inc.). Cells transfected with the same plasmid carrying non-targeting shRNAs served as the negative control (sh-NC). Target sequences were as follows: sh-CNPY2#1, CGAACAGATCTTTGTGACCAT; sh-CNPY2#2, CTTTGCAGTAAGCGAACAGAT; and sh-NC, TTCTCCGAACGTGTCACGT. Complexes of Lipofectamine and shRNA in serum-free DMEM were added to VSMCs at ~70% confluence. Knockdown efficacy was determined 48 h after transfection at 37˚C (21).

The cells were plated in 96-well plates (1x10³/well) and then subjected to the aforementioned treatments. Then, 100 µl CCK-8 solution (Dojindo Laboratories, Inc.) was added to the cells for 2 h, after which the optical density was measured at 450 nm using a microplate reader (Thermo Fisher Scientific, Inc.).

The cells were plated in six-well plates (1x10⁵/well) and subjected to treatment. The cells were then incubated at 37˚C in 20 µM EdU solution from an EdU Cell Proliferation Image Kit (cat. no. KTA2030; Abbkine Scientific Co., Ltd.) for 2 h, and fixed in 4% formaldehyde for 30 min at room temperature (22). The cells were permeated by 0.3% Triton X-100 for 10 min and subsequently exposed to reaction solution (Abbkine Scientific Co., Ltd.) for 30 min, followed by DAPI staining (cat. no. E607303; Sangon Biotech Co., Ltd.) for 30 min at room temperature. Images were captured and analyzed using an inverted fluorescence microscope (Axio Observer Z1; Zeiss AG).

The cells were plated in six-well plates (1x10⁵/well) and were then subjected to treatment. The Cell Cycle Assay Kit (cat. no. E-CK-A351; Elabscience Biotechnology, Inc.) was used for analysis of the cell cycle. Cells were harvested after digestion with 0.25% trypsin (Vazyme Biotech Co., Ltd.), and the supernatant was discarded. The cells were washed with ice-cold PBS and collected after centrifugation at 850 x g for 5 min at 4˚C. Precooled 70% ethanol was used to immobilize the cells at 4˚C for 2 h and then the cells were washed with PBS. Subsequently, the cells were incubated with RNase reagent for 30 min at 37˚C and propidium iodide for 30 min at 4˚C in the dark (23). The cell cycle status was then assessed using flow cytometry (BD Bioscience; excitation wavelength 488 nm) and analyzed using FlowJo version 10 software.

The treated VSMCs (1x10⁴/well) in serum-free DMEM were plated in the upper chambers of 24-well Transwell plates (pore size, 8.0 µm; Corning, Inc.) and the lower chambers were supplemented with 10% FBS in DMEM. Following 24 h of incubation at 37˚C, the cells on the lower surface of the Transwell membranes were fixed with 4% formaldehyde for 20 min and stained with 0.1% crystal violet at 25˚C for 15 min (24). The migratory cells were observed under a light microscope (BX51W; Olympus Corporation).

A cell layer of the treated VSMCs were scratched using a pipette tip to form a straight scratch wound. The cell layer was incubated with serum-free DMEM for 24 h. Images of the wound were captured using a light microscope (BX51W; Olympus Corporation) at 0 and 24 h. Cell migration was analyzed using ImageJ software version 1.8.0 (National Institutes of Health).

The treated cells were fixed with 4% paraformaldehyde at room temperature for 10 min and blocked with 1% BSA (MilliporeSigma) at room temperature for 30 min, followed by overnight incubation with F-actin primary antibody (MA1-80729; 1:20; Invitrogen; Thermo Fisher Scientific, Inc.) at 4˚C, and then incubation with goat anti-mouse Alexa Fluor^™ 488 secondary antibody (A-11001; 1:2,000; Invitrogen; Thermo Fisher Scientific, Inc.) at room temperature for 1 h. Cell nuclei were then stained with DAPI for 5 min at room temperature. Six random high-power fields were selected, and images were obtained using a fluorescence microscope (Axio Observer Z1).

Data are presented as the mean ± SD (n≥3). Statistically significant differences between experimental parameters among the groups were analyzed using one-way ANOVA followed by Tukey's test or by unpaired Student's t-test using GraphPad Prism Software Version 6.0 (Dotmatics). P<0.05 was considered to indicate a statistically significant difference.

After stimulation of the VSMCs with PDGF-BB, the expression of CNPY2 was detected using RT-qPCR and western blot analysis. The results revealed that compared with the untreated control group, the expression of CNPY2 in the PDGF-BB-stimulated cells was significantly increased (Fig. 1A). A CNPY2 interference plasmid was then constructed, and the transfection efficacy was detected using RT-qPCR and western blot analysis (Fig. 1B). Since the interference efficiency achieved with sh-CNPY2#2 was stronger than that of sh-CNPY2#1, sh-CNPY2#2 was selected for use in the follow-up experiments and is henceforth referred to as sh-CNPY2. CCK-8 and EdU assays were used to detect cell viability and proliferation, respectively. The results revealed that the viability and proliferative ability of cells in the PDGF-BB group were increased compared with those in the control group. In addition, cell viability and proliferation in the PDGF-BB + sh-CNPY2 group were decreased compared with those in the PDGF-BB + sh-NC group (Fig. 1C and D). Flow cytometric analysis revealed that the number of cells in the G₀/G₁ phase decreased, and that in the S phase increased following stimulation with PDGF-BB, indicating that the cells were proliferating. In the PDGF-BB + sh-CNPY2 group compared with the PDGF-BB + sh-NC group, the number of cells in the G₀/G₁ phase increased, while that of cells in the S phase decreased, indicating that sh-CNPY2 blocked cell proliferation (Fig. 1E and F).

The results of wound healing and Transwell assays revealed that the migratory ability of the VSMCs significantly increased following stimulation with PDGF-BB, and the knockdown of CNPY2 expression significantly attenuated the PDGF-BB-induced migration of the cells (Fig. 2A and B). When observed under a microscope, it was observed that following stimulation with PDGF-BB, the morphology of the VSMCs flattened and the cell bodies increased in size, exhibiting a low degree of differentiation. However, compared with those in the PDGF-BB + sh-NC group, the cell bodies of the PDGF-BB + sh-CNPY2 group were normalized and exhibited a high degree of differentiation (Fig. 2C). The IF staining of cytoskeletal F-actin also showed that the cell morphology was flattened following stimulation with PDGF-BB, and revealed that the content of myofilaments and structural proteins decreased. However, in comparison with the contents of myofilaments and structural proteins in the PDGF-BB + sh-NC group, those in the PDGF-BB + sh-CNPY2 group were increased (Fig. 2D). Western blot analysis demonstrated that in the PDGF-BB group compared with the control group, the expression of OPN was significantly increased, while that of SMA and F-actin was significantly decreased. In addition, in the PDGF-BB + sh-CNPY2 group, OPN expression was significantly decreased while SMA and F-actin expression was significantly increased compared with that in the PDGF-BB + sh-NC group (Fig. 2E).

Western blot analysis of the proteins in the Akt/mTOR/GSK-3β signaling pathway revealed that the ratios of p-Akt, p-mTOR and p-GSK-3β protein levels to those of the respective total proteins in the cells was significantly increased following stimulation with PDGF-BB. However, the knockdown of CNPY2 expression significantly inhibited the PDGF-BB-induced upregulation of p-Akt, p-mTOR and p-GSK-3β protein levels (Fig. 3).

To further explore the regulatory mechanisms of CNPY2, the cells were pretreated with the Akt activator SC79. The results of CCK-8 and EdU staining revealed that the cell viability and proliferative capacity of the PDGF-BB + sh-CNPY2 + SC79 group were significantly increased compared with those of the PDGF-BB + sh-CNPY2 group (Fig. 4A and B). Also, flow cytometric analysis demonstrated that the cell cycle and cell proliferation were accelerated in the PDGF-BB + sh-CNPY2 + SC79 group compared with the PDGF-BB + sh-CNPY2 group (Fig. 4C). The results of the wound healing and Transwell assays indicated that the migratory abilities of the VSMCs were significantly increased in the PDGF-BB + sh-CNPY2 + SC79 group compared with the PDGF-BB + sh-CNPY2 group (Fig. 5A and B). In addition, IF staining demonstrated that the content of myofilaments and structural proteins in the PDGF-BB + sh-CNPY2 + SC79 group was reduced compared with that in the PDGF-BB + sh-CNPY2 group (Fig. 5C). Furthermore, western blotting indicated that OPN expression in the PDGF-BB + sh-CNPY2 + SC79 group was significantly increased compared with that in the PDGF-BB + sh-CNPY2 group, while SMA and F-actin expression was significantly decreased (Fig. 5D).