HIV attacks the human immune system and targets CD4+T lymphocytes, which are important immune cells. The introduction of highly active antiretroviral therapy (HAART) has markedly improved outcomes in patients with HIV infection and long-term survival can be expected even following the onset of acquired immune deficiency syndrome (1). However, patients with HIV are at increased risk of cancer due to oncogenic factors, including the immune dysregulated state, direct pathogenicity of the virus, chronic stimulation and prolonged drug exposure (2). Acute promyelocytic leukemia (APL), the French-American-Britain classification of acute myeloid leukemia (AML)-M3 (3), is distinct among AML subtypes due to its unique prognosis and pathogenesis. The malignant clone is characterized by a specific translocation t(15;17), which results in rearrangement the retinoic acid receptor α (RARα) genes and promyelocytic leukemia (PML) (4). The resulting protein product interferes with maturation of the immature myeloid morphology (5). APL is now a highly curable disease with an overall response rate of 95% and current cure rate is >80% (5). The incidence of HIV with APL is extremely rare, with only 12 cases reported to date, and it is even rarer in the chromosomally complex APL population. Due to the small number of cases, there is no uniform standard of treatment for APL complicated with HIV, and the prognosis remains unclear (2,4,6–14). The status of patients infected with HIV and initiation and course of chemotherapy are increasingly a cause of concern due to the highly effective HAART and its success in controlling viral load (6,7). The present report describes a case of high-risk APL with additional chromosomal abnormalities and HIV infection and discusses the existing literature on this unique population.

A 49-year-old previously healthy female patient presented in July 2022 following abdominal pain for 1 week and intermittent mild fever combined with fatigue for 3 days. Before admission to The First Affiliated Hospital of Jishou University (Jishou, China), the patient was admitted to Fenghuang County People's Hospital (Fenghuang, China) at which the initial hematological assessment determined the following: An elevated white blood cell (WBC) count of 40.97×10⁹/l (normal range, 4.0–10.0×10⁹/l); neutrophil count, 4.30×10⁹/l (normal range, 1.8–6.3×10⁹/l); platelet count of 14×10⁹/l (normal range, 100–400×10⁹/l) and a hemoglobin, 75 g/l (normal range, 110–150 g/l) (15). Whole abdominal computed tomography (CT) scan (KVP:120, MA:177, SL-573.5MM, TITLE:0, Head 5.0, Hr40 3) and abdominal standing films showed no abnormalities. Intravenous cephalosporin antibiotic administration (2 g ceftazidim twice/day for 4 days) and fluid replacement were used to control the fever but the efficacy was limited. Subsequently, the patient was admitted to the Emergency Department of The First Affiliated Hospital of Jishou University for further diagnosis and treatment in July 2022.

Physical examination revealed an afebrile case with conjunctival pallor and abdominal tenderness without tonsillar exudates. Old ecchymosis was visible on the skin without fresh petechiae and ecchymoses. There was no hepatosplenomegaly or lymphadenopathy. Physical examination of the heart and lungs showed no positive signs. The patient had no history of tobacco, alcohol or illicit drug use.

Laboratory assessment demonstrated the following: Hemoglobin, 66 g/l; total leukocyte count, 41.86×10⁹/l; platelet count of 9×10⁹/l and reticulocyte count of 32.3×10⁹/l. Blood tests showed differential leukocyte counts were as follows: 19.8% neutrophils, 12.9% lymphocytes and 66.5% monocytes (Table I). Immature cells and rod-shaped bodies were visible but no schistocytes were observed in the peripheral blood smear. Prothrombin time and activated partial thromboplastin time were 17.4 and 41.6 sec, respectively. Fibrinogen levels were 1.294 g/l, D-dimer levels were 23.97 µg/ml and fibrin monomer concentration was 40.05 µg/ml. Serum potassium levels were 2.79 mmol/l and lactate dehydrogenase concentration was 808 U/l. Serum electrolytes, calcium, magnesium, urea and creatinine were within normal range. Liver function tests were normal. Hepatitis B surface antigen index was 2362.00 and the HIV antibody index was 1303.00. The hepatitis B virus (HBV) titer was 2.96×10³ IU/ml, as evidenced by HBV-DNA virus nucleic acid quantitative detection-internal standard quantification (High Pure Viral Nucleic Acid kit, Roche Diagnostics, Mannhein, Germany). The lymphocyte subsets [analyzed by flow cytometry (MoFlo^® Astrios; Beckman Coulter) (16)] were as follows: Lymphocytes, 4.01%; B lymphocytes, 22.99%; helper/induced T lymphocytes, 21.30%; CD4/CD8, 0.55% and absolute helper/induced T lymphocytes count, 335.00/µl.

Based on morphology (cells from the bone marrow aspirate smears stained with Wright's stain for 10–15 min and myeloperoxidase respectively. For myeloperoxidase staining: 10–15 drops of 0.3% benzidine ethanol solution in the slices, after 1 min, 10–15 drops of hydrogen peroxide solution were added for 5 min. Slides were rinsed and Wright's stain was added for 30 min, followed by another rinse. Images were captured using an optical microscope at magnifications, ×10 and ×100) (Fig. 1), 92% of marrow cells were promyelocytes [myeloperoxidase (MPO+++)]. These variant (monocytoid) promyelocytes expressed CD13, CD33, cMPO and human leukocyte antigen-DR, whilst CD34 and CD19 were absent. Monocytic markers were either absent (CD14) or scarcely expressed (CD64). Cytogenetic analysis revealed an abnormal female karyotype [46, XX, add(5)(q15), add(5)(q31), add(7)(q11.2), add(12)(p13), t(15;17)(q24; q21)[19]/46, XX; Fig. 2], whilst myeloid leukemia fusion gene results were negative for AML1/ETO, mixed-lineage leukemia and core-binding factor subunit β rearrangements. For fusion gene detection, leukemia-associated fusion gene analysis detected positive expression of PML-RARα, and negative expression of BCR/ABL1, MLL/ELL, MLL/SEPT6, SET/CAN, TEL/PDGFRB, TLS/ERG, MLL/AF6, NPM1/RARα, TEL/ABL1, AML1/ETO, CBFβ/MYH11, PLZF/RARα, FIP1L1/PDGFRA, DEK/CAN, AML1-MDS1/EVI1, AML1/MTG16, AML1/EAP, NPM1/MLF, MLL/AF9, MLL/AF10, MLL/ENL, MLL/AF17, MLL/AF1q, MLL/AF1p (Total RNA was extracted from the patient's bone marrow mononuclear cells by TRIzol method. The reaction solution was prepared according to the instructions of leukemia fusion gene detection kit, and the amplification reaction was performed by ABI7500 amplification instrument). For the mutated gene fraction, sample transfer/genomic DNA levels were detected by deep target sequencing (Next-generation sequencing; NGS). Gene mutations in AML suggested the following: Calreticulin (CALR) p.E371fs, variant abundance, 2.40%) and lysine methyltransferase 2C (KMT2C) p.H1826R, variant abundance, 49.30%. NGS was performed by Golddomain Medicine/Guangzhou Jinyu Inspection using DNA extracted from bone marrow mononuclear cells of the patient Using illumina platform NextSeq550 sequencing platform (Thermo Fisher Scientific, Inc.), 72 genes (ANKRD26, ABCB1, ARID1A, ARID1B, ARID2, ASXL1, ASXL2, ATG2B, BCOR, BCORL1, BRAF, CALR, CBL, CEBPA, CREBBP, CSF3R, CTCF, DDX41, DIS3, DNMT3A, ETNK1, ETV6, EZH2, FLT3, GATA1, GATA2, GFI1, GNB1, GSKIP, HRAS, IDH1 IDH2 IKZF1 JAK1 JAK2 JAK3 KDM6A KIT KMT2A KMT2C KRAS MPL MYC NBN NF1 NPM1 NRAS NTRK1 PHF6 PML PPM1D PTPN11 RAD21 RARA RUNX1 SBDS SETBP1 SETD2 SF3B1 SMC1A SMC3 SRSF2 STAG2 STAT5A TERC TERT TET1 TET2 TP53 U2AF1 WT1 ZRSR2) of patients were deeply sequenced by targeted amplicon method (NGS amplicon sequencing primers were designed and synthesized by Thermo Fisher company). Sequencing depth of 170-fold.] Reverse transcription (RT)-qPCR testing was positive for the PML/RARα translocation [Type L; PML-retinoic acid receptor α (RARα) gene copy number, 15,006 copies; ABL1 gene copy number, 138499 copies; PML-RARα/ABL1:10.835%; The relative quantitation of PML/RARa=(copiesPML/RARa/copiesABL) ×100% (17)]. PML-RARα mRNA expression was measured using RT-qPCR [The patient's bone marrow RNA was reverse-transcribed onto the cDNA and tested for PML/RAR α transcripts with primers: forward, 5′-GCAATTTAGGTATGAAAGCCAGC-3′, and reverse, 5′-CTTTCAGCATTTTGACGGCAACC-3′; and fluorescein amidite-labeled probe (Boshang Biotechnology Co., Ltd.): 5′-CTGCTCTGGGTCTCAATGGCTGCCTCC-3′; ABL was used as the reference gene and detected with the primers: forward, 5′-TCCATCTCGCTGAGATACGAAG-3′, and reverse, 5′-ATGATGAACCAACTCGGCCA-3′; and VIC-labeled probe 5′CAACACTGCTTCTGATGGCAAGCTCTACG3′. RT-qPCR was tested for 2 min at 50°C, pre-denatured for 3 min at 95°C, and then 40 cycles of denatured for 5 sec at 95°C, annealed and extended for 30 sec at 58°C were performed using the ABI 7500 Real-time PCR system. Data was collected and analyzed using ABI 7500 software v2.3 (Thermo Fisher Scientific, Inc.)].

Chest CT and electrocardiography were normal. Multigated equilibrium radionucleotide cineangiography revealed normal cardiac wall motion and ejection fraction of 58%. However, cranial CT suggested a subarachnoid hemorrhage (Fig. 3).

Remission was induced using all-trans-retinoic acid (ATRA; 25 mg/m²). The patient was administered Pirarubicin hydrochloride (45 mg/m²) via a continuous intravenous infusion over 24 h (20 mg for 3 day, 10 mg × 2 day) and arsenic trioxide (ATO; 0.16 mg/m²) as an intravenous bolus once daily for three days. As the corrected QT interval of the patient increased from normal to 492 msec, ATO was intermittently used during induction. The patient developed differentiation syndrome during chemotherapy but it did not recur following ATRA dose reduction (20 mg twice/day). In the absence of disseminated intravascular coagulation, heparin was not administered. Red cells, platelets, fibrinogen and cryoprecipitate were transfused as required.

Following discussion with the Department of Infection, HAART was initiated during the induction. HAART regimen comprised efavirenz (600 mg daily) and lamivudine (300 mg daily). Simultaneously, the patient received anti-HBV therapy (tenofovir disoproxil fumarate, 300 mg daily) due to infection with hepatitis B. A total of 4 weeks later, the CD4+ T cell count was decreased, whilst the HIV-1 titer was below the normal range of detection values.

Following one cycle of chemotherapy, the patient was in complete morphological remission (CMR; Fig. 1C and D). Subsequently, the patient was administered one cycle of consolidation chemotherapy with idarubicin (IDA; 8 mg/sqm/d; days 1–3; bolus intravenous injection) and cytosine arabinoside (1 g/sqm/12 h; days 1–3, continuous intravenous infusion), and HAART was administered throughout. The chromosome karyotype of the patients was normalized after chemotherapy. As of January 2024 (Fig. 4), the patient is receiving regular chemotherapy, but is asymptomatic and has tolerated both chemotherapy and HAART well; however, there is risk of recurrence and need further observation

HIV attacks the human immune system and may increase risk of malignant tumors, which may be associated with oncogenic factors, including immune dysregulation status, direct viral pathogenicity, chronic stimulation and long-term medication exposure. An association between HIV infection and several types of malignancy has been reported (1). Although the most frequent neoplasms are non-Hodgkin lymphoma, Kaposi sarcoma and invasive cervical carcinoma, other cancers are increasingly reported (2,18). A few cases of AML have been described in patients with AML and HIV infection (9,10). As the incidence of APL in patients infected with HIV is sporadic, the therapeutic approach is individualized and often challenging (2,4,8). Recently, with the advent of novel therapies, survival of patients with HIV and APL has improved but there are no relevant guidelines for treatment of the concomitant HIV and APL (6,7,9–14). Therefore, evaluating the mechanism and clinical characteristics of these cases is important. The present report described a case of an HIV-positive patient with a high-risk AML M3L presenting with hyperleukocytosis complicated by hematencephalon and prolonged QT interval during induction therapy. HIV may also infect monocytes and macrophages in addition to functioning as a tropic retrovirus and neurotropic virus for helper inducer (CD4) lymphocytes (19). This increases DNA-binding activity of the NF-κB transcription factor, which can further activate genes that may be involved in leukemogenesis [for example, IL-6, granulocyte-colony stimulating factor (CSF) or granulocyte-macrophage-CSF] through paracrine or autocrine loops (8). Immunodeficiency may also explain. The high incidence of APL in two disorders associated with chronic T cell abnormality, severe combined immunodeficiency and Wiskott Aldrich syndrome, suggests that an immunodeficient state is associated with APL (2,20). Furthermore, during HIV infection, tumor cells evade immune surveillance via lost or decreased immune response. The development of APL in patients infected with HIV may involve the potent transactivator protein Tat, which serves a crucial role in angiogenesis and can replace the preformed basic fibroblast growth factor (bFGF). bFGF increases myelopoiesis directly via FGF receptors on myeloid progenitors (21). HIV may also alter the bone marrow microenvironment to make it more favorable for proliferation of leukemic cells (19,21). Lastly, in the era of ART, the improvement in survival rate following HIV infection has led to an increase in long-term morbidity, including APL. Exposure to drugs, including cell inhibitors, HIV nucleoside analogs, benzene, alkanes and cytotoxic molecules, can increase the risk of leukemia complications in patients with HIV. In addition to the aforementioned factors, ionizing radiation can cause chromosome breakage and recombination, along with alterations and mutations in the c-myc and ras genes, which serve an important role in inducing leukemia. The greater the radiation dose, the higher the risk of leukemia. It is hypothesized that the occurrence of APL in HIV may be coincidental but certain authors suggest that incidence of APL is higher in HIV-infected patients (22). Cytopenia of patients with HIV infection is usually attributed to action of viruses and antiviral drugs, and the accompanying malignant tumors of the hematopoietic system are often ignored (23). Therefore, further assessment and monitoring of potential associations is needed to determine the cause of concomitant HIV and APL. Although prognostic variables have been assessed to stratify patients, the data concerning the prognostic relevance of CK are conflicting (24–29). Most patients with APL who have t(15;17) chromosome heterotopia are considered to have a good prognosis, but certain factors affect prognosis including high WBC count, the male sex, elevated serum creatinine levels, advanced age and fibrinogen levels (30). The prognosis of complex chromosome karyotype in patients with AML but no HIV is poor but whether CK affects the prognosis of patients with APL is debatable and, to the best of our knowledge, few studies have assessed this (25,31). The additional chromosome abnormality does not affect overall survival (OS). Moreover, the additional chromosome abnormality population has advantages in duration of complete remission (CR) and event-free survival rate (EFS) (25–26). Wiernik et al (25), through uni- and multivariate survival analysis, reported that treatment regimen with arsenic acid could prolong the disease-free survival of patients with APL and improve prognoses. Arsenic acid and retinoic acid may have a synergistic effect on clearing promyelocytic leukemia clones, thus improving the curative effect (32). Wan et al (27) reported that the additional chromosome does not affect the OS rate but patients with APL carrying additional chromosome abnormalities have delayed recurrence, which may be related to the lack of a serine proline enrichment region in PML-RARα fusion gene S (33). However, Vu et al (28) reported that patients with additional chromosomal abnormalities have aggressive disease, and additional chromosomal abnormalities are independent adverse prognostic factors for these patients. Another study (29) demonstrated inferior EFS for patients harboring complex karyotypes but not for patients harboring additional cytogenetic abnormalities. In conclusion, prognosis of patients with APL with additional chromosomes remains controversial and needs more evidence. At the molecular level, mutations were detected in CALR (p.E371fs) and KMT2C genes in the present patient. CALR is a multifunctional protein with 417 amino acids and is mainly localized in the luminal of the endoplasmic reticulum (34). A study reported that gene expression of CALR is downregulated in patients with APL (35). Another study reported that CALR may participate in clearance of tumor cells by reducing angiogenesis and immune system activation (36). Moreover, increased CALR expression may cause tumor metastasis, which may be associated with lack of matrix attachment or regulation of Ca²⁺ signaling (37). In the nucleus, CALR inhibits the interaction between the retinoic acid receptor and its DNA response elements and CALR silencing causes a significant decrease in both erythroid and MK differentiation of human HSPC (38). KMT2C is an epigenetic modifier gene that participates in histone methylation and affects transcriptional coactivation of gene expression. KMT2C is expressed in several types of tumor tissues, including leukemia, and is among the most frequently mutated genes in human cancer (39). KMT2C is a haploinsufficient tumor suppressor (40) and its inhibition impairs the differentiation of hematopoietic stem cells and progenitor cells. In a study on AML with fms-related receptor tyrosine kinase 3 (FLT3)-internal tandem duplication (ITD) mutations, RFS and OS were markedly decreased in patients with recurrent KMT2C mutations and deletions compared with patients with FLT3-ITD mutations without KMT2C (41). To the best of our knowledge, however, there are no reports of CALR or KMT2C mutations or CK with HIV and more studies are needed to reveal their relevance.

APL is among the highly curable hematological neoplastic diseases with a 10-year OS rate of 93.9% owing to the use of ATRA and ATO (42). A total of 13 cases of APL with HIV have been reported (Tables II and III) (2,4,6–14). Of these, treatment and survival details are unavailable for one case (9). ATRA was used in 12 patients and 10/12 (83.3%) evaluable patients remained in CR at the time of reporting, which is similar to the experience with classic APL (32). For the 13 patients, the median age was 37 years (range, 22–67 years); 9 were male (69.2%) and 4 (30.8%) were female. A total of four cases were in the high-risk and 9 in the low-median group (based on NCCN guidelines) (43). The patients in the high-risk and the low-median group who were still in the CR status at the time of reporting accounted for 50.0 and 88.9%, respectively. The treatment failed for one patient as ATRA was used inappropriately (CR was not maintained for a long period after chemotherapy). A total of 6/12 (50.0%) patients who received chemotherapy-alone were alive during CR at a median follow-up of 10 months, which is consistent with classical APL treated with chemotherapy-alone (44). Thus, even from a small number of cases, it appears that there is no difference in survival between individuals with HIV. However, extensive data are needed to confirm this observation. Therefore, chemotherapy should not be rejected even for patients with HIV. Despite therapeutic advances, early mortality of APL is 32.6–34.6% (45). Hemorrhage remains one of the most common causes of early mortality (46) and mainly occurs in the brain and lungs. High WBC count and prolonged Prothrombin time predict severe bleeding in patients with high-risk APL (47,48). Strategies to reduce early death are key for improving the survival of patients with APL (42). To prevent early death, patients with high risk of early death and hemorrhage should be identified. The patient in the present report suffered from a subarachnoid hemorrhage after diagnosis. Platelet transfusion was administered during induction chemotherapy but the efficacy was not obvious, which may be associated with heavy tumor burden and the immune dysfunction caused by HIV. Platelet transfusion resistance (PTR) refers to persistently inadequate increments in post-transfusion platelet count. It is commonly defined as a corrected count increment of the platelet count <7.5×10⁹/l or a % platelet recovery of <30% within 60 min post-transfusion. PTR can result from non-immune and immune factors; non-immune causes are more common. These factors include infection, disseminated intravascular coagulation, fever (body temperature ≥38°C), bleeding, heparin administration, splenomegaly and intravenous antibiotic use. Immune factors include incompatibility of non-specific antigens, such as human leukocyte antigen class I, ABO, CD36 and human platelet antigen (48,49). Following one cycle of induction chemotherapy and HAART, re-examination of the bone marrow morphology of the patient in the present report revealed CR, effective platelet transfusion and a notably decreased transfusion volume of platelets (Fig. 5), which further confirms that the poor efficacy of platelet transfusion may be related to the high tumor burden. Simultaneously, red blood cell infusion was markedly decreased compared with before (Fig. 6). However, prolonging QT interval is common, especially in frail patients, and attention should be paid to the risk to their heart (50). The patient in the present report experienced repeated prolonging of QT interval during the induction of chemotherapy, during which potassium supplementation and electrocardiogram monitoring were performed, while arsenic treatment was intermittent. The patient in the present report had HIV and APL, and received treatment that is considered to be ‘standard of care’. Standard treatment for APL together with HAART should be used in patients with HIV infection when possible. Attempting to prolong the maintenance treatment cycle may overcome the adverse effects of complex karyotype on relapse-free survival but needs further clinical research. The disease state of patients with APL with complex chromosome karyotype needs to be monitored to identify early recurrence and ultimately improve their prognoses. It is difficult to establish a definite association between HIV and APL due to the scarcity of cases. Multicenter clinical studies are needed to define epidemiology, standardize cytogenetic/molecular features and improve therapeutic management.