The human osteosarcoma cell line MG-63 was obtained from the Cell Bank of the Chinese Academy of Sciences (cat. no. TCHu124) and maintained as monolayer cultures in Dulbecco's modified Eagle's medium/F12 (DF12; cat. no. D8900; MilliporeSigma) supplemented with 5% fetal bovine serum (FBS; MilliporeSigma), penicillin (100 U/ml) and streptomycin (100 U/ml) in an incubator at 37°C with 5% CO₂. The human embryonic kidney cells 293T were obtained from the Cell Bank of the Chinese Academy of Sciences (cat. no. SCSP-502) and maintained as monolayer cultures in Dulbecco's modified Eagle's medium-high glucose (cat. no. D5648; MilliporeSigma) supplemented with 5% fetal bovine serum (FBS; MilliporeSigma), penicillin (100 U/ml) and streptomycin (100 U/ml) in an incubator at 37°C with 5% CO₂. For OSCs, the MG-63 was cultured in serum-free DF12 supplemented with 5 factors (5F), including 10 μg/ml human insulin, 5 μg/ml human transferrin, 10 μM 2-aminoethanol, 10 nM sodium selenite, 10 μM mercaptoethanol, 5 mg/ml bovine serum albumin and 5 ng/ml transforming growth factor-β, as previously described (23,24).

The knockout of DRP1 by CRISPR/Cas9 in the MG-63 cells was performed using the 2nd Lenti-Crispr-vector system (cat. no. 49535; Addgene, Inc.). Lentivirus (5 μg) was amplified from 293T packaging cells with pSPAX2 and pMD2G (cat. nos. 12260 and 12259; Addgene, Inc.) helper plasmids (quantity of plasmids ratio was pSPAX2:pMD2G:Lentivirus=3.75:1.25:5). The virus-containing supernatants were collected at 48 h following transfection. The supernatants, with 5% PEG8000 were centrifuged at 4,000 × g for 2 h at 4°C to concentrate the lentiviral particles, diluted in 200 μl PBS and then stored at -80°C. The MG-63 cells were then transfected with the lentivirus (40 μl lentivirus in 2 ml DF12; with a multiplicity of infection of 10 for lentiviral vectors) for 8 h at 37°C then selected with 1 μg/ml puromycin (cat. no. A1113803; Gibco; Thermo Fisher Scientific, Inc.). The time interval between transduction and subsequent experimentation was 48 h to allow sufficient expression of the transgene. The single guide (sg)RNA-DRP1 primers were as follows: Sequence 1, AUAUUCUGUUUUCAGAGCAG and sequence 2, GAGCUCAGUGCUAGAAAGCC.

Total RNA was extracted from the cells (1×10⁶ cells per well in a 6-well plate) using an EZ-press RNA Purification kit (cat. no. B0004DP; EZBioscience) and equal amounts of RNA were reverse-transcribed into cDNA using the First Strand cDNA Synthesis kit, ReverTraAce (cat. no. FSQ-201; Toyobo Life Science). RNA extraction and cDNA synthesis were performed according to the manufacturer's protocols. RT-qPCR was performed using a LightCycler 480 SYBR-Green I Master (Roche Diagnostics) according to the manufacturer's instructions. The thermocycling conditions were applied at 95°C for 5 min, followed by 40 cycles of 95°C for 10 sec (denaturation), 60°C for 20 sec (annealing) and then at 72°C for 20 sec (extension). mRNA expression was normalized to GAPDH using the 2^−ΔΔCq method (25). All the experiments were carried out at least three times independently. The primers used for RT-qPCR are listed in Table SI.

The cells were lysed by RIPA lysis buffer (cat. no. P0013K; Beyotime Institute of Biotechnology) containing a protease inhibitor cocktail (cat. no. 04693132001; Roche Diagnostics) on ice for 30 min. The protein concentration was determined using the BCA kit assay (cat. no. 23225; Thermo Fisher Scientific, Inc.). Total cellular proteins were extracted and analyzed by immunoblotting as described previously (23). In brief, a total of 30 μg of protein per lane were separated on 10% SDS-polyacrylamide gel and then transferred to PVDF membranes. Non-fat dried milk (5%; cat. no. 1172GR500; BioFroxx) dissolved in TBST (Tris-buffered saline with 0.5% Tween-20, cat. no. 1115GR500; BioFroxx) was used to block at room temperature for 1 h. The corresponding primary antibodies were incubated overnight at 4°C, followed by the addition of HRP-labeled secondary antibodies at room temperature for 1 h. Enhanced Chemiluminescence (ECL; cat. no. 34580; Thermo Fisher Scientific, Inc.) was employed for visualizing results Subsequently, images were acquired using a CCD system. Densitometry analysis was performed using ImageJ (Version v1.8.0; National Institutes of Health) software. The antibodies used for western blotting are listed in Table SII.

A CCK-8 assay was employed to evaluate the chemoresistance of non-OSCs and OSCs to doxorubicin (DOX) or cisplatin (CIS; cat. nos. HY-15142 and HY-17394; MedChemExpress). Cells were plated in 96-well plates at a density of 5,000 cells/well. Different concentrations (0-25 μM) of CIS or (0-100 μM) DOX were added to the medium for 24 h. After treatments, 10% CCK-8 solution was added into mediums incubated for 2 h and optical density (OD) values were evaluated at 450 nm using a microplate reader. CIS and DOX were dissolved in dimethyl sulfoxide (DMSO) and the equivalent amount of DMSO was added to the control group for consistency in the present study.

The intracellular reactive oxygen species (ROS) were detected by the Reactive Oxygen Species Assay kit (cat. no. S0033S; Beyotime Institute of Biotechnology) which includes 2′,7′-Dichlorodihydrofluorescein diacetate (DCFH-DA) detection. According to the kit protocol, cells were treated with 10 μM DCFH-DA diluted in DF12 for 20 min at 37°C. Fluorescence was detected at 488 nm excitation and 525 nm emission using a Beckman MoFlo Astrios EQs flow cytometer (Beckman Coulter, Inc.). The flow cytometry data were analyzed using FlowJo v10 software (FlowJo LLC).

The intracellular NADPH levels were determined using an NADP⁺/NADPH Assay kit with water-soluble tetrazolium salt 8 (cat. no. S0179; Beyotime Institute of Biotechnology). The absorbance values were measured at 450 nm by recording luminescence using a BioTek Synergy LX multimode reader (BioTek; Agilent Technologies, Inc.). The intracellular ATP levels were determined using an ATP assay kit (cat. no. S0026, Beyotime Institute of Biotechnology). Luminescence was recorded using the same multimode reader with an integration time of 10 sec per well. All the analyses were conducted according to the instructions of the manufacturer.

Cells were seeded in glass-bottom dishes (Standard Imaging, Inc.) and treated with CIS or DOX. OSCs were initially cultured in normal petri dishes and then transferred to glass-bottom dishes for image capture. Cells were stained with PK Mito Red (PKMR) dye (cat. no. PKMR-2; GenVivo, Inc.) at 37°C for 15 min. Images were acquired using a Multimodality Structured Illumination Microscopy (Multi-SIM) imaging system (NanoInsights-Tech) equipped with a 100, 1.49NA oil objective and a Kinetix camera (Photometrics). The PKMR was excited at a wavelength of 561 nm and the resulting images were acquired in 3D-SIM mode with a laser power of 50 mW and an exposure time of either 1 msec (for OSCs) or 2 msec (for non-OSCs). Subsequently, the acquired images were reconstructed using SIM Imaging Analyser software (Version 2.23.9, NanoInsights-Tech). During image acquisition, cells were maintained in a humidified chamber at 37°C under 5% CO₂.

The acquired images were reconstructed using Imaris v9.6.0 (Oxford Instruments plc). The original images were observed in 3D view mode and the surface module was used for 3D rendering. The rendering parameter surface detail was 0.0612. The background subtraction mode was selected and the diameter of the largest sphere was 1 μm (for OSCs)/4 μm (for non-OSCs). The threshold and filter surfaces were adjusted according to the actual conditions of each image. After rendering, mitochondrial parameters including length, volume and sphericity of the mitochondrial network were obtained in a single cell for drawing the density distribution map.

The data were presented as the mean ± standard deviation. A one-way analysis of variance (ANOVA) followed by Tukey's multiple comparisons test was conducted to analyze the among multiple groups. An unpaired two-tailed Student's t-test was used to compare the data between two groups. P<0.05 was considered to indicate a statistically significant difference.

To investigate the mitochondrial morphology of OSCs, OSCs were cultured in a serum-free culture medium as previously described (23,24). When cultured in DF12 supplemented with 5% FBS, cells exhibited characteristics of non-OSCs and demonstrated a monolayer phenotype (Fig. 1A). By contrast, under serum-free conditions, these cells exhibited characteristics of OSCs and displayed a sphere phenotype (Fig. 1A). To assess the chemoresistance of OSCs compared with non-OSCs, the cells were treated with primary clinical chemotherapeutics CIS and DOX. The results indicated that OSCs exhibited a higher level of chemoresistance to CIS or DOX treatment compared with non-OSCs (Fig. 1B). TUNEL staining was employed to assess the apoptotic status of the cells. Non-OSCs exhibited significant apoptosis upon treatment with CIS or DOX compared with the untreated group (Fig. 1C). However, only a few apoptotic cells were detected in the OSCs compared with the non-OSCs group (Fig. 1C). Compared with non-OSCs, OSCs showed significantly increased resistance to apoptosis (Fig. 1D). Overall, these results indicated that the OSCs showed higher chemoresistance compared with non-OSCs.

For an improved characterization and quantitative analysis of mitochondrial morphology and dynamic alteration, particularly fusion and fission status, high-quality mitochondrial images are essential. A schematic illustrated the process of capturing and rendering 3D images of cells (Fig. 2A). The complete structure and network of mitochondria within non-OSCs were visualized (Fig. 2B). This revealed a diverse range of morphologies in non-OSCs, including punctate shapes, linear forms and interconnected networks. Additionally, OSCs exhibited mitochondrial morphologies distinct from those observed in non-OSCs (Fig. 2C). For an improved characterization and quantitative analysis of mitochondrial morphology, videos were created to show the full range of mitochondrial morphologies in both individual non-OSCs and OSCs (Videos S1-S4). To further elucidate the differences in mitochondrial morphologies between non-OSCs and OSCs, the present study analyzed and quantified 10-20 cells for each group, measuring various morphological parameters of whole mitochondria, including length, volume and sphericity. Mitochondria in OSCs exhibited a predominant fusion pattern and reduced sphericity. These findings indicated that mitochondria within OSCs were characterized by increased size and enhanced fusion compared with non-OSCs.

The diverse morphologies of mitochondria could influence mitochondrial functions, including cell survival, apoptosis, metabolism, ROS management and mitophagy (26,27). CIS or DOX triggers apoptosis through mitochondrial pathways involving the release of cytochrome c, generation of ROS and permeabilization mediated by Bax/Bak (28). Following treatment with CIS or DOX, non-OSCs showed higher levels of mitochondrial fragmentation and fission compared with the untreated group (Fig. 3A). Additionally, non-OSCs treated with CIS or DOX showed smaller mitochondrial volume and shorter length, with more homogeneous sphericity distribution compared with the untreated group (Fig. 3B and C). The mitochondrial networks of OSCs did not exhibit significant alterations and their overall morphology remained stable following CIS or DOX treatment (Fig. 3D). Moreover, CIS or DOX treatment did not affect the mitochondrial volume, length and sphericity distribution. These results suggested that CIS or DOX can induce mitochondrial fragmentation and fission in non-OSCs, while having no impact on OSCs. Mitochondria in OSCs exhibited more stable homeostasis compared with non-OSCs when exposed to chemotherapeutics.

Disruption of mitochondrial homeostasis impairs mitochondrial function, affects cellular metabolism and can potentially lead to apoptosis (29). Mitochondria play a crucial role in regulating the metabolism and bioenergetics of cancer cells and their dysfunction can disrupt the production of essential metabolites such as ATP and NADPH (14). To assess mitochondrial function, specific assays were used to measure parameters related to ATP production, NADPH levels and ROS levels. Non-OSCs exhibited significantly reduced intracellular ATP levels following CIS or DOX treatment compared with the untreated group (Fig. 4A). The intracellular ATP levels in OSCs were unaffected by CIS or DOX treatment, compared with the untreated group (Fig. 4A). NADPH/NADP directly affects the redox balance within cells (30). Non-OSCs after the treatment with CIS or DOX showed a significant downregulation of the intracellular NADPH/(NADP⁺ + NADPH) ratio compared with the untreated group (Fig. 4B). However, there was no significant decrease in the NADPH/(NADP⁺ + NADPH) ratio observed in OSCs following CIS or DOX treatment (Fig. 4B). Intracellular ROS was detected by flow cytometry using DCFH-DA staining. The results demonstrated a significant increase in intracellular ROS accumulation in non-OSCs following CIS and DOX treatment, whereas no substantial ROS accumulation was observed in OSCs following exposure to either CIS or DOX (Fig. 4D).

The regulation of mitochondrial dynamics involves specific proteins, including MFN1, MFN2, OPA1 and DRP1. The results of the present study showed that non-OSCs treated with CIS or DOX exhibited significant downregulation of MFN1, MFN2 and DRP1 expression while showing no significant change in OPA1 expression. Conversely, in OSCs treated with CIS or DOX, the expression levels of MFN1, MFN2, DRP1 and OPA1 remained unchanged (Fig. 4D). Western blot analysis was used to detect the protein expression level of DRP1, which showed that non-OSCs had significantly downregulated DRP1 expression following CIS and DOX treatment, while OSCs showed no significant change in DRP1 expression (Fig. 4E). The results suggested that CIS or DOX can induce mitochondrial dysfunction in non-OSCs but not in OSCs. Meanwhile, the expression of MFN1, MFN2 and fission-related DRP1 was downregulated following CIS or DOX treatment; however, this suppression of these genes in OSCs was not observed.

In summary, under CIS or DOX treatment, OSCs maintained mitochondrial stability without significant alterations in ATP or NADPH levels, ROS accumulation, or gene expression. Conversely, non-OSCs exhibited impaired mitochondrial function, characterized by reduced levels of ATP and NADPH, elevated ROS accumulation and suppressed gene expression. These results indicated that OSCs can maintain mitochondrial functional homeostasis during chemotherapy, whereas non-OSCs lack this ability.

Changes in mitochondrial morphology are a continuous process, where mitochondria constantly undergo fusion and fission. Disruption of these processes can lead to dysregulated of mitochondrial homeostasis. The present study used two different sgRNA sequences to knock out DRP1 (OSCs^DRP1-KO, and OSCs^DRP1-KO2) and western blotting was employed to determine the knockout efficiency (Fig. 5A). The two sgRNA sequences demonstrated high knockdown efficiency and OSCs^DRP1-KO2 was selected for further experiments. After sequencing MG-63^DRP1-KO2, a 4-base pair deletion in exon 2 of the DRP1 gene was identified, which caused a frameshift mutation that led to the production of a premature stop codon in exon 5, truncating the protein. This mutation affected the GTPase domain, which is crucial for GTP binding and hydrolysis, both of which are essential for the protein's role in mitochondrial and peroxisomal fission (Fig. S1). The mitochondrial morphology in OSCs^DRP1-KO2 showed increased fusion (Fig. 5B). Further quantitative analysis revealed an increase in mitochondrial volume and length in OSCs^DRP1-KO2 compared with the OSCs^sgcontrol. Additionally, the cellular sphericity distribution did not show any significant change (Fig. 5C). These findings indicate that DRP1 is essential for regulating mitochondrial fission and fusion processes and knockdown of DRP1 leads to significant alterations in the morphology of the mitochondrial network.

To investigate the relationship between changes in mitochondrial morphology and chemoresistance, OSCs^DRP1-KO2 and OSCs^sgcontrol were treated with CIS or DOX at various concentrations. The results indicated that half-maximal inhibitory concentration (IC₅₀) was significantly decreased in OSCs^DRP1-KO2 following the treatments with CIS or DOX (Fig. 6A). TUNEL staining for apoptosis revealed a significant increase in fluorescence in the OSCs^DRP1-KO2 compared with the OSCs^sgcontrol treated with CIS or DOX (Fig. 6B). Furthermore, parameters representing mitochondrial function were assessed. OSCs^DRP1-KO2 exhibited a significant decrease in average intracellular ATP production (Fig. 6C) following CIS or DOX treatment compared with the untreated group. Intracellular NADPH/(NADP⁺+NADPH) in OSCs^Drp-1KO2 showed a significant downregulation following CIS or DOX treatment compared with the untreated group (Fig. 6D). Additionally, knocking out DRP1 in OSCs led to significant intracellular ROS accumulation and reduced chemoresistance following CIS and DOX treatment compared with OSCs^sgcontrol (Fig. 6E). These results underscore the critical role of DRP1 in maintaining chemoresistance and mitochondrial function in OSCs.