Molecular Medicine Reports Molecular Medicine Reports 1791-2997 1791-3004 D.A. Spandidos 10.3892/mmr.2025.13451 MMR-31-4-13451 Articles Lipid mediators obtained from docosahexaenoic acid by soybean lipoxygenase alleviate ovalbumin‑induced allergic asthma in mice by reducing airway inflammation and oxidative stress SuYan 1 2 ChoiHack Sun 3 KwonSoon Kyu 1 HanYunjon 1 ChoSoon-Chang 4 ShinJin Hyuk 4 JangYong-Suk 2 ChoiJong Hyun 1 SeoJeong-Woo 1 Microbial Biotechnology Research Center, Korea Research Institute of Bioscience and Biotechnology, Jeongeup, Jeollabuk 56212, Republic of Korea Department of Bioactive Material Sciences, Jeonbuk National University, Jeonju, Jeollabuk 54896, Republic of Korea Department of Biochemistry and Molecular Biology, Yonsei University College of Medicine, Seoul 03722, Republic of Korea Biocorp Co., Ltd., Goheung-gun, Jeollanam 59551, Republic of Korea Correspondence to: Dr Jeong-Woo Seo or Dr Jong Hyun Choi, Microbial Biotechnology Research Center, Korea Research Institute of Bioscience and Biotechnology, 181 Ipsin-gil, Sinjeong-dong, Jeongeup, Jeollabuk 56212, Republic of Korea, E-mail: jhchoi@kribb.re.kr jwseo@kribb.re.kr 04 2025 03 02 2025 31 4 86 08102024 09012025 Copyright: © 2025 Su et al. 2025 This is an open access article distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivs License, which permits use and distribution in any medium, provided the original work is properly cited, the use is non-commercial and no modifications or adaptations are made.

Asthma is a chronic allergic respiratory disease lacking effective therapies. The present study investigated the anti-asthmatic properties of lipid mediators using an ovalbumin (OVA)-induced allergic asthma model. Lipid mediators (LM; 17S-monohydroxy docosahexaenoic acid, resolvin D5 and protectin DX at a ratio of 3:47:50) were derived from docosahexaenoic acid through soybean lipoxygenase. LM treatment significantly alleviated major features of allergic asthma, including inflammatory cell infiltration, with a particular reduction in eosinophils in bronchoalveolar lavage fluid, downregulation of Th2 cytokine expression, attenuation of airway remodeling, and oxidative stress, thereby closely resembling the normal condition. Additionally, a significant increase in the serum levels of interleukin-6 [167.12±6.25 pg/ml; P<0.0001 vs. negative control (NC) group], tumor necrosis factor-α (109.17±7.17 pg/ml; P<0.0001 vs. NC group) and IgE (90.24±5.98 ng/ml; P<0.0001 vs. NC group) was observed following OVA challenge; however, oral administration of LM resulted in a notable reduction in these levels to 99.45±6.12 pg/ml (P<0.001 vs. OVA group), 62.51±4.03 pg/ml (P<0.001 vs. OVA group) and 56.50±2.70 ng/ml (P<0.001 vs. OVA group), respectively. Furthermore, the heightened expression of Th2-related cytokines induced by OVA was observed to be restored closely to normal conditions following LM treatment, as demonstrated for both gene and protein expression levels. Histological analysis demonstrated that LM mitigated inflammatory cell infiltration while reducing mucus secretion. Additionally, LM effectively ameliorated oxidative stress in OVA-induced asthma, with a significant increase in the activity of superoxide dismutase (~185% vs. OVA group; P<0.001), elevated levels of glutathione (~74% higher than the OVA group; P<0.001) and reduced content of malondialdehyde (~40% lower than the OVA group; P<0.001) in lung tissues. Collectively, these findings suggested that LM effectively protected lung tissues from inflammation and oxidative stress, thereby representing a promising therapeutic option for the treatment of allergic asthma.

 asthma airway inflammation oxidative stress Microbial Biotechnology Research Center, Korea Research Institute of Bioscience and Biotechnology from the Ministry of Science and ICT KGM5482423 National Research Foundation of Korea grant funded by the Korean government NRF2021R1A2C2013498 The present study was supported by the Microbial Biotechnology Research Center, Korea Research Institute of Bioscience and Biotechnology from the Ministry of Science and ICT (grant no. KGM5482423) and the National Research Foundation of Korea grant funded by the Korean government (grant no. NRF2021R1A2C2013498). Introduction

Allergic asthma, the most common type of asthma, is an airway inflammatory disease driven by the many kinds of inflammatory cells (1,2). The primary characteristic of allergic asthma is the narrowing of airway due to the infiltration of immune cells, particularly eosinophils, leading to a range of phenomena, including enhanced mucus production and airway wall remodeling (3–5). Allergic asthma is characterized by a Th2 cell response, aberrant accumulation of Th2 cytokines [interleukin (IL)-4, IL-5, IL-9, and IL-13], and Th2-oriented cytokines (IL-6 and IL-33), which contribute to goblet cell dysplasia and accumulation of mucus (6,7). Therefore, targeting Th2 cytokines is a potential therapeutic approaches for severe asthma (8–11).

The activation of inflammatory cells in allergic asthma subsequently leads to the generation of a substantial amount of reactive oxygen species (ROS) (12). During the normal condition, the antioxidant and oxidant systems maintain balance; however, with the excessive accumulation of ROS, the balance was damaged, resulting in oxidative stress. Various cellular antioxidants can mitigate oxidative stress, such as superoxide dismutase (SOD), catalase, and glutathione (GSH) (13,14). Furthermore, the activation of nuclear factor-kappaB (NF-κB) pathway promotes the production of pro-inflammatory cytokines and recruits eosinophils, that play crucial roles in allergic inflammation and oxidative stress (15–17).

Previous studies suggested that dietary supplementation of omega-3 fatty acids, enriched with docosahexaenoic acid (DHA) and eicosapentaenoic acid (EPA), exerts beneficial effects in inflammatory diseases, including asthma (18–20). Notably, it has been observed that intake of omega-3 fatty acids can elevate the levels of specialized pro-resolving mediators (SPMs), potentially serving as the primary mechanism by which omega-3 fatty acids reduce inflammation (21,22). SPMs act as potent regulators of cytokines and chemokines production, thereby facilitating a return to tissue homeostasis (23,24). Additionally, studies have demonstrated that SPMs exhibit both anti-inflammatory and pro-resolution properties at more than thousands times lower doses compared to omega-3 fatty acids (25–27). Thus, SPMs are promising methods for asthma. Lipid mediators (LM;17S-monohydroxy docosahexaenoic acid, resolvin D5, and protectin DX at 3:47:50 ratio), produced from DHA by soybean lipoxygenase, attenuate atopic dermatitis, which is an allergic condition involving the inhibition of inflammatory cytokines and mediators (28). Thus, we hypothesized that LM could mediate allergic asthma and evaluated the underlying mechanism of LM on allergic asthma in OVA-challenged mice.

 Materials and methods <sec> <title>Animals

Female BALB/c mice (6 weeks) were obtained from Orient Bio (Gyeonggi, Korea). The animals were housed at under controlled conditions of temperature (21–23°C), relative humidity (60–70%), and a 12-h light/dark cycle. This study was reviewed and approved by the Institutional Animal Care and Use Committee and Institutional Animal Ethics Committee of the Korea Research Institute of Bioscience and Biotechnology (Daejeon, Korea) (KRIBB-AEC-23236).

 Animal model and treatment

Ovalbumin (OVA), the chief globular egg white protein, has been widely used for allergic models (29,30). The mice were divided into three groups and the allergic asthma model was induced by OVA. As depicted in Fig. 1, sensitization of the mice occurred through intraperitoneal (i.p.) administration of 100 µg of OVA (Sigma-Aldrich, St. Louis, MO) on days 1, 7, and 14. Subsequently, 150 µg of OVA was intranasally (i.n.) administered to the mice from days 21 to 24. In the normal control group (NC) and OVA alone group, saline was orally administered; however, in the OVA + LM group, LM (10 µg/kg) was orally treated. The mice were sacrificed for blood, bronchoalveolar lavage fluid (BALF), and lung tissue collection on Day 25. The dosage selection for LM was based on a previous study (28,31). The mice were euthanized via 5% isoflurane in oxygen until breathing ceases.

 Collection of BALF

The BALF was obtained by lavaging the lungs with phosphate-buffered saline (PBS), ensuring a slow rinse to protect the epithelial cells in the bronchioalveolar space. Subsequently, centrifugation for 10 min was performed to separate the supernatants for cytokines analysis and resuspend the cell pellets for cell counting (32).

 Measurement of cytokines and IgE level

IL-4, IL-5, IL-13, and IL-33 levels in BALF and IL-6, TNF-α, and IgE levels in serum were measured using ELISA kits (Abcam, Cambridge, MA) based on the manufacturer's protocols.

 Histological analysis

After dissecting the lungs, tissue sections were fixed in 4% paraformaldehyde. Subsequently, they underwent dehydration using ethanol and xylene. The dehydrated tissue was then embedded in paraffin and stained with H&E (Sigma) to evaluate the infiltration of inflammatory cells. The inflammatory score was determined by assigning grades: 0, no inflammation; 1, minimal inflammation; 2, mild inflammation; 3, moderate inflammation; and 4, severe inflammation (11). Additionally, the slides were subjected to periodic acid Schiff (PAS; Abcam) staining for assessing mucus production.

 Oxidative stress assays in lung tissue

The level of malondialdehyde (MDA) was quantified by lipid peroxidation colorimetric/fluorometric assay kit (ab118970), GSH was determined by GSH assay colorimetric kit (ab239727), and the activity of SOD was analyzed by superoxide dismutase activity assay kit (ab65354) based on the protocols accompanying the kits from Abcam.

 Western blot analysis

The protein was isolated from homogenized lung tissue via radio immunoprecipitation assay buffer with protein inhibitors. Subsequently, the proteins were separated by sodium dodecyl sulfate-polyacrylamide gel and transferred onto polyvinylidene fluoride membranes, followed by incubation with blocking buffer and incubation of primary antibodies against p-p65 (1:1,000, ab76302, Abcam), p65 (1:1,000, ab16502, Abcam), IkB (1:2,000, ab32518, Abcam), and p-IkB (1:1,000. ab133462, Abcam). Finally, horseradish peroxidase-conjugated goat anti-rabbit antibodies (1:20,000, ab205718, Abcam) were applied to the membranes for a period of 2 h. The relative levels of protein were calculated using ImageJ software (1.48v; National Institutes of Health).

 Reverse transcription-quantitative PCR (RT-qPCR)

The lung tissue was subjected to RNA isolation using a MiniBEST kit (TaKaRa, Tokyo, Japan). Briefly, transcript levels were quantified using a One-Step AccuPower GreenStar RT-qPCR PreMix kit (Bioneer Corporation, Daejeon, Korea). RT-qPCR analysis was performed on the CFX Connect system (Bio-Rad, CA, USA). The relative mRNA expression of target genes was determined using the 2−ΔΔCq method. Gene-specific primers utilized in this study are listed in Table I (33).

 Statistical analysis

Data were shown as means ± standard deviations (SDs). Statistical analysis was conducted using GraphPad Prism 9.0 software (GraphPad, San Diego, CA, USA). The Shapiro-Wilk test was used to test for normality. Comparisons were analyzed by ANOVA, followed by Dunnett's test as the post hoc test; or by Kruskal-Wallis test followed by Dunn's test as the post hoc test. Statistical significance was defined as P<0.05.

 Results <sec> <title>LM reduces the level of inflammatory cells in the BALF in OVA-induced asthma

As shown in Fig. 2A and B, OVA-challenged mice exhibited a higher level in both total cell number (P<0.0001) and eosinophil percentage (P<0.0001) compared to the normal condition. However, treatment with LM effectively attenuated the accumulation of OVA-induced eosinophils (P<0.0001 vs. OVA group). These findings suggest that LM possesses the ability to suppress the infiltration of inflammatory cells, particularly eosinophils, in lung tissue following OVA exposure.

 LM decreases Th2 cytokines in BALF

OVA challenge resulted in elevated levels of IL-4 (78.21±4.10 pg/ml, P<0.0001 vs. NC group), IL-5 (64.09±2.21 pg/ml, P<0.0001 vs. NC group), and IL-13 (57.02±3.96 pg/ml, P<0.0001 vs. NC group) in BALF; however, treatment with LM markedly reduced the expression of these cytokines, as evidenced by a reduction in IL-4 level to 30.24±3.76 pg/ml (P<0.0001 vs. OVA group), IL-5 to 37.99±2.78 pg/ml (P<0.0001 vs. OVA group), and IL-13 to 15.16±1.10 pg/ml (P<0.0001 vs. OVA group) (Fig. 2C-E). Lung epithelial cells produce IL-33, a type of Th2-oriented cytokine that promotes IL-5 production (34). The IL-33 level was markedly enhanced almost 2 times in OVA mice (45.83±2.69 pg/ml, P<0.0001) compared to the normal control group. However, LM treatment recovered IL-33 to 26.00±1.41 pg/ml (P<0.0001 vs. OVA group), close to the normal level (Fig. 2F).

 LM inhibits pro-inflammatory cytokines and IgE level in the serum

The levels of IL-6 and TNF-α, which are representative inflammatory cytokines, were significantly elevated in the serum of asthmatic animals (167.12±6.25 pg/ml, P<0.0001; 109.17±7.17 pg/ml, P<0.0001, respectively) compared to normal controls (58.97±6.35 pg/ml; 30.50±3.81 pg/ml, respectively). However, treatment with LM effectively suppressed the expression of both cytokines induced by OVA allergen (99.45±6.12 pg/ml, P<0.001, vs. OVA group; 62.51±4.03 pg/ml, P<0.001 vs. OVA group) (Fig. 3A and B). The OVA-induced asthma group exhibited a significant increase in IgE level, reaching to 90.24±5.98 ng/ml (P<0.0001 vs. NC group), which was nearly three times of the control group. However, treatment with LM resulted in a substantial reduction in IgE level to 56.50±2.70 ng/ml (P<0.001 vs. OVA group) (Fig. 3C).

 LM inhibits the expression of inflammatory cytokine in OVA-induced asthma

The expression levels of IL-4, IL-5, and IL-13 were upregulated in lung tissues following OVA challenge compared to the normal control group (P<0.01, P<0.01, P<0.001, respectively). However, treatment with LM effectively suppressed these cytokines at the gene level in allergic asthma (P<0.01, P<0.01, P<0.0001 vs. OVA group, respectively) (Fig. 4A-C). Additionally, LM treatment resulted in downregulation of IL-6 and TNF-α expressions compared to OVA-induced asthma (P<0.001, P<0.0001, respectively) (Fig. 4D and E).

 LM modulates antioxidant markers in OVA-induced asthma

To investigate the role of LM in oxidative stress, we quantified key antioxidant biochemical markers in lung tissue, including MDA, SOD, and GSH (35,36). In OVA-induced mice, MDA level was significantly increased to 9.14±0.62 nmol/g (P<0.0001 vs. NC group) (Fig. 5A), while the crucial antioxidants SOD and GSH were significantly reduced to 1.34±0.11 U/mg protein (P<0.0001 vs. NC group) and 6.52±0.66 µmol/g (P<0.0001 vs. NC group) in lung tissue (Fig. 5B and C). Notably, administration of LM effectively restored these mediators to near-normal levels, with MDA decreasing to 5.55±0.53 nmol/g (P<0.001 vs. OVA group), SOD increasing to 2.48±0.17 U/mg protein (P<0.001 vs. OVA group), and GSH enhancing to 11.42±0.52 µmol/g (P<0.001 vs. OVA group). Overall, LM exhibited the ability to modulate oxidative stress in an OVA-induced asthma model.

 LM ameliorates the histopathological changes in OVA-induced asthma

As depicted in Fig. 6, OVA stimulation resulted in inflammatory cell infiltration in both bronchi and alveoli of lung tissues (P<0.0001 vs. NC group); however, treatment with LM significantly modulated the inflammatory cell profile within the lung (P<0.001 vs. OVA group) (Fig. 6A-C). Furthermore, the inflammatory score was markedly elevated in the OVA group (P<0.0001 vs. NC group), which was then attenuated by LM (P<0.05 vs. OVA group) (Fig. 6D). Goblet cell hyperplasia and mucus excessive production are commonly employed to assess the airway remodeling (37). As shown in Fig. 7, OVA stimulation induced goblet cell dysplasia in the asthma group (P<0.0001 vs. NC group), which was mitigated by LM treatment (P<0.0001 vs. OVA group). Furthermore, LM treatment suppressed OVA-induced mucus secretion in the bronchi (P<0.0001 vs. OVA group). These findings suggest that LM modulated the histopathological alterations associated with OVA-induced asthma.

 LM suppresses NF-κB signaling pathway during OVA-induced asthma

In this study, we postulated that LM could effectively inhibit NF-κB signaling in OVA-induced asthma. As shown in Fig. 8, OVA challenge upregulated the phosphorylated IκB and NF-κB (p65) expression, and increased the degradation of IκB (P<0.0001 vs. NC group, respectively). However, treatment with LM significantly suppressed NF-κB activation as evidenced by inhibition of IκB degradation (P<0.0001 vs. OVA group), and downregulated levels of p-IκB (P<0.001 vs. OVA group) and p-p65 (P<0.01 vs. OVA group). These findings demonstrate the anti-inflammatory potential of LM through inhibition of the NF-κB pathway in OVA-sensitized mice.

 Discussion

The main features of allergic asthma include inflammation, excessive mucus production, and remodeling in the airway (32). Despite the availability of a few drugs, it is imperative to explore more effective approaches for treating asthma. Over the years, there have been numerous conflicting reports regarding the supplementation of omega-3 fatty acids in asthma management. Several studies have demonstrated that intake of omega-3 fatty acids exerts a protective effect in asthma (38–42). However, other findings suggest that omega-3 fatty acid supplementation may either exacerbate pulmonary inflammation or exhibit no significant reduction in its severity, rendering it ineffective in human trials (43,44). Conversely, SPMs, derived from DHA or EPA, are demonstrated robust and favorable effects on inflammatory diseases even at doses thousands of times lower than DHA or EPA, including asthma (45–47). Revealing the involvement of SPMs in inflammatory responses associated with asthma enhances the comprehension of dysfunctional inflammation resolution mechanisms and unveils potential therapeutic targets for managing this condition. In this study, OVA exposure successfully induced asthmatic features in mice including elevated eosinophils in BALF and lung pro-inflammatory symptoms along with goblet cell hyperplasia, increased mucus production, and oxidative stress. Furthermore, treatment with LM significantly reduced inflammatory cell infiltration into the airway and lung while attenuating airway remodeling and modulating oxidative stress levels. These findings demonstrate the efficacy of LM in regulating inflammation in asthma (Fig. 9).

Eosinophils play a pivotal role in allergic inflammation and the development of airway remodeling during Th2-type allergic asthma (4). Th2 cytokines, such as IL-4, IL-5, and IL-13, promote the infiltration of eosinophils into lung tissue (48). IL-5 facilitates the eosinophils to migrate into the lungs (6). IL-4 and IL-13 stimulate B cells to secrete IgE, which subsequently activates mast cells and basophils in allergic diseases (49). Additionally, IL-13 influences smooth muscle activity and airway mucus secretion (50,51). Therefore, these cytokines represent important targets for suppressing asthma. In this study, we observed excessive production of these Th2-related cytokines following OVA induction in mice, suggesting an allergic-like asthma model. Resolvin D1 and resolvin E1 markedly decreased airway eosinophilia and mucus metaplasia, accompanied with decreased Th2 cytokines in mice asthma model (25–27). Similarly, treatment with LM significantly reduced levels of Th2-related cytokines, while concurrently decreasing eosinophil counts in BALF and lung tissues. Goblet cell hyperplasia is a pathophysiological characteristic of asthma, significantly augmenting mucus production, thereby leading to airway obstruction (52,53). As anticipated, OVA induced goblet cell hyperplasia and resulted in excessive mucus accumulation; however, oral treatment with LM substantially mitigated goblet cell dysplasia and suppressed mucus secretion, indicating the inhibitory role of LM in asthmatic airway remodeling.

IgE is induced by Th2 cytokines and contributes to the asthma (10,48). In present study, OVA challenge led to an elevated level of IgE in the serum, while LM effectively attenuated the OVA-induced increase in serum IgE. IL-6 and TNF-α are widely recognized as key markers of inflammation (34). TNF-α has recently emerged as a crucial factor in refractory asthma and plays multiple roles in airway pathology during asthmatic conditions (54). Additionally, IL-6 promotes Th2 differentiation and IL-4 production (55). Our findings demonstrate that stimulation with OVA resulted in upregulated expression of both IL-6 and TNF-α in lung tissue and serum, which were significantly suppressed by LM treatment. These results highlight the anti-inflammatory effects of LM on asthma.

Oxidative stress is crucial in the pathogenesis of asthma, as it may contribute to the airway inflammation via airway hyper-responsiveness, mucus secretion, and pro-inflammatory cytokines (56,57). In our study, we observed elevated level of MDA along with decreased SOD activity and GSH level during OVA-induced asthma, indicating oxidative stress in OVA-induced asthma model. Importantly, LM highly mediated these anti-oxidative parameters which were associated with the protective role exerted by LM in mitigating asthma pathology.

NF-κB is a pivotal mediator in the progression of asthma (58). IκB, which inhibits NF-κB, is bound to NF-κB in the cytoplasm. Within the inducer, IκB was phosphorylated and degraded, resulting in the activation of NF-κB (59). Activation of NF-κB leads to the expression of inflammatory cytokines and chemokines, contributing to the Th2 cell differentiation in allergic asthma (60). In our previous investigations, we found LM attenuated NF-κB signaling pathway in RAW264.7 cells and atopic dermatitis (28,31). In the present study, OVA exposure increased the expression of p-IκB and p-p65, leading to the activation of the NF-κB signaling pathway. Treatment with LM drastically inhibited the degradation and phosphorylation of IκB. Furthermore, LM inhibited the expression of p-p65. Taken together, the results suggest that LM ameliorates OVA-induced allergic asthma by regulating the NF-κB activation.

In conclusion, this study demonstrates that LM shows promise as a viable option for both alternative and adjunctive therapy in the management of asthma. Firstly, LM is endogenous to the human body, ensuring its safety; Secondly, LM exhibits significant improvements at significantly lower doses compared to omega-3 fatty acids, facilitating ease of intake. However, more research is required to explore optimal therapeutic strategies including dose-dependency, administration methods, and clinical testing.

 Acknowledgements

Not applicable.

 Availability of data and materials

The data generated in the present study may be requested from the corresponding author.

 Authors' contributions

YS conceptualized and designed the study, performed experiments, analyzed data, and wrote and revised manuscript. HSC analyzed data, contributed to critical revisions and contributed to the final manuscript. SKK and YH performed experiments and analyzed data. SCC and JHS investigated the literature, supplied the materials and analyzed data. YSJ contributed to data analysis and critical revisions of the intellectual content. JHC contributed to data analysis, and the draft and final manuscript. JWS conceptualized the study, and contributed to the draft and final manuscript. YS and JWS confirmed the authenticity of all the raw data. All authors have read and approved the final manuscript.

 Ethics approval and consent to participate

The present study was reviewed and approved by the Institutional Animal Care and Use Committee and Institutional Animal Ethics Committee of the Korea Research Institute of Bioscience and Biotechnology (Daejeon, South Korea; approval no. KRIBB-AEC-23236).

 Patient consent for publication

Not applicable.

 Competing interests

The authors declare that they have no competing interests.

 References PawankarRAllergic diseases and asthma: A global public health concern and a call to actionWorld Allergy Organ J712201410.1186/1939-4551-7-1224940476 AgacheIEguiluz-GraciaICojanuCLaculiceanuADel GiaccoSZemelka-WiacekMKosowskaAAkdisCAJutelMAdvances and highlights in asthma in 2021Allergy7633903407202110.1111/all.1505434392546 LambrechtBNHammadHThe immunology of asthmaNat Immunol164556201510.1038/ni.304925521684 PossaSSLeickEAPradoCMMartinsMATibérioIFLCEosinophilic inflammation in allergic asthmaFront Pharmacol446201310.3389/fphar.2013.0004623616768 HammadHLambrechtBNThe basic immunology of asthmaCell18414691485202110.1016/j.cell.2021.02.01633711259 StokesJRCasaleTBCharacterization of asthma endotypes: Implications for therapyAnn Allergy Asthma Immunol117121125201610.1016/j.anai.2016.05.01627499539 AbdelazizMHAbdelwahabSFWanJCaiWHuixuanWJianjunCKumarKDVasudevanASadekASuZAlternatively activated macrophages; a double-edged sword in allergic asthmaJ Transl Med1858202010.1186/s12967-020-02251-w32024540 MaYGeAZhuWLiuYNJiNFZhaWJZhangJXZengXNHuangMMorin attenuates ovalbumin-induced airway inflammation by modulating oxidative stress-responsive MAPK signalingOxid Med Cell Longev20165843672201610.1155/2016/584367226783416 SaeedaviMGoudarziMMehrzadiSBasirZHasanvandAHosseinzadehASinapic acid ameliorates airway inflammation in murine ovalbumin-induced allergic asthma by reducing Th2 cytokine productionLife Sci307120858202210.1016/j.lfs.2022.12085835931198 Ezz-EldinYMAboseifAAKhalafMMPotential anti-inflammatory and immunomodulatory effects of carvacrol against ovalbumin-induced asthma in ratsLife Sci242117222202010.1016/j.lfs.2019.11722231881223 ZafarMSShahidKGobeGCYasminRNaseemNShahzadMSuppression of cytokine storm and associated inflammatory mediators by salicylaldehyde derivative of pregabalin: An innovative perspective for alleviating airway inflammation and lung remodelingJ King Saud Univ Sci34101877202210.1016/j.jksus.2022.101877 SahinerUMBirbenEErzurumSSackesenCKalayciOOxidative stress in asthmaWorld Allergy Organ J4151158201110.1097/WOX.0b013e318232389e23268432 BowlerRPCrapoJDOxidative stress in airways: Is there a role for extracellular superoxide dismutase?Am J Respir Crit Care Med166S38S43200210.1164/rccm.220601412471087 MichaeloudesCAbubakar-WaziriHLakhdarRRabyKDixeyPAdcockIMMumbySBhavsarPKChungKFMolecular mechanisms of oxidative stress in asthmaMol Aspects Med85101026202210.1016/j.mam.2021.10102634625291 LeeKSLeeHKHayflickJSLeeYCPuriKDInhibition of phosphoinositide 3-kinase delta attenuates allergic airway inflammation and hyperresponsiveness in murine asthma modelFASEB J20455465200610.1096/fj.05-5045com16507763 Ganesh YerraVNegiGSharmaSSKumarAPotential therapeutic effects of the simultaneous targeting of the Nrf2 and NF-κB pathways in diabetic neuropathyRedox Biol1394397201310.1016/j.redox.2013.07.00524024177 El-HashimAZRennoWMAbduoHTJaffalSMAkhtarSBenterIFEffect of inhibition of the ubiquitin-proteasome-system and IκB kinase on airway inflammation and hyperresponsiveness in a murine model of asthmaInt J Immunopathol Pharmacol243342201110.1177/03946320110240010521496385 LiJXunPZamoraDSoodALiuKDaviglusMIribarrenCJacobsDJrShikanyJMHeKIntakes of long-chain omega-3 (n-3) PUFAs and fish in relation to incidence of asthma among American young adults: The CARDIA studyAm J Clin Nutr97173178201310.3945/ajcn.112.04114523193002 WendellSGBaffiCHolguinFFatty acids, inflammation, and asthmaJ Allergy Clin Immunol13312551264201410.1016/j.jaci.2013.12.108724613565 KitzRRoseMASchubertRBeermannCKaufmannABöhlesHJSchulzeJZielenSOmega-3 polyunsaturated fatty acids and bronchial inflammation in grass pollen allergy after allergen challengeRespir Med10417931798201010.1016/j.rmed.2010.06.01920637584 SiddiqueeAPatelMRajalingamSNarkeDKuradeMPonnothDSEffect of omega-3 fatty acid supplementation on resolvin (RvE1)-mediated suppression of inflammation in a mouse model of asthmaImmunopharmacol Immunotoxicol41250257201910.1080/08923973.2019.158490330849257 MiyataJAritaMRole of omega-3 fatty acids and their metabolites in asthma and allergic diseasesAllergol Int642734201510.1016/j.alit.2014.08.00325572556 DuvallMGLevyBDDHA- and EPA-derived resolvins, protectins, and maresins in airway inflammationEur J Pharmacol785144155201610.1016/j.ejphar.2015.11.00126546247 KoltsidaOKaramnovSPyrillouKVickeryTChairakakiADTamvakopoulosCSiderasPSerhanCNAndreakosEToll-like receptor 7 stimulates production of specialized pro-resolving lipid mediators and promotes resolution of airway inflammationEMBO Mol Med5762775201310.1002/emmm.20120189123584892 LevyBDResolvin D1 and Resolvin E1 promote the resolution of allergic airway inflammation via shared and distinct molecular counter-regulatory pathwaysFront Immunol3390201210.3389/fimmu.2012.0039023293638 RogerioAPHaworthOCrozeROhSFUddinMCarloTPfefferMAPriluckRSerhanCNLevyBDResolvin D1 and aspirin-triggered resolvin D1 promote resolution of allergic airways responsesJ Immunol18919831991201210.4049/jimmunol.110166522802419 AokiHHisadaTIshizukaTUtsugiMKawataTShimizuYOkajimaFDobashiKMoriMResolvin E1 dampens airway inflammation and hyperresponsiveness in a murine model of asthmaBiochem Biophys Res Commun367509515200810.1016/j.bbrc.2008.01.01218190790 SuYHanYChoiHSLeeGYChoHWChoiHJangYSChoiJHSeoJWLipid mediators derived from DHA alleviate DNCB-induced atopic dermatitis and improve the gut microbiome in BALB/c miceInt Immunopharmacol124110900202310.1016/j.intimp.2023.11090037708704 ZhouRShiXGaoYCaiNJiangZXuXAnti-inflammatory activity of guluronate oligosaccharides obtained by oxidative degradation from alginate in lipopolysaccharide-activated murine macrophage RAW 264.7 cellsJ Agric Food Chem63160168201510.1021/jf503548a25483391 SunNTengAZhaoYLiuHTuJJiaQWangQImmunological and anticancer activities of seleno-ovalbumin (Se-OVA) on H22-bearing miceInt J Biol Macromol163657665202010.1016/j.ijbiomac.2020.07.00632634513 SuYHanYChoiHSLeeGYChoHWChoiHChoiJHJangYSSeoJWLipid mediators obtained from docosahexaenoic acid by soybean lipoxygenase attenuate RANKL-induced osteoclast differentiation and rheumatoid arthritisBiomed Pharmacother171116153202410.1016/j.biopha.2024.11615338232664 WuDLiSLiuXXuJJiangAZhangYLiuZWangJZhouEWeiZAlpinetin prevents inflammatory responses in OVA-induced allergic asthma through modulating PI3K/AKT/NF-κB and HO-1 signaling pathways in miceInt Immunopharmacol89107073202010.1016/j.intimp.2020.10707333039967 LivakKJSchmittgenTDAnalysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) methodMethods25402408200110.1006/meth.2001.126211846609 LambrechtBNHammadHFahyJVThe cytokines of asthmaImmunity50975991201910.1016/j.immuni.2019.03.01830995510 KaradoganBBeyazSGelincikABuyukozturkSArdaNEvaluation of oxidative stress biomarkers and antioxidant parameters in allergic asthma patients with different level of asthma controlJ Asthma59663672202210.1080/02770903.2020.187012933380228 ChoYSMoonH-BThe role of oxidative stress in the pathogenesis of asthmaAllergy Asthma Immunol Res2183187201010.4168/aair.2010.2.3.18320592917 HuangWCFangLWLiouCJPhloretin attenuates allergic airway inflammation and oxidative stress in asthmatic miceFront Immunol8134201710.3389/fimmu.2017.0013428243240 SchubertRKitzRBeermannCRoseMALiebASommererPCMoskovitsJAlberternstHBöhlesHJSchulzeJZielenSEffect of n-3 polyunsaturated fatty acids in asthma after low-dose allergen challengeInt Arch Allergy Immunol148321329200910.1159/00017038619001792 MickleboroughTDLindleyMRIonescuAAFlyADProtective effect of fish oil supplementation on exercise-induced bronchoconstriction in asthmaChest1293949200610.1378/chest.129.1.3916424411 YokoyamaAHamazakiTOhshitaAKohnoNSakaiKZhaoGDKatayamaHHiwadaKEffect of aerosolized docosahexaenoic acid in a mouse model of atopic asthmaInt Arch Allergy Immunol123327332200010.1159/00005364511146390 MorinCFortinSCantinAMRousseauÉMAG-EPA resolves lung inflammation in an allergic model of asthmaClin Exp Allergy4310711082201310.1111/cea.1216223957343 JiangTLiPZhaoJDaiLSunDLiuMAnLJiaLJingXWangHLong-chain polyunsaturated fatty acids improve airway pathological features and gut microbial imbalances in BALB/c mice with ovalbumin-induced asthmaJ Funct Foods81104465202110.1016/j.jff.2021.104465 YinHLiuWGoleniewskaKPorterNAMorrowJDPeeblesRSJrDietary supplementation of omega-3 fatty acid-containing fish oil suppresses F2-isoprostanes but enhances inflammatory cytokine response in a mouse model of ovalbumin-induced allergic lung inflammationFree Radic Biol Med47622628200910.1016/j.freeradbiomed.2009.05.03319501157 SchusterGUBrattJMJiangXPedersenTLGrapovDAdkinsYKelleyDSNewmanJWKenyonNJStephensenCBDietary long-chain omega-3 fatty acids do not diminish eosinophilic pulmonary inflammation in miceAm J Respir Cell Mol Biol50626636201410.1165/rcmb.2013-0136OC24134486 MiyataJFukunagaKIwamotoRIsobeYNiimiKTakamiyaRTakiharaTTomomatsuKSuzukiYOgumaTDysregulated synthesis of protectin D1 in eosinophils from patients with severe asthmaJ Allergy Clin Immunol131353360.e2-e2201310.1016/j.jaci.2012.07.04823006546 ZambaldeÉPTeixeiraMMFavarinDCde OliveiraJRMagalhãesMLCunhaMMSilvaWCJrOkumaCHRodriguesVJrLevyBDRogerioAPThe anti-inflammatory and pro-resolution effects of aspirin-triggered RvD1 (AT-RvD1) on peripheral blood mononuclear cells from patients with severe asthmaInt Immunopharmacol35142148201610.1016/j.intimp.2016.03.01427044027 PehHYBruggemannTRHoWEChengCTanWDWongWFLevyBDResolvin D2 promotes the resolution of allergen-induced lung inflammationJ Immunol204(1 Suppl)S147.19202010.4049/jimmunol.204.Supp.147.19 LeighREllisRWattieJNHirotaJAMatthaeiKIFosterPSO'ByrnePMInmanMDType 2 cytokines in the pathogenesis of sustained airway dysfunction and airway remodeling in miceAm J Respir Crit Care Med169860867200410.1164/rccm.200305-706OC14701709 Platts-MillsTAESchuylerAJErwinEAComminsSPWoodfolkJAIgE in the diagnosis and treatment of allergic diseaseJ Allergy Clin Immunol13716621670201610.1016/j.jaci.2016.04.01027264001 IngramJLKraftMIL-13 in asthma and allergic disease: Asthma phenotypes and targeted therapiesJ Allergy Clin Immunol130829844201210.1016/j.jaci.2012.06.03422951057 AlasandaguttiMLAnsariMSSSagurthiSRValluriVGaddamSRole of IL-13 genetic variants in signalling of asthmaInflammation40566577201710.1007/s10753-016-0503-328083766 CurranDRCohnLAdvances in mucous cell metaplasia: A plug for mucus as a therapeutic focus in chronic airway diseaseAm J Respir Cell Mol Biol42268275201010.1165/rcmb.2009-0151TR19520914 LaiHRogersDFNew pharmacotherapy for airway mucus hypersecretion in asthma and COPD: Targeting intracellular signaling pathwaysJ Aerosol Med Pulm Drug Deliv23219231201010.1089/jamp.2009.080220695774 AdnerMRoseACZhangYSwärdKBensonMUddmanRShankleyNPCardellLOAn assay to evaluate the long-term effects of inflammatory mediators on murine airway smooth muscle: Evidence that TNFalpha up-regulates 5-HT(2A)-mediated contraction contractionBr J Pharmacol137971982200210.1038/sj.bjp.070492812429569 DienzORinconMThe effects of IL-6 on CD4 T cell responsesClin Immunol1302733200910.1016/j.clim.2008.08.01818845487 HendersonWRJrChiEYTeoJLNguyenCKahnMA small molecule inhibitor of redox-regulated NF-kappa B and activator protein-1 transcription blocks allergic airway inflammation in a mouse asthma modelJ Immunol16952945299200210.4049/jimmunol.169.9.529412391249 PoynterMEAirway epithelial regulation of allergic sensitization in asthmaPulm Pharmacol Ther25438446201210.1016/j.pupt.2012.04.00522579987 MaBAthariSSMehrabi NasabEZhaoLPI3K/AKT/mTOR and TLR4/MyD88/NF-κB signaling inhibitors attenuate pathological mechanisms of allergic asthmaInflammation4418951907202110.1007/s10753-021-01466-333860870 BaoZZhangPYaoYLuGTongZYanBTuLYangGZhouJDeguelin attenuates allergic airway inflammation via inhibition of NF-κb pathway in miceInt J Biol Sci13492504201710.7150/ijbs.1723828529457 DasJChenCHYangLCohnLRayPRayAA critical role for NF-kappa B in GATA3 expression and TH2 differentiation in allergic airway inflammationNat Immunol24550200110.1038/8315811135577

Schedule of OVA-induced asthma in the present study. Mice were sensitized via i.p. injection of 100 µg OVA emulsified in 5 mg hydroxyl aluminum along with 100 µl PBS on days 1, 7 and 14. Subsequently, the mice underwent i.n. challenge with 150 µg OVA dissolved in 50 µl PBS on days 21, 22, 23 and 24. Oral saline was given to the normal control and OVA groups, while LM (10 µg/kg) was orally administered to the OVA + LM group. The mice were sacrificed after a period of 24 h following the final challenge for the collection of blood, BALF and lung tissue. BALF, bronchoalveolar lavage fluid; i.n., intranasal; i.p., intraperitoneal; LM, lipid mediators; OVA, ovalbumin.

Effects of LM on inflammatory cells and Th2 cytokines in BALF of OVA-induced mice. BALF was collected at 24 h after the last OVA challenge to measure (A) the total cell in BALF, (B) eosinophil count (%), and Th2 cytokines, including (C) IL-4, (D) IL-5, (E) IL-13 and (F) IL-33. Data are presented as the mean ± SD. Dunnett's test was performed to compare the groups. ****P<0.0001. BALF, bronchoalveolar lavage fluid; LM, lipid mediators; NC, negative control; OVA, ovalbumin.

Effects of LM on pro-inflammatory cytokines and IgE in the serum of OVA-induced mice. Blood was collected at 24 h after the last OVA challenge to measure (A) IL-6, (B) TNF-α and (C) IgE levels. Data are presented as the mean ± SD. Dunnett's test was performed to compare the groups. ***P<0.001, ****P<0.0001. LM, lipid mediators; NC, negative control; OVA, ovalbumin.

Effects of LM on cytokine expression in the lung tissues of OVA-induced mice. RNA was extracted from lung tissues and analyzed to determine the mRNA expression levels of (A) IL-4, (B) IL-5, (C) IL-13, (D) IL-6 and (E) TNF-α by reverse transcription-quantitative PCR. Data are presented as the mean ± SD. Dunnett's test was performed to compare the groups. **P<0.01, ***P<0.001, ****P<0.0001. LM, lipid mediators; NC, negative control; OVA, ovalbumin.

Effects of LM on oxidative stress in the lung tissues of OVA-induced mice. (A) MDA, (B) SOD and (C) GSH levels in lung tissues were detected. Data are presented as the mean ± SD. Dunnett's test was performed to compare the groups. ***P<0.001, ****P<0.0001. GSH, glutathione; LM, lipid mediators; MDA, malondialdehyde; NC, negative control; OVA, ovalbumin; SOD, superoxide dismutase.

Effects of LM on inflammation in lung tissues of OVA-induced mice. (A) H&E staining of histological sections was performed and evaluated to determine inflammatory cell infiltration in lung tissues. Blue arrows, bronchi; black arrows, alveoli. Scale bar, 100 µm. Relative infiltration of cells in (B) bronchi and (C) alveoli compared with OVA-induced mice. Data are presented as the mean ± SD. Dunnett's test was performed to compare the groups. ***P<0.001, ****P<0.0001. (D) Inflammation score of the lung tissue. Data are presented as the mean ± SD. Dunn's test was performed to compare the groups. *P<0.05, ****P<0.0001. LM, lipid mediators; NC, negative control; OVA, ovalbumin.

Effects of LM on mucus accumulation in lung tissues of OVA-induced mice. (A) PAS staining of lung tissue sections was performed to examine mucus accumulation in the airways. Black arrows, mucus secretion; red arrows, goblet cell hyperplasia. Scale bar, 100 µm. Relative quantification of (B) goblet cell hyperplasia and (C) mucus secretion in the bronchial mucosal epithelium compared with OVA-induced mice. Data are presented as the mean ± SD. ANOVA and Dunnett's test were performed to compare the groups. ****P<0.0001. LM, lipid mediators; NC, negative control; OVA, ovalbumin; PAS, periodic acid-Schiff.

Effects of LM on the NF-κB signaling pathway in OVA-induced mice. (A) p65, p-p65, IκB and p-IκB levels were detected by western blotting. The relative levels of (B) IκB/GAPDH, (C) p-IκB/IκB and (D) p-p65/p65 were calculated using ImageJ software. Data are presented as the mean ± SD. Dunnett's test was performed to compare the groups. **P<0.01, ***P<0.001, ****P<0.0001. LM, lipid mediators; NC, negative control; OVA, ovalbumin; p-, phosphorylated.

LM regulates OVA-induced asthma in lung airways. Sensitization and challenge with OVA induce the production of pro-inflammatory cytokines in the lungs, which recruit inflammatory cells such as eosinophils and macrophages. Additionally, OVA-induced oxidative stress promotes sustained inflammation and mucus secretion. Treatment with LM reduces airway inflammation, oxidative stress, goblet cell hyperplasia and mucus accumulation in lung airways. LM, lipid mediators; OVA, ovalbumin.

Primer sequences.

Mouse genes Sequences (5′-3′)
IL-4 Forward: ATCATCGGCATTTTGAACGAGGTC
Reverse: ACCTTGGAAGCCCTACAGACGA
IL-5 Forward: GATGAGGCTTCCTGTCCCTACT
Reverse: TGACAGGTTTTGGAATAGCATT
TCC
IL-13 Forward: AACGGCAGCATGGTATGGAGTG
Reverse: TGGGTCCTGTAGATGGCATTGC
IL-6 Forward: TACCACTTCACAAGTCGGAGGC
Reverse: CTGCAAGTGCATCATCGTTGTTC
TNF-α Forward: GGTGCCTATGTCTCAGCCTCTT
Reverse: GCCATAGAACTGATGAGAGGGAG
GAPDH Forward: CATCACTGCCACCCAGAAGACTG
Reverse: ATGCCAGTGAGCTTCCCGTTCAG