OL Oncology Letters 1792-1074 1792-1082 D.A. Spandidos 10.3892/ol.2025.14991 OL-29-5-14991 Articles The feasible role of soluble E‑cadherin in spheroidogenesis of HCT116 colorectal cancer cells, a candidate biomarker for liquid biopsy ChangIn-Youb 1 BooHye-Jin 2 HyunJin Won 2 YoonSang-Pil 2 3 Department of Anatomy, College of Medicine, Chosun University, Gwangju 61452, Republic of Korea Jeju Research Center for Natural Medicine, Jeju National University, Jeju 63243, Republic of Korea Department of Anatomy, College of Medicine, Jeju National University, Jeju 63243, Republic of Korea Correspondence to: Professor Sang-Pil Yoon, Department of Anatomy, College of Medicine, Jeju National University, 102 Jejudaehak-ro, Jeju 63243, Republic of Korea, E-mail: spyoon@jejunu.ac.kr 05 2025 24 03 2025 29 5 245 05112024 21022025 Copyright: © 2025 Chang et al. 2025 This is an open access article distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivs License, which permits use and distribution in any medium, provided the original work is properly cited, the use is non-commercial and no modifications or adaptations are made.

Although E-cadherin is known as a tumor suppressor via its effects on cell to cell adhesion, the effects of E-cadherin on malignant transformation have not yet been thoroughly investigated. In the present study, after malignant transformation was induced by spheroid formation in a fetal bovine serum-supplemented environment, the effects of soluble E-cadherin on the spheroidogenesis of colorectal cancer cells were investigated. E-cadherin knock-out (KO) was performed in HCT116 cells, targeting exon 3 of the CDH1 gene. A cell viability assay was performed to determine the proliferation and viability of wild type and CDH1 KO HCT116 cells after treatment with anticancer drugs. Spheroidogenesis was compared with or without exogenous E-cadherin, antibody against the ectodomain of E-cadherin (DECMA-1) and PD98059 treatment. In addition, morphometry, immunocytochemistry and western blotting were performed. Soluble E-cadherin in culture media was measured using an enzyme-linked immunosorbent assay. Firstly, CDH1 KO was confirmed by western blotting. Notably, the proliferation and viability of cells following treatment with 5-fluorouracil, epidermal growth factor receptor inhibitor and src kinase inhibitor were similar between the cell lines. Exogenous E-cadherin or DECMA-1 treatment did not affect spheroidogenesis, although long-term maintenance was slightly disturbed in CDH1 KO spheroids compared with that in wild type spheroids. In addition, E-cadherin was increased in spheroid culture as compared with that in conventional culture. Soluble E-cadherin was increased in a time-dependent manner, particularly in wild type HCT116 cells. PD98059 inhibited ERK activation and enhanced E-cadherin expression in conventional culture without affecting spheroidogenesis. These results suggested that soluble E-cadherin may be considered as a biomarker for colorectal cancer, although exogenous E-cadherin might not have a further role in malignant transformation.

 liquid biopsy soluble E-cadherin colorectal cancer malignant transformation biomarker Basic Science Research Program through the National Research Foundation of Korea funded by the Korea government 2021R1F1A1063023 Ministry of Education RS-2023-00270936 This research was supported by the Basic Science Research Program through the National Research Foundation of Korea funded by the Korea government (grant no. 2021R1F1A1063023) and by the Ministry of Education (grant no. RS-2023-00270936). Introduction

Mortality caused by cancers including colorectal cancer (CRC) has continued to decline recently because of earlier detection and improved treatment options. Incidence rates, however, increased for CRC in young adults, which is first leading cause of cancer death in men and second in women (1). Despite continued overall declines, CRC is rapidly shifting to diagnosis at a younger age, in the left colon or rectum, and at a more advanced or metastatic stage (2). Chemotherapy regimens for metastatic CRC are classified as first-, second-, and third-line treatment such as 5-fluorouracil (5-FU), epidermal growth factor (EGF) receptor (EGFR) inhibitor, and src kinase inhibitor, respectively (3).

CDH1 gene located on chromosome 16q22.1 is composed of 16 exons. It encodes the E-cadherin protein. Frequent mutations of CDH1 gene have been reported mostly in gastric cancers (4,5), in which most variations have been identified in exons 4–12 encoding the extracellular domain. Based on cell-cell adhesion properties, E-cadherin is known as a tumor suppressor protein in experimental cancer researches. E-cadherin, however, might promote proliferation via interaction with EGFR, resulting in EGF-dependent ERK activation in CRC (6–8). Lack or dysfunction of the transmembrane domain of E-cadherin might trigger cell proliferation or epithelial-mesenchymal transition (EMT) by activating β-catenin. The loss or dysfunction on extracellular domain of E-cadherin might accelerate malignant transformation by ruining EGFR/E-cadherin complex (9,10).

A three-dimensional (3D) spheroid formation model is a basic tool for cancer research (11), because it resembles in vivo solid tumors by anchorage-independent EMT (12). In this experimental setting, cells initially aggregate and then form compact spheroids via E-cadherin (12), which is inversely correlated with EMT similar to malignant transformation (13). Although E-cadherin is frequently downregulated with carcinogenesis, cell-cell adherence between cancer cells is disturbed after adding a soluble fragment of E-cadherin, leading to malignant transformation (14,15). Contrary to the well-known tumor suppressor role of E-cadherin (9,10), the extracellular domain of E-cadherin can act as EGF to EGFR. Therefore, the extracellular domain of E-cadherin has been suggested as a possible oncogene (14,16,17).

Growth factors or fetal bovine serum (FBS) could be supplemented in a spheroid formation model, although the efficiency could differ between cell lines (12,18,19). We have previously revealed that spheroid formation is related to soluble E-cadherin and pan-RAS in CRC cells, including 5-FU-resistance acquired cell line, but not related to any marker for cancer stem cells or drug resistance (19). Increased soluble E-cadherin during spheroid formation has only been observed in FBS-supplemented environment, not in growth factor-supplemented environment irrespective of 5-FU resistance. Therefore, application of exogenous E-cadherin in FBS-supplemented spheroid formation is needed to reveal whether soluble E-cadherin is a result or a cause of spheroidogenesis.

The extracellular domain of E-cadherin (around 80 kDa) is a soluble fragment. A commercial E-cadherin protein (around 64.4 kDa) could be collectively regarded as a soluble E-cadherin (19). Exogenous soluble E-cadherin (around 1 µg/ml) is known to contribute to ultraviolet-induced skin carcinogenesis via association with human epidermal growth factor receptor (14). Treatment with DECMA-1 (antibody against the ectodomain of E-cadherin) at 1 mg/kg can suppress breast carcinogenesis in an in vivo model (20). Although germline variants in CDH1 are associated with elevated risks of diffuse gastric cancer (21), whether they could increase the risk of CRC has not been reported yet. Effects of E-cadherin on FBS-supplemented spheroid formation and associated mechanisms have not been suggested either. Thus, this study aimed to investigate whether exogenous soluble E-cadherin or DECMA-1 could affect spheroidogenesis of CRC cells and determine possible mechanisms involved.

 Materials and methods <sec> <title>Reagents and antibodies

Reagents and antibodies used in this study are summarized in Table I.

 Cell culture

Wild-type (WT) and CDH1 knock-out (KO) HCT116 cells were purchased from SYNTHEGO (Synthego Engineered cells; Redwood city, CA, USA). CDH1 KO was performed using the CRISPR/Cas-9 system targeting the exon 3, corresponding to the precursor of CDH1. Guide RNA sequences were ‘UUACAGUCAAAAGGCCUCUA’, ‘CUUUCUGUAGGUGGAGUCCC’, and ‘AACAUACCUGAUGGGGCGGG’.

Cells were cultured in McCoy's 5A medium supplemented with 10% heat-inactivated FBS, 100 U/ml penicillin, and 100 mg/ml streptomycin at 5% CO2, 37°C, and humidified atmosphere conditions. All cell culture reagents were obtained from Corning Inc. (Corning, NY, USA).

 Cell viability assay

Cell proliferation was determined using MTT assay. Briefly, cells were plated in a 96-well plate (2×103 cells/well in 200 µl of media). Starting from the day of seeding (day 0), cell viability was checked for 4 days consecutively. Each day, 20 µl of MTT reagent was added to each well. After 3 h, formazan crystals were dissolved in dimethylsulfoxide. The absorbance was read at 595 and 620 nm using a VERSAmax microplate reader (Molecular Devices Korea LLC.; Seoul, Republic of Korea). Absorbance values of treated cells were compared to those of vehicle-treated cells, representing 100% cell viability.

Cells were seeded in triplicate wells of 96-well plates, and treated with 5-FU, erlotinib, saracatinib (0, 0.1, 1, 10, and 100 µM/each), E-cadherin (0, 0.1, 1, 10, and 100 ng/ml), DECMA-1 (0, 1, 10, 100, and 1,000 ng/ml), or PD98059 (0, 1, 10, 20, and 50 µM). After cells were incubated for 3 days, cell viability was assessed as described above.

 Spheroid formation

Ultra-low attachment 96-well plates were purchased from Corning Inc. (Corning) to create an anchorage-independent environment. Cells were cultured with conventional culture media as described above. After adding E-cadherin (0, 1, 10, 100, and 1,000 ng/ml), DECMA-1 (0, 1, 10, 100, and 1,000 ng/ml), or PD98059 (0, 1, 10, 20, and 50 µM), cells were cultured in round bottom plates (Corning, #7007) at a density of 2×102 cells/well. Long-term changes of spheroidogenesis were evaluated using flat bottom plates (Corning, #3474) at a density of 2×103 cells/well. Spheroid formation was checked for morphometry on day 5 in round bottom plates or on days 7, 14, and 21 in flat bottom plates.

 Western blot analysis

WT and CDH1 KO cells were cultured in conventional 2D monolayer for 3 days with or without PD98059 (20 µM) and in spheroid formation culture in flat bottom plates for 7, 14, and 21 days. Cells and spheroids were harvested in T-PERTM protein extraction reagent including 1% protease inhibitor cocktail, 0.5% phosphatase inhibitor cocktail I, and 0.5% phosphatase inhibitor cocktail II. Protein concentrations were assessed by BCA protein assay according to the manufacturer's instructions (19).

Cell lysates (30 µg protein/lane) were subjected to 8–12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis, transferred to a polyvinylidene difluoride membrane (#162-0176; Bio-Rad Laboratories, Hercules, CA, USA), and then blocked with 5% skimmed milk at room temperature for 1h. These membranes were incubated with primary antibodies (diluted 1:1,000; 1:2,000 for β-actin and GAPDH) at 4°C overnight and appropriate secondary antibodies (diluted 1:2,000) at room temperature for 1h. Protein bands were detected using the AzureTM c300 and quantified using the AzureSpot analysis software (version 14.2; Azure Biosystems, Inc., Dublin, CA, USA).

 Enzyme-linked immunosorbent assay (ELISA)

ELISA was performed according to the manufacturer's instruction (19). Briefly, conventional 2D monolayer and spheroid formation culture media samples (50 µl/each) were added into each well to bind E-cadherin antibody cocktail (50 µl/each) followed by incubation at room temperature for 1 h. After wells were washed with a washing buffer, TMB development solution (100 µl/each) was added into each well followed by incubation for 10 min at room temperature. A stop solution (100 µl/each) was then added and optical density was measured at 450 nm using a VERSAmax microplate reader.

 Immunocytochemistry

One and three weeks after spheroid formation culture, formed spheres (>70 µm) were collected using a cell strainer with a pore size of 70 µm (Corning Inc., #CLS431751) and fixed with 4% paraformaldehyde for 24 h at 4°C. The paraffin-embedded sections (4 µm-thick) were cut with a microtome and prepared for immunocytochemistry as previously described (19). These sections were then blocked with 10% normal horse serum for 1 h at room temperature. Incubation with an anti-E-cadherin antibody (diluted 1:100) was performed at 4°C overnight and an anti-rabbit secondary antibodies (ready-to-use) for 1h at room temperature. The binding was visualized using 3,3′-diaimnobenzidine, and nuclei were counterstained with hematoxylin (#H-3404, Vector) for 1 min at room temperature. Immunolabelled images were directly captured using a DP22 digital camera and BX-51 light microscope (Olympus, Tokyo, Japan).

 Statistical analysis

All data were compiled from a minimum of three replicate experiments. Data are expressed as mean values ± standard deviation. P<0.05 was considered to indicate a statistically significant difference as determined using Student's t-test or two-way analysis of variance (ANOVA) followed by a Bonferroni post-hoc test. MS Excel 2016 was used for statistical analysis.

 Results <sec> <title>Characteristics of WT and CDH1 KO HCT116 cells

E-cadherin in CDH1 KO cells was decreased 0.48±0.05-fold (P<0.001) compared to that in WT HCT116 cells (Fig. 1A). WT and CDH1 KO HCT116 cells showed similar proliferation curves in a time-dependent manner (P<0.001), but no difference between cell types (P=0.760) (Fig. 1B).

Effects of anticancer drugs on cell viability were assessed using the MTT assay (Fig. 1C). Cell viability was decreased in a dose-dependent manner (P<0.001 for both) in both WT and CDH1 KO HCT116 cells with similar IC50 values, but no differences between cell types against 5-FU (P=0.065), erlotinib (P=0.516), and saracatinib (P=0.802).

 Effects of exogenous E-cadherin and anti-E-cadherin antibody on WT and CDH1 KO HCT116 cells

Cell viability was decreased after exogenous E-cadherin treatment in a dose-dependent manner (P=0.001) in both WT and CDH1 KO HCT116 cell, but no differences between cell types (P=0.248). Exogenous E-cadherin at 100 ng/ml decreased cell viability of WT (0.7±0.03-fold, P<0.001) and CDH1 KO (0.84±0.04-fold; P=0.019) HCT116 cells. Exogenous E-cadherin inhibited spheroid formation in a dose-dependent manner (P<0.001) and between WT and CDH1 KO HCT116 cell types (P=0.003). Significant difference between cells was observed only at 100 ng/ml (P=0.002) of WT (0.90±0.02-fold) and CDH1 KO (0.95±0.01-fold) HCT116 cells (Fig. 2A).

Cell viability was decreased after exogenous DECMA-1 treatment in a dose-dependent manner (P<0.001) in both WT and CDH1 KO HCT116 cells, but no differences between cell types (P=0.427). Exogenous DECMA-1 at 100 ng/ml decreased viability of WT (0.87±0.03-fold; P=0.002) and CDH1 KO (0.82±0.03-fold; P=0.042) HCT116 cells without causing an inter-cellular difference. Exogenous DECMA-1 inhibited spheroid formation in a dose-dependent manner (P<0.001) in both WT and CDH1 KO HCT116 cells, but no differences between cell types (P=0.086). Exogenous DECMA-1 at 1000 ng/ml suppressed spheroidogenesis of WT (0.86±0.01-fold; P<0.001) and CDH1 KO (0.85±0.02-fold; P<0.001) HCT116 cells (Fig. 2B).

 Long-term spheroidogenesis of WT and CDH1 KO HCT116 cells

Long-term spheroidogenesis was evaluated until day 21 in WT and CDH1 KO HCT116 cells. Although the number of spheroids was decreased in a time-dependent manner (P<0.001) in both WT and CDH1 KO HCT116 cells, there was no difference between cell types (P=0.970). The size of spheroids was increased in a time-dependent manner (P<0.001) in both WT and CDH1 KO HCT116 cells, but no differences between cell types (P=0.055). Compared to WT HCT116 cells, CDH1 KO HCT116 cells showed some scattering or inability to maintain the shape of spheroids (Fig. 3A).

Morphological features were evaluated by performing immunostaining of E-cadherin (Fig. 3B). E-cadherin was immunostained in spheroids of WT HCT116 cells from day 7 to day 21. In spheroids from CDH1 KO HCT116 cells, E-cadherin immunostaining was only observed for a few cells. Some central area was neither immunostained with E-cadherin nor stained with hematoxylin for nuclei, suggesting necrotic changes.

As compared with 2D monolayer culture, spheroid cultures showed significant increase of E-cadherin in a time-dependent manner (P<0.001) and between WT and CDH1 KO HCT116 cells (P<0.001). Although E-cadherin was increased by about 4 times in spheroids as compared to that in 2D culture of WT HCT116 cells, it was increased by about 2 times in spheroid cultures of CDH1 KO HCT116 cells (Fig. 4A and Table II).

Concentrations of E-cadherin in cultured media of WT and CDH1 KO HCT116 cells for 2D monolayer and spheroid cultures were estimated by ELISA (Fig. 4B). ELISA results showed significant increase of soluble E-cadherin in a time-dependent manner (P<0.001) and between WT and CDH1 KO HCT116 cell types (P<0.001). The ratio of soluble E-cadherin in WT HCT116 cells was found to be significantly increased at 14 (2.76±0.05-fold vs. 1.19±0.03-fold; P<0.001) and 21 (5.36±0.05-fold vs. 1.39±0.05-fold; P<0.001) days after incubation in WT and CDH1 KO HCT116 cells as compared with 2D monolayer culture condition.

E-cadherin related proteins such as EGFR, β-catenin, pan-RAS, and ERK were further checked in spheroidogenesis. The proteins examined were significantly increased in spheroids as compared to those under 2D culture conditions in a time-dependent manner (P<0.001 for both) in both WT and CDH1 KO HCT116 cells, but there was no difference between cell types on EGFR (P=0.618), β-catenin (P=0.597), and pan-RAS (P=0.253), except ERK activation (P=0.037). ERK activation was significantly increased between cell types at 7 days after spheroidogenesis (P=0.012) (Fig. 4C; Table II).

 PD98059-induced E-cadherin on spheroidogenesis of WT and CDH1 KO HCT116 cells

As a significant change on ERK activation was observed in spheroidogenesis, a MEK-ERK inhibitor (PD98059) was adopted. Cell viability was decreased after PD98059 treatment in a dose-dependent manner (P<0.001) and between WT and CDH1 KO HCT116 cells (P<0.001). Cell viability was significantly decreased by PD98059 at a concentration of 10 µM (0.80±0.02-fold vs. 0.68±0.03-fold; P<0.001 for both). Intercellular difference in viability was observed for groups treated with PD98059 at 10 (P=0.002), 20 (P=0.005), or 50 µM (P=0.008) (Fig. 5A).

There was no significant difference in ERK activation between WT and CDH1 KO (1.08±0.12-fold; P=0.283) HCT116 cells (Fig. 5A). ERK activation was significantly decreased after PD98059 (20 µM; P<0.001) treatment, but there was no difference between cell types (P=0.388). However, E-cadherin was significantly increased depend on PD98059 treatment (P=0.004) and between WT and CDH1 KO HCT116 cells (P<0.001). Although E-cadherin was lower in CDH1 KO HCT116 cells as compared to WT HCT116 cells, PD98059 considerably increased E-cadherin (Fig. 5B and Table II).

PD98059 inhibited spheroid formation in a dose-dependent manner (P<0.001) and between WT and CDH1 KO HCT116 cells (P=0.014) At 10 µM, it significantly decreased spheroid formation in both cells (P<0.001 for both). Intercellular difference was observed at 1 µM (1.01±0.05-fold vs. 0.95±0.08-fold; P=0.034) and 20 µM (0.60±0.01-fold vs. 0.57±0.01-fold; P=0.032) of PD98059 (Fig. 5C).

The related proteins suggested in spheroidogenesis were further checked. β-catenin and pan-RAS were significantly increased after PD98059 treatment (P<0.001 for both), but there was no difference between WT and CDH1 KO HCT116 cells on β-catenin (P=0.913) and pan-RAS (P=0.698). However, EGFR did not change after PD98059 treatment (P=0.346) or between cell types (P=0.451) (Fig. 5D; Table III).

 Discussion

This study determined whether exogenous E-cadherin could affect spheroidogenesis of CRC cells in FBS-supplemented environment. First of all, we set CDH1 KO condition targeting the precursor exon 3 to compare general characteristics of HCT116 cells. CDH1 KO did not affect cell proliferation, chemotherapeutic responses against respective first- to third-line regimens, or spheroidogenesis as compared to WT HCT116 cells. The addition of exogenous soluble E-cadherin or DECMA-1 did not cause significant changes between WT and CDH1 KO HCT116 cells. Subtle differences in long-term maintenance of spheroids were observed. Some spheroids from CDH1 KO HCT116 cells did not maintain their shapes consistently at day 21. However, total number and mean size of spheroids were not considerably changed between WT and CDH1 KO HCT116 cells.

Controversy over E-cadherin on spheroidogenesis has been continued. Cells can aggregate and then form spheroids via E-cadherin during the initial spheroidogenesis in any environment (12). Although the expression of E-cadherin (120 kDa) was decreased during spheroid formation (22,23), E-cadherin might also induce EMT of CRC cells (24). Based on decreased E-cadherin and increased soluble E-cadherin in FBS-supplemented spheres (19), we have previously suggested that soluble E-cadherin might promote growth of spheroids and be an essential component of spheroidogenesis in FBS-supplemented environment. This hypothesis can be reinforced by previous studies showing that soluble E-cadherin could be an oncogene like EGF in spheroidogenesis (14–16) as well as conventional cultures (14). Contrary to expectations, the addition of E-cadherin protein or DECMA-1 did not show any significant effect on spheroidogenesis of HCT116 cells irrespective of CDH1 KO.

The activation of ERK was not different between WT and CDH1 KO HCT116 cells, although it was increased in spheroidogenesis. When ERK activity was inhibited by PD98059, proliferation of both WT and CDH1 KO HCT116 cells was also inhibited in a dose-dependent manner. While E-cadherin was significantly increased by PD98059 treatment, it did not lead to significant changes in spheroidogenesis of WT or CDH1 KO HCT116 cells. As compared to spheroidogenesis, PD98059 did not affect EGFR expression. EGF-dependent ERK activation (6–8) might be a relevant pathway in CRC. However, the possibility of soluble E-cadherin as an oncogene like EGF was not supported in this study.

ERK might promote EMT-like phenotype from E-cadherin to N-cadherin shift (25,26). The condition of an activated ERK with E-cadherin suppressed is known to promote proliferation and/or metastasis in CRC (27–33). Opposite results on ERK and E-cadherin have been reported (34–38), similar to results of the present study. When ERK activation was inhibited by PD98059, the proliferation of both WT and CDH1 KO HCT116 cells was inhibited with E-cadherin expression increased. Although ERK activation might have no effect on EMT in CRC (39), it decreased proliferation and inhibited invasion of CRC when E-cadherin was stabilized (40). In this context, overexpression of E-cadherin (41) or soluble E-cadherin (24) can stimulate EGFR and EGF-dependent ERK activation, resulting in cancer stem cell properties such as spheroid formation. However, when ERK activity was inhibited by PD98059, spheroidogenesis was also inhibited by PD98059 in a dose-dependent manner regardless whether E-cadherin expression was induced or CDH1 was knocked out.

To suggest details of prognostic factors for highly aggressive soft tissue sarcomas, inflammatory markers were investigated. Although clinical trial did not reveal significant differences between inflammatory markers of remission and non-remission cases (42), the tumor microenvironment would be different from tumors. E-cadherin might be involved in the pathogenesis of inflammatory breast cancer, but not that of non-inflammatory breast cancer, in which a positive association between E-cadherin loss and poor prognosis has been suggested (43,44). While reduced or loss of E-cadherin in localized tumor cells is correlated with proliferation, an increased level of soluble E-cadherin in circulation might be a marker for the extent of damaged skin caused by tumor and/or inflammation (45) or bacteria-induced diseases (46). Overexpression of soluble cell adhesion molecules, such as soluble E-cadherin, in body fluids can trigger inflammation and pro-carcinogenic programming leading to tumor induction and metastasis (46). Although the relationship among soluble E-cadherin, colon cancer and inflammation has not been thoroughly investigated, the potential value of E-cadherin for liquid biopsy in cancers has been suggested since soluble E-cadherin is significantly elevated in patients suffering from epithelial cancers including CRCs (47,48). Although soluble E-cadherin becomes hard to generalize the value due to lack of specificity and sensitivity as compared to existing tumor markers, such as carcinoembryonic antigen, it has been suggested as an alternative diagnostic biomarker for monitoring advanced CRC (49,50). Soluble E-cadherin can diffuse into the extracellular environment including blood and/or urine and act as a paracrine and/or autocrine signaling molecule (15). In this study, soluble E-cadherin was significantly increased in long-term maintained spheres with an FBS-supplemented environment, not in GF-supplemented environment as previously reported (19). This means that soluble E-cadherin cannot act as an oncogene like EGF. Although spheroidogenesis might not be closely related to CDH1 expression in HCT116 cells, the soluble E-cadherin showed significantly increases in a time-dependent manner. Therefore, it could be a biological marker for monitoring the progression of CRCs. However, this relationship of soluble E-cadherin with inflammation should further be investigated in CRC.

However, the present study has certain limitations. First of all, the possible role of soluble E-cadherin as on oncogene was suggested in SNU-C5 CRC cells (19), but there remained the un-met issue using exogenous E-cadherin or DECMA-1 treatment for spheroidogenesis. To investigate the issue timely, the commercial HCT116 cell line, well-known for 3D culture and already prepared for CDH1 KO, were purchased from the company. In order to clarify the feasible role of soluble E-cadherin, additional CRC cell lines should be further included. Second, ERK activation should be more precisely interpreted while spheroidogenesis. As ERK activation was increased in spheroidogenesis regardless of E-cadherin level, an ERK inhibitor PD98059 was adopted. PD98059 treatment inhibited ERK activation and spheroidogenesis, but increased E-cadherin. Therefore, the decreased ERK rather than ERK activation might be more paid attention to interpret the present results. In addition, PD98059 treatment did not affect EGFR expression compared to spheroidogenesis, which might mean EGFR overexpression is an essential to spheroidogenesis. As EGF-dependent ERK activation (6–8) was suggested as a relevant pathway in CRC, the related signaling pathways on E-cadherin, EGFR, ERK, or β-catenin should be further investigated. Nevertheless, a candidate signaling pathway could not be specified based on current results. Finally, further experiments using animal models or human samples including blood or urines are needed to ensure the hypothesis, a biomarker for liquid biopsy for CRC.

In conclusion, E-cadherin did not affect proliferation, viability, or spheroidogenesis of WT or CDH1 KO HCT116 cells, although soluble E-cadherin was increased in a time-dependent manner, especially being prominent in WT. These results suggest that soluble E-cadherin could be a biomarker for colorectal cancer although exogenous E-cadherin might not have a further role like an oncogene in this experimental setting. Further studies should be focused on multiple signaling pathways that can be activated or inhibited by soluble E-cadherin.

 Acknowledgements

Not applicable.

 Availability of data and materials

The data generated in the present study may be requested from the corresponding author.

 Authors' contributions

IYC and SPY conceived and designed the present study. IYC, HJB and JWH performed the experiments for data acquisition and analysis, and interpreted the experimental results. IYC and SPY confirm the authenticity of all the raw data. IYC wrote the original manuscript. SPY revised the manuscript. All authors read and approved the final version of the manuscript, and agree to be accountable for all aspects of the research in ensuring that the accuracy or integrity of any part of the work are appropriately investigated and resolved.

 Ethics approval and consent to participate

Not applicable.

 Patient consent for publication

Not applicable.

 Conflict of interest statement

The authors declare that they have no competing interests.

 References SiegelRLGiaquintoANJemalACancer statistics, 2024CA Cancer J Clin741249202410.3322/caac.2182038230766 SiegelRLWagleNSCercekASmithRAJemalAColorectal cancer statistics, 2023CA Cancer J Clin73233254202310.3322/caac.2177236856579 HechtJRCurrent and emerging therapies for metastatic colorectal cancer: Applying research findings to clinical practiceAm J Health Syst Pharm65(11 Suppl 4)S15S21quiz S22-4200810.2146/ajhp08010218499885 BerxGBeckerKFHöflerHvan RoyFMutations of the human E-cadherin (CDH1) geneHum Mutat12226237199810.1002/(SICI)1098-1004(1998)12:4<226::AID-HUMU2>3.0.CO;2-D9744472 Bustos-CarpinteyroAROliveiraCSousaAOliveiraPPinheiroHCarvalhoJMagaña-TorresMTFlores-MiramontesMGAguilar-LemarroyAJave-SuárezLFCDH1 somatic alterations in Mexican patients with diffuse and mixed sporadic gastric cancerBMC Cancer1969201910.1186/s12885-019-5294-030642281 BoccaCBozzoFCannitoSParolaMMigliettaACelecoxib inactivates epithelial-mesenchymal transition stimulated by hypoxia and/or epidermal growth factor in colon cancer cellsMol Carcinog51783795201210.1002/mc.2084621882253 KimKKimKHRohKYooBCKuJLShinYKChoJYKimMKwonMHGohSHAntitumor effects of calgranulin B internalized in human colon cancer cellsOncotarget72036820380201610.18632/oncotarget.778326933915 TrinhNTNguyenTMNYookJIAhnSGKimSAQuercetin and quercitrin from Agrimonia pilosa ledeb inhibit the migration and invasion of colon cancer cells through the JNK signaling pathwayPharmaceuticals (Basel)15364202210.3390/ph1503036435337161 HuMNHuSHZhangXWXiongSMDengHOverview on new progress of hereditary diffuse gastric cancer with CDH1 variantsTumori106346355202010.1177/030089162094966832811340 LeeYKoDYoonJLeeYKimSTMEM52B suppression promotes cancer cell survival and invasion through modulating E-cadherin stability and EGFR activityJ Exp Clin Cancer Res4058202110.1186/s13046-021-01828-733641663 Manuel IglesiasJBeloquiIGarcia-GarciaFLeisOVazquez-MartinAEguiaraACufiSPavonAMenendezJADopazoJMartinAGMammosphere formation in breast carcinoma cell lines depends upon expression of E-cadherinPLoS One8e77281201310.1371/journal.pone.007728124124614 HanSJKwonSKimKSChallenges of applying multicellular tumor spheroids in preclinical phaseCancer Cell Int21152202110.1186/s12935-021-01853-833663530 OnderTTGuptaPBManiSAYangJLanderESWeinbergRALoss of E-cadherin promotes metastasis via multiple downstream transcriptional pathwaysCancer Res6836453654200810.1158/0008-5472.CAN-07-293818483246 BrouxhonSMKyrkanidesSTengXAtharMGhazizadehSSimonMO'BanionMKMaLSoluble E-cadherin: A critical oncogene modulating receptor tyrosine kinases, MAPK and PI3K/Akt/mTOR signalingOncogene33225235201410.1038/onc.2012.56323318419 HuQPKuangJYYangQKBianXWYuSCBeyond a tumor suppressor: Soluble E-cadherin promotes the progression of cancerInt J Cancer13828042812201610.1002/ijc.2998226704932 PatilPUD'AmbrosioJIngeLJMasonRWRajasekaranAKCarcinoma cells induce lumen filling and EMT in epithelial cells through soluble E-cadherin-mediated activation of EGFRJ Cell Sci12843664379201526483386 Ramírez MorenoMBulgakovaNAThe cross-talk between EGFR and E-cadherinFront Cell Dev Biol9828673202210.3389/fcell.2021.82867335127732 MinSOLeeSWBakSYKimKSIdeal sphere-forming culture conditions to maintain pluripotency in a hepatocellular carcinoma cell linesCancer Cell Int1595201510.1186/s12935-015-0240-y26457068 ChangIYYoonSPIncreased soluble E-cadherin of spheroid formation supplemented with fetal bovine serum in colorectal cancer cellsOncol Lett25207202310.3892/ol.2023.1379337123020 BrouxhonSMKyrkanidesSTengXRajaVO'BanionMKClarkeRByersSSilberfeldATornosCMaLMonoclonal antibody against the ectodomain of E-cadherin (DECMA-1) suppresses breast carcinogenesis: Involvement of the HER/PI3K/Akt/mTOR and IAP pathwaysClin Cancer Res1932343246201310.1158/1078-0432.CCR-12-274723620408 StanichPPElgindiDStoffelEKoeppeEBansalAStetsonRCollinsDLClarkDFKarloskiEDudleyBColorectal neoplasia in CDH1 pathogenic variant carriers: A multicenter analysisAm J Gastroenterol11718771879202210.14309/ajg.000000000000199636087100 HanXYWeiBFangJFZhangSZhangFCZhangHBLanTYLuHQWeiHBEpithelial-mesenchymal transition associates with maintenance of stemness in spheroid-derived stem-like colon cancer cellsPLoS One8e73341201310.1371/journal.pone.007334124039918 ZhangZBuXChenHWangQShaWBmi-1 promotes the invasion and migration of colon cancer stem cells through the downregulation of E-cadherinInt J Mol Med3811991207201610.3892/ijmm.2016.273027600678 QianYWuXYokoyamaYOkuzakiDTaguchiMHiroseHWangJHataTInoueAHirakiME-cadherin-Fc chimera protein matrix enhances cancer stem-like properties and induces mesenchymal features in colon cancer cellsCancer Sci11035203532201910.1111/cas.1419331505062 TayPNTanPLanYLeungCHLabanMTanTCNiHManikandanJRashidSBYanBPalladin, an actin-associated protein, is required for adherens junction formation and intercellular adhesion in HCT116 colorectal cancer cellsInt J Oncol37909926201020811713 RaoCFrodymaDESouthekalSSvobodaRABlackARGudaCMizutaniTCleversHJohnsonKRFisherKWLewisREKSR1- and ERK-dependent translational regulation of the epithelial-to-mesenchymal transitionElife10e66608202110.7554/eLife.6660833970103 DíazVMHurtadoMKortEJResnatiMBlasiFThomsonTPaciucciRRequirement of the enzymatic and signaling activities of plasmin for phorbol-ester-induced scattering of colon cancer cellsExp Cell Res31222032213200610.1016/j.yexcr.2006.03.01716631161 GaoSHuJWuXLiangZPMA treated THP-1-derived-IL-6 promotes EMT of SW48 through STAT3/ERK-dependent activation of Wnt/β-catenin signaling pathwayBiomed Pharmacother108618624201810.1016/j.biopha.2018.09.06730243096 ParkYRSeoSYKimSLZhuSMChunSOhJMLeeMRKimSHKimIHLeeSOMiRNA-206 suppresses PGE2-induced colorectal cancer cell proliferation, migration, and invasion by targetting TM4SF1Biosci Rep38BSR20180664201810.1042/BSR2018066430135139 DongLDingCZhengTPuYLiuJZhangWXueFKangPMaYWangXMaoCExtracellular vesicles from human umbilical cord mesenchymal stem cells treated with siRNA against ELFN1-AS1 suppress colon adenocarcinoma proliferation and migrationAm J Transl Res1169896999201931814902 YangXZhengYTRongWSevoflurane induces apoptosis and inhibits the growth and motility of colon cancer in vitro and in vivo via inactivating Ras/Raf/MEK/ERK signalingLife Sci239116916201910.1016/j.lfs.2019.11691631626792 ChengBRongAZhouQLiWLncRNA LINC00662 promotes colon cancer tumor growth and metastasis by competitively binding with miR-340-5p to regulate CLDN8/IL22 co-expression and activating ERK signaling pathwayJ Exp Clin Cancer Res395202010.1186/s13046-019-1510-731900207 JunJHOhJEShimJKKwakYLChoJSEffects of bisphenol A on the proliferation, migration, and tumor growth of colon cancer cells: In vitro and in vivo evaluation with mechanistic insights related to ERK and 5-HT3Food Chem Toxicol158112662202110.1016/j.fct.2021.11266234743013 MinelliRSerpeLPettazzoniPMineroVBarreraGGigliottiCMesturiniRRosaACGascoPVivenzaNCholesteryl butyrate solid lipid nanoparticles inhibit the adhesion and migration of colon cancer cellsBr J Pharmacol166587601201210.1111/j.1476-5381.2011.01768.x22049973 SatowRHiranoTBatoriRNakamuraTMurayamaYFukamiKPhospholipase Cδ1 induces E-cadherin expression and suppresses malignancy in colorectal cancer cellsProc Natl Acad Sci USA1111350513510201410.1073/pnas.140537411125197077 PengCLiZNiuZNiuWXuZGaoHNiuWWangJHeZGaoCNorcantharidin suppresses colon cancer cell epithelial-mesenchymal transition by inhibiting the αvβ6-ERK-Ets1 signaling pathwaySci Rep620500201610.1038/srep2050026846153 LiXZhangGWangYElgehamaASunYLiLGuYGuoWXuQLoss of periplakin expression is associated with the tumorigenesis of colorectal carcinomaBiomed Pharmacother87366374201710.1016/j.biopha.2016.12.10328068625 ChangYFWangHHShuCWTsaiWLLeeCHChenCLLiuPFTMEM211 promotes tumor progression and metastasis in colon cancerCurr Issues Mol Biol4545294543202310.3390/cimb4506028737367036 LiYZhuGZhaiHJiaJYangWLiXLiuLSimultaneous stimulation with tumor necrosis factor-α and transforming growth factor-β1 induces epithelial-mesenchymal transition in colon cancer cells via the NF-κB pathwayOncol Lett1568736880201829725419 LinMCWangFYKuoYHTangFYCancer chemopreventive effects of lycopene: Suppression of MMP-7 expression and cell invasion in human colon cancer cellsJ Agric Food Chem591130411318201110.1021/jf202433f21923160 BartucciMSvenssonSRicci-VitianiLDattiloRBiffoniMSignoreMFerlaRDe MariaRSurmaczEObesity hormone leptin induces growth and interferes with the cytotoxic effects of 5-fluorouracil in colorectal tumor stem cellsEndocr Relat Cancer17823833201010.1677/ERC-10-008320603394 HashimotoKNishimuraSShinyashikiYItoTAkagiMCharacterizing inflammatory markers in highly aggressive soft tissue sarcomasMedicine (Baltimore)101e30688202210.1097/MD.000000000003068836181081 KleerCGvan GolenKLBraunTMerajverSDPersistent E-cadherin expression in inflammatory breast cancerMod Pathol14458464200110.1038/modpathol.388033411353057 CohenENGaoHAnfossiSMegoMReddyNGDebebBGiordanoATinSWuQGarzaRJInflammation mediated metastasis: Immune induced epithelial-to-mesenchymal transition in inflammatory breast cancer cellsPLoS One10e0132710201510.1371/journal.pone.013271026207636 ShirahamaSFurukawaFWakitaHTakigawaME- and P-cadherin expression in tumor tissues and soluble E-cadherin levels in sera of patients with skin cancerJ Dermatol Sci133036199610.1016/0923-1811(95)00493-98902651 DevauxCAMezouarSMegeJLThe E-cadherin cleavage associated to pathogenic bacteria infections can favor bacterial invasion and transmigration, dysregulation of the immune response and cancer induction in humansFront Microbiol102598201910.3389/fmicb.2019.0259831781079 KatayamaMHiraiSYasumotoMNishikawaKNagataSOtsukaMKamihagiKKatoISoluble fragments of e-cadherin cell-adhesion molecule increase in urinary-excretion of cancer-patients, potentially indicating its shedding from epithelial tumor-cellsInt J Oncol510491057199421559679 RepettoODe PaoliPDe ReVCanzonieriVCannizzaroRLevels of soluble E-cadherin in breast, gastric, and colorectal cancersBiomed Res Int2014408047201410.1155/2014/40804725535613 WeissJVKlein-ScorySKüblerSReinacher-SchickAStrickerISchmiegelWSchwarte-WaldhoffISoluble E-cadherin as a serum biomarker candidate: Elevated levels in patients with late-stage colorectal carcinoma and FAPInt J Cancer12813841392201110.1002/ijc.2543820473926 OkugawaYToiyamaYInoueYIwataTFujikawaHSaigusaSKonishiNTanakaKUchidaKKusunokiMClinical significance of serum soluble E-cadherin in colorectal carcinomaJ Surg Res175e67e73201210.1016/j.jss.2011.11.00922277332

General characteristics of WT and CDH1 KO HCT116 cells. (A) CDH1 KO was confirmed by western blotting. (B) Proliferation was similar between two cell types. (C) Respective cell viability after treatment with an anticancer drug, 5-FU, epidermal growth factor receptor inhibitor (erlotinib) or src kinase inhibitor (saracatinib) was similar between two cell lines. ***P<0.001 vs. WT; #P<0.05, ##P<0.01, ###P<0.001 vs. vehicle. WT, wild-type; KO, knock-out; 5-FU, 5-fluorouracil.

Effects of exogenous E-cadherin and DECMA-1 on WT and CDH1 KO HCT116 cells. (A) Although exogenous E-cadherin decreased viability and sizes of spheroids in both cells, a little but considerable changes was observed in CDH1 KO cells at higher dose (100 ng/ml). (B) Exogenous DECMA-1 significantly decreased viability and sizes of spheroids of both cells. Scale bar=200 µm. *P<0.05, **P<0.01, ***P<0.001 vs. vehicle; ##P<0.01 vs. WT at same concentration. WT, wild-type; KO, knock-out.

Long-term spheroidogenesis of WT and CDH1 KO HCT116 cells. (A) When spheroidogenesis was maintained for 21 days, the number of spheroids was decreased while sizes of spheroids were increased in a time-dependent manner in both cells. Interestingly, some spheroids from CDH1 KO cell line lost their morphological integrity (arrows). Scale bar=500 µm. (B) Immunocytochemistry (magnification, ×4 and ×20) using with an anti-E-cadherin antibody for spheroids revealing decreased E-cadherin in CDH1 KO cells. Arrows indicate necrosis. *P<0.05, ***P<0.001 vs. Day 7. WT, wild-type; KO, knock-out.

Characteristics of long-term-maintained spheroids of WT and KO HCT116 cells. (A) Western blotting showing significant increase of E-cadherin in spheroids (3D) as compared to conventional 2D culture in both cell lines. (B) ELISA on culture media showing time-dependent increases of soluble E-cadherin in spheroid culture, with such increases being prominent in WT HCT116 cells. (C) Western blotting showing significant increases of EGFR, β-catenin, pan-RAS, and ERK activation in spheroid culture as compared to 2D cultures in both cell lines. *P<0.05, **P<0.01, ***P<0.001 vs. 2D; #P<0.05, ##P<0.01, ###P<0.001 vs. WT at same time. WT, wild-type; KO, knock-out; 2D, 2-dimensional; 3D, 3-dimensional.

Effects of PD98059 on E-cadherin and spheroidogeneis of WT and CDH1 KO HCT116 cells. (A) PD98059 decreased cell viability in dose-dependent manner with a significant difference between WT and CDH1 KO HCT116 cells while ERK activation was similar. (B) PD98059 (20 µM) inhibited ERK activation in both cells, but increased E-cadherin expression. (C) PD98059 decreased sizes of spheroids in both cell lines. (D) PD98059 significantly increased the expression of β-catenin and pan-RAS without affecting the expression of EGFR. Scale bar=200 µm. *P<0.05, **P<0.01, ***P<0.001 vs. vehicle; #P<0.05, ###P<0.001 vs. WT. WT, wild-type; KO, knock-out.

Reagents and antibodies used in the experiment.

A, Reagents
Name (cat. no.) Company Purpose/action
MTT (M6494) Thermo Fisher Scientific Cell viability
5-FU (F6627); erlotinib (S2156) Sigma-Aldrich (Merck KGaA) Anti-cancer drugs
Saracatinib (11497) Cayman Chemical
T-PER™ protein extraction reagent (78510) Thermo Fisher Scientific Preparation for western blotting
Protease inhibitor cocktail (ab201111); Abcam Preparation for western blotting
phosphatase inhibitor cocktail I (ab201112);
phosphatase inhibitor cocktail II (ab201113)
Pierce™ BCA protein assay kit (23227) Thermo Fisher Scientific Preparation for western blotting
PD98059 (9900) Cell Signaling Tech MEK-ERK inhibitor
Hematoxylin (H-3404) Vector Laboratories Counter-staining
Human E-cadherin protein (ab235682) Abcam Recombinant E-cadherin protein for
spheroidogenesis
DECMA-1 (ab11512) Abcam Anti-E-cadherin antibody
(intercellular junction marker)
for spheroidogenesis
Human E-cadherin SimpleStep ELISA Kit (ab233611) Abcam Soluble E-cadherin detection
B, Antibodies
Name (cat. no.) Company Purpose/action
Phosphor-ERK (4370) Cell Signaling Tech Primary antibody
EGFR (ab52894) Abcam Primary antibody
ERK (sc-93); β-catenin (sc-7199); Santa Cruz Biotechnology Primary antibody
pan-RAS (sc-166691); β-actin (sc-47778);
GAPDH (sc-47724)
Anti-mouse IgG (PI-2000); anti-rabbit IgG (PI-1000) Vector Laboratories Secondary antibody
ImmPRESS Reagent kit (MP-7401) Vector Laboratories Immunocytochemistry

5-FU, 5-fluorouracil; phosphor, phosphorylated.

Densitometric comparison of spheroid formation between WT and CDH1 KO HCT116 colorectal cancer cells.

Spheroids
Protein Cell type 2D Day 7 Day 14 Day 21
E-cadherin WT 1.00±0.17 4.01±0.73 (bP=0.001) 4.34±0.85 (bP=0.002) 4.24±0.74 (bP=0.001)
KO 0.49±0.08 1.05±0.21 (aP=0.014; 1.22±0.24 (bP=0.008; 0.88±0.10 (bP=0.003;
(fP<0.001) eP=0.001) eP=0.003) fP<0.001)
EGFR WT 1.00±0.05 1.74±0.46 (bP=0.006) 1.64±0.50 (aP=0.013) 1.35±0.17 (bP=0.001)
KO 0.80±0.22 1.77±0.45 (cP<0.001) 1.71±0.41 (cP<0.001) 1.68±0.49 (bP=0.001)
β-catenin WT 1.00±0.05 2.19±0.46 (cP<0.001) 2.31±0.53 (cP<0.001) 1.81±0.35 (cP<0.001)
KO 0.83±0.29 1.75±0.36 (cP<0.001) 2.68±0.27 (cP<0.001) 2.28±0.65 (cP<0.001)
Pan-RAS WT 1.00±0.05 2.51±0.85 (cP<0.001) 2.86 0.64 (cP<0.001) 2.69±0.49 (cP<0.001)
KO 1.19±0.28 2.00±0.35 (cP<0.001) 2.67±0.67 (cP<0.001) 2.57±0.57 (cP<0.001)
pERK/ERK WT 1.00±0.27 1.62±0.55 (aP=0.016) 1.62±0.62 (aP=0.029) 2.32±0.72 (bP=0.003)
KO 1.16±0.35 2.40±0.45 (cP<0.001; 2.15±0.66 (bP=0.005) 2.31±0.80 (bP=0.007)
dP=0.012)

Results are expressed as relative fold as compared to 2D culture condition of WT cells.

P<0.05,

P<0.01,

P<0.001 vs. 2D culture condition;

P<0.05,

P<0.01,

P<0.001 vs. WT. WT, wild-type; KO, knock-out; 2D, 2-dimensional.

Densitometric comparison of effects of PD98059 treatment on WT and CDH1 KO HCT116 colorectal cancer cells.

Protein Cell type Vehicle PD98059
pERK/ERK WT 1.00±0.11 0.61±0.16 (cP<0.001)
KO 1.14±0.40 0.66±0.18 (aP=0.022)
E-cadherin WT 1.00±0.12 2.15±1.26 (aP=0.012)
KO 0.55±0.16 0.76±0.18 (eP=0.004)
(fP<0.001)
EGFR WT 1.00±0.16 1.14±0.22
KO 1.13±0.16 1.12±0.13
β-catenin WT 1.00±0.04 3.08±0.74 (cP<0.001)
KO 1.50±0.43 2.52±0.92 (bP=0.005)
Pan-RAS WT 1.00±0.02 1.58±0.24 (cP<0.001)
KO 1.18±0.17 1.45±0.28 (eP=0.005)
(bP=0.001)

Results are expressed as relative fold as compared to vehicle-treated condition of WT cells.

P<0.05,

P<0.01,

P<0.001 vs. vehicle-treated condition;

P<0.01,

P<0.001 vs. WT. WT, wild-type; KO, knock-out.