ETM Experimental and Therapeutic Medicine 1792-0981 1792-1015 D.A. Spandidos ETM-30-1-12894 10.3892/etm.2025.12894 Articles Methylation levels in the GRIN2B promoter region are associated with bipolar disorder and its anxiety and insomnia symptoms YuHao WuYao ZouShaohong Department of Clinical Psychology, People's Hospital of Xinjiang Uygur Autonomous Region, Urumqi, Xinjiang 830001, P.R. China Correspondence to: Professor Shaohong Zou, Department of Clinical Psychology, People's Hospital of Xinjiang Uygur Autonomous Region, 91 Tianchi Road, Jiefang South Road, Tianshan, Urumqi, Xinjiang 830001, P.R. China zoushaohong@126.com 072025 23052025 30 1 144 30 01 2025 30 04 2025 Copyright: © 2025 Yu et al. 2025 This is an open access article distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivs License, which permits use and distribution in any medium, provided the original work is properly cited, the use is non-commercial and no modifications or adaptations are made.

This study investigated the potential role of promoter-region DNA methylation in GRIN2B in bipolar disorder (BD) and its association with anxiety and insomnia symptoms among patients with BD. The DNA methylation levels in the GRIN2B promoter region were quantified using MassARRAY technology in peripheral blood samples from 31 patients with BD and 32 healthy controls. To assess associations, binary logistic regression and partial correlation analyses were performed to examine potential links between GRIN2B methylation, BD diagnosis and symptom severity. The exploratory analysis revealed six differentially methylated CpG sites between groups, four of which exhibited hypermethylation in patients with BD compared with the controls. Significant positive correlations were observed between Hamilton Anxiety Rating Scale scores and CpG9 methylation (r=0.408, P=0.038), as well as between Pittsburgh Sleep Quality Index scores and CpG8 methylation (r=0.419, P=0.033). These findings provide preliminary evidence supporting an association between GRIN2B methylation levels and BD, as well as related clinical symptoms. However, given the small sample size and the exploratory nature of this study, these results should be interpreted with caution. Further replication in larger, longitudinal cohorts is warranted to confirm these observations and evaluate their clinical implications.

 GRIN2B DNA methylation bipolar disorder anxiety insomnia Funding: This study was supported by grants from the Natural Science Foundation of Xinjiang Uygur Autonomous Region (grant no. 2022D01C606) and the Tianshan Innovation Team Plan of Xinjiang Uygur Autonomous Region (grant no. 2022D14011). Introduction

Bipolar disorder (BD) is associated with severe mental disability and an increased risk of suicide, significantly contributing to the societal burden (1,2). Insomnia and anxiety, two common concomitant symptoms of BD, often persist throughout the course of the illness. Approximately 45% of individuals with BD will experience co-morbid anxiety disorders over their lifetime (3). This comorbidity further exacerbates the risk of substance dependence and suicide (4), worsening social functioning and quality of life in individuals with BD (5). Crucially, anxiety symptoms have become a key target for early intervention in individuals at risk of BD (6), anxiety in BD is associated with an increased risk of subjective sleep disturbances (7). Sleep, as a key regulator of both metabolic homeostasis and oxidative stress, plays a particularly significant role; when disrupted, it can contribute to the onset and progression of BD. Given their role as cross-diagnostic precursors, insomnia and anxiety represent high-priority therapeutic targets for preventing BD episodes (8,9).

The N-methyl-D-aspartate receptor subunit 2B (GRIN2B) gene, which is located at 12p13.1, spans 419 kilobases and consists of 15 exons. N-methyl-D-aspartate receptors (NMDARs), a class of ionotropic glutamate receptors, are involved in regulating neuronal activity, synaptic plasticity and excitatory transmission, with substantial implications for the pathophysiology and treatment of affective disorders (10). The GRIN2B gene encodes the NMDAR subunit 2B (NR2B), which is crucial for determining both the structure and functional dynamics of NMDARs; overexpression of NR2B leads to long-lasting enhancement and increased synaptic efficacy (11). Light, which is the primary driver of sleep rhythm regulation (12), triggers numerous intracellular cascades through NMDARs in the suprachiasmatic nucleus (SCN), ultimately affecting the expression of clock genes (13) studies have demonstrated that circadian rhythm disturbances in mice correlate with reduced expression of the NR2B subunit of NMDARs in the SCN (14,15). Additionally, rats subjected to maternal separation showed a significant increase in anxiety, accompanied by upregulated expression of the GRIN2B gene (16), while ethanol-exposed mice displayed anxiety-like behaviors with elevated levels of GRIN2B mRNA expression in the cerebellum (17).

DNA methylation, one of the most stable epigenetic mechanisms, is increasingly recognized as a potential biomarker for numerous neuropsychiatric disorders (18) and various malignancies (19). It plays a significant role in the pathophysiology of BD (20) and may serve as a biomarker for variability in BD treatment response (21). Numerous studies have identified significant DNA methylation changes in patients with BD, particularly in regions such as the prefrontal cortex and peripheral leukocytes (22-24), with potential links to suicidal behavior (25), cognitive impairment (26) and substance dependence (27). Emerging evidence from cancer epigenetics demonstrates that methylation patterns can effectively stratify disease subtypes and predict clinical outcomes (28,29), suggesting similar precision medicine applications could be explored in BD. However, few studies have specifically examined the associations of DNA methylation with anxiety and insomnia in BD, despite established methodological frameworks for epigenetic analysis in other neuropsychiatric conditions, such as depression (30) and schizophrenia (31).

Based on these findings, GRIN2B epigenetics appears to play a significant role in the development of BD and related anxiety and insomnia symptoms. However, the role of GRIN2B in BD remains controversial; a study detected no disease-associated variants in glutamatergic genes (including GRIN2B) through targeted sequencing in patients with BD (32), whereas another study reported associations between GRIN2B genotypes and both psychotic symptoms and disease relapse in BD (33). Research on GRIN2B gene inheritance as it relates to anxiety and insomnia has been largely restricted to animal models (34,35). Therefore, to further clarify the relationship between GRIN2B gene inheritance (particularly DNA methylation) and BD, as well as its potential role in anxiety and insomnia among patients with BD, DNA methylation levels were measured in the GRIN2B gene's promoter region in peripheral blood leukocytes from patients with BD and healthy controls via the MassARRAY method and the possibility of an association was analyzed.

 Patients and methods <sec> <title>Participants and procedure

A total of 31 patients diagnosed with BD (in the depressive phase) were recruited from the inpatient units of the Clinical Psychology Department at the People's Hospital of Xinjiang Uygur Autonomous Region (Urumqi, China) between April and December 2023, while 32 healthy controls (HCs) were concurrently enrolled from hospital staff and students at the affiliated Medical University during the same study period. All participants were aged 18-55 years. The upper age limit was set to 55 years to minimize age-related confounding factors. This threshold aligns with evidence that epigenetic drift accelerates after age 55(36), age-associated methylation changes increasingly interact with inflammatory/metabolic pathways beyond age 50(37) and neurodegenerative comorbidities in older populations may introduce spurious associations (38). BD diagnosis was confirmed using the Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition, Text Revision (DSM-IV-TR) criteria (39), based on structured clinical interviews conducted by two senior psychiatrists. Eligible patients met the following criteria: i) No medication, psychotherapy or physical therapy for ≥6 months before recruitment; ii) Hamilton Depression Rating Scale (HAMD)-24 [specifying the 24-item Hamilton Depression Rating Scale (HAMD-24); total score range: 0-76] to distinguish clinical severity thresholds from the 17-item version (HAMD-17), total score >20(40); and iii) Young Mania Rating Scale (YMRS) total score <7(41). The exclusion criteria (applied to all participants) were as follows: i) Comorbid psychiatric disorders (DSM-IV-TR axis I/II) (42); ii) history of organic brain disease or severe systemic illness; iii) pregnancy or lactation (women); and iv) substance abuse/dependence (drugs, alcohol or psychoactive substances). This study was reviewed and approved by the Ethics Committee of the People's Hospital of Xinjiang Uygur Autonomous Region (Urumqi, China; approval no. KY2023020968). All subjects volunteered to participate in the study and provided written informed consent prior to the study.

 Data collection

Demographic data, including age, gender, education level and history of smoking and alcohol use, were collected from all participants. Clinical data, such as age at onset, illness duration, subtype, HAMD-24 score, depression severity, YMRS score, 14-item Hamilton Anxiety Scale (HAMA-14) (43) score and Pittsburgh Sleep Quality Index (PSQI) (44) score, were obtained from patients only.

 DNA extraction and bisulfite conversion

Peripheral fasting venous blood samples (~5 ml) were collected from patients with BD using EDTA anticoagulant tubes (BD Biosciences) within 24 h of hospital admission, prior to the initiation of any new pharmacotherapy. Healthy control samples were obtained the following morning after enrollment. Genomic DNA was subsequently extracted using the solution-based Genenode DNA extraction kit (Wuhan Genenode Biotech) according to the manufacturer's protocol and stored at -80˚C. Quality control assessments included spectrophotometric analysis for determining DNA concentration and agarose gel electrophoresis to verify DNA integrity. Following extraction, the isolated DNA underwent modification and purification using the EZ DNA Methylation-Gold™ Kit (Zymo Research Corp.) according to the manufacturer's protocol. During this process, cytosine residues that were non-methylated were deaminated to uracil, while methylated cytosine residues remained stable.

 DNA methylation assay. Primer design

The CpG island prediction website was utilized to predict potential CpG islands in the GRIN2B promoter region gene sequences, identifying two CpG islands (Fig. 1A). The Agena EpiDesigner program (http://www.epidesigner.com) was used to design primers for the target GRIN2B sequences (Fig. 1B), and a fragment with a high level of CpG methylation (#14 in Fig. 2A) was selected as the primer sequence (Fig. 2A and B). Details of the primer sequences are provided in Table I.

Methylation assay of GRIN2B. The bisulfite-converted GRIN2B DNA was amplified by PCR using the primers mentioned above. Optimal amplification conditions were achieved through digestion with shrimp alkaline phosphatase, transcriptional cleavage and resin-based purification. The purified PCR product was then transferred to a 384-well SpectroCHIP® bioarray (Axygen; Corning, Inc.) for precise spot sampling using the Agena Nanodispenser RS1000 spotter (Agena Bioscience). The spotted bioarray was analyzed by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry with the MassARRAY Analyzer 4.0 (Axygen; Corning, Inc.) to generate mass spectra. Methylation levels were then quantified from these spectra using Epityper 1.2 software (Sequenom).

 Statistical analysis

All analyses were performed using SPSS 27.0 (IBM Corp.) and OriginPro 8.5.0 (OriginLab Corp.). Continuous variables were assessed for normality using Shapiro-Wilk tests. Normally distributed data were expressed as the mean ± standard deviation and compared using independent-samples t-tests. Non-normally distributed data were reported as the median (interquartile range) and analyzed with Mann-Whitney U-tests. Categorical variables were presented as frequencies (percentages) and evaluated by χ² tests. All group comparisons were adjusted using the Bonferroni method to control for Type I error inflation. Binary logistic regression models adjusted for age, sex and education duration were constructed to examine the association between GRIN2B promoter methylation (independent variable) and bipolar disorder diagnosis (dependent variable). Partial correlation analyses (based on the Pearson correlation coefficient) controlling for age, sex, education level and HAMD scores were conducted to assess relationships between GRIN2B methylation levels and clinical symptom severity, specifically insomnia severity (PSQI) and anxiety severity (HAMA-14). A two-sided α-level of 0.05 was set as the statistical significance threshold for all analyses. All tests were performed with 95% confidence intervals (95% CI).

 Results <sec> <title>Sample description

In Table II, the demographic and clinical profiles of patients with BD and healthy controls were presented. The BD group included 31 participants [8 male (25.8%), 23 female (74.2%)] with a median age of 23 years [interquartile range (IQR), 20-39], while the HC group comprised 32 individuals [11 male (34.4%), 21 female (65.6%)] with a median age of 26.5 years (IQR, 22.0-37.5). No statistically significant differences were observed between the groups in terms of age, years of education, gender or smoking and drinking history (P>0.05).

 GRIN2B DNAm and BD. Altered GRIN2B DNAm patterns in patients with BD

In the present study, the DNA methylation levels of 12 CpG sites in the GRIN2B promoter region were compared between patients with BD and HCs. An independent-samples t-test showed that 6 out of the 12 CpG sites (50%) had statistically significant differences in DNA methylation levels between the groups (Fig. 3). Specifically, CpG3, CpG5, CpG10 and CpG12 showed hypermethylation, while CpG1 and CpG7 showed hypomethylation in patients with BD compared to HCs. Among these, CpG3 (BD: 52.52±10.00%; HC: 32.60±25.70%) and CpG1 (BD: 36.03±13.94%; HC: 19.15±12.33%) exhibited the most significant differences in methylation levels between the two groups (P<0.001).

Association of BD with GRIN2B methylation. The predictive role of GRIN2B DNA methylation in the development of BD was analyzed using a binary logistic regression model with stepwise forward selection. Age, gender and years of education were included as covariates and the final model chosen through stepwise selection yielded a chi-square test value of χ²=44.49 (P<0.001), indicating model significance. The Hosmer-Lemeshow test result was χ²=3.896 (P=0.866), suggesting a good fit. The model identified four variables associated with the likelihood of BD development, specifically the hypermethylation of CpG3, CpG5, CpG10 and CpG12. Among these, CpG3 [P=0.002, odds ratio (OR)=1.079, 95% CI: 1.029-1.132] and CpG10 (P=0.002, OR=1.113, 95% CI: 1.042-1.190) demonstrated a significant predictive role (Table III).

 Association of GRIN2B DNA methylation with anxiety and insomnia in BD

Partial correlation analysis (Table IV) revealed that the HAMA-14 score was positively associated with methylation levels of CpG9 (r=0.408, P=0.038) after controlling for age, gender and years of education (r=0.419, P=0.033). Similarly, the PSQI score showed a positive correlation with methylation levels of CpG8 at the GRIN2B locus. No significant correlations were observed between other CpG sites and either the HAMA or PSQI scores (P>0.05).

 Discussion

To our knowledge, this study provides the first evidence of differential DNA methylation patterns in the GRIN2B promoter region among patients with BD. The present findings not only demonstrate the association between GRIN2B methylation status and BD diagnosis but also reveal clinically meaningful correlations with comorbid anxiety symptoms and sleep disturbances in this population.

The present analysis revealed differential DNA methylation patterns at specific CpG sites within the GRIN2B promoter region between patients with BD and HCs. Among the 12 analyzed CpG loci, six exhibited methylation alterations: CpG3, CpG5, CpG10 and CpG12 showed hypermethylation, whereas CpG1 and CpG7 displayed hypomethylation. Notably, after adjusting for covariates through logistic regression, only the hypermethylation patterns at CpG3, CpG5, CpG10 and CpG12 maintained statistical significance, suggesting that site-specific epigenetic modifications may be particularly relevant to BD pathophysiology. The GRIN2B gene encodes a critical subunit of the NMDAR complex and DNA methylation-dependent transcriptional modulation may alter NMDAR subunit composition, potentially disrupting synaptic plasticity in prefrontal-temporal-limbic circuits. The functional impact of BD-associated GRIN2B polymorphisms identified in German-Jewish (45) and Chinese Han populations (46) could be modulated by the local methylation status. Notably, the clinical relevance of these mechanisms is underscored by prior findings that the GRIN2B genotype predicts psychotic symptom severity and relapse frequency in patients with BD (33), suggesting methylation-mediated expression changes may similarly impact the disease course. Intriguingly, the therapeutic efficacy of quetiapine in BD may involve GRIN2B-related pathways, as molecular docking studies suggest its interaction with neuroactive ligand-receptor systems regulated by GRIN2B (47). Hypermethylation-induced GRIN2B downregulation could reduce NMDAR density in key brain regions (e.g., prefrontal cortex and hippocampus) (48) creating a neurobiological state amenable to mood stabilizer modulation. While the present findings align with gene-environment interaction models proposing methylation as a dynamic interface between genetic predisposition and environmental stressors, three critical considerations emerge: First, the observed methylation differences may represent either compensatory adaptations or pathogenic processes. Second, glutamatergic dysfunction (49) could serve as both precursor and consequence of neurodevelopmental alterations in BD; and third, the functional consequences of site-specific methylation require validation through allele-specific expression analyses.

In the present study, it was also found that DNA methylation levels of GRIN2B were associated with anxiety and insomnia symptoms in BD, independent of age, gender, education or depression severity. This epigenetic alteration may contribute to BD-related psychopathology by suppressing GRIN2B transcription, thereby reducing the availability of functional NR2B subunits-a critical component of NMDARs implicated in synaptic plasticity and glutamatergic signaling (50), diminished NR2B activity could impair glutamate-mediated neurotransmission in limbic circuits (e.g., prefrontal cortex-amygdala connectivity and hippocampal networks), which are essential for emotion regulation and stress adaptation (34,51-53).

The association between GRIN2B methylation levels and anxiety symptoms may stem from dysregulated NMDAR-dependent excitatory-inhibitory balance. Specifically, hippocampal NMDARs are critical to behavioral inhibitory systems (40), and NR2B subunit deficiency-induced functional impairment could exacerbate anxiety-related neural hyperactivity. For instance, preclinical studies demonstrate that environmental stressors [e.g., benzo (a) pyrene exposure or high-fat diets] induce anxiety-like behaviors in tandem with elevated GRIN2B methylation in brain regions governing fear responses (34,54) epigenetic silencing likely attenuates NMDAR-mediated synaptic potentiation in the ventral hippocampus and anterior cingulate cortex-key regions where NR2B modulates anxiety-like phenotypes (52,53,55), ketamine's rapid anxiolytic effects-mediated by NMDAR antagonism (56)-further support the hypothesis that GRIN2B methylation-driven NMDAR hypofunction could perpetuate anxiety states in BD.

Insomnia is a hallmark symptom of anti-NMDAR encephalitis, with clinical evidence underscoring the critical role of NMDAR dysfunction in sleep architecture disruption (57), aberrant GRIN2B methylation may perturb sleep-wake regulation through two interconnected pathways: i) Diminished NR2B expression in the hypothalamic SCN, where NR2B-containing NMDARs are essential for circadian rhythm entrainment (15,58); and ii) impaired Non-Rapid Eye Movement (NREM) sleep homeostasis caused by reduced NMDAR-mediated excitability in the lateral preoptic hypothalamus, a key region for sleep initiation and maintenance (59). The findings of the present study align with chronic sleep deprivation studies in young mice demonstrating reduced NR2B levels (35), suggesting that GRIN2B aberrant methylation may exacerbate insomnia by impairing NMDAR-dependent synaptic adaptation to sleep pressure. Additionally, selective NR2B antagonism disrupts cortical gamma oscillations during REM sleep (60), indicating that GRIN2B epigenetic silencing could destabilize sleep architecture through dysregulated glutamatergic neurotransmitter interactions.

While the present study yielded promising results, several critical limitations must be acknowledged. First, the conclusions may be constrained by the relatively small sample size, which reduces statistical power to detect robust epigenetic associations. Given the established clinical and biological heterogeneity of BD, the limited sample of the present study may not adequately represent the full spectrum of disease subtypes. These factors, combined with the cross-sectional design, preclude causal inferences; it cannot be determined whether the observed GRIN2B methylation alterations are causes or consequences of BD pathophysiology. Second, the reliance on peripheral blood methylation profiles raises questions about their biological relevance to brain processes. While blood-based biomarkers offer clinical practicality, it remains elusive whether these patterns mirror those in the central nervous system. Future validation should incorporate postmortem brain tissue analyses or emerging cerebrospinal fluid-based epigenetic profiling techniques. Third, the present study relied on retrospective data collection and self-reported medical histories, which may have resulted in the underreporting of comorbidities. This could lead to unintentional inclusion of patients with undiagnosed conditions that met exclusion criteria, potentially confounding the observed methylation patterns. Fourth, while cohort homogeneity was improved by exclusively recruiting patients with BD in the depressive phase, this design limits the generalizability of findings to other disease phases (e.g., manic or euthymic states). Epigenetic markers may exhibit phase-dependent fluctuations, implying the results could reflect state-specific alterations rather than trait characteristics of BD. Fifth, the lack of integrated single-nucleotide polymorphism analyses and gene expression data limits our ability to elucidate gene-environment interactions underlying the observed methylation changes. Most importantly, these preliminary findings require replication in larger, independent cohorts with longitudinal designs to establish clinical generalizability. Future investigations should prioritize multicenter collaborations, incorporate pharmaco-epigenetic analyses and employ multi-omics approaches to comprehensively characterize GRIN2B methylation dynamics in BD progression, and explicitly address phase-specific biomarker variations through cross-state comparisons.

In conclusion, the present study demonstrated for the first time that DNA hypermethylation in the GRIN2B promoter region is associated with BD and may play a role in mediating the development of anxiety and insomnia symptoms in patients with BD. These findings underscore the importance of gene-environment interactions in BD and advance a better understanding of its complex etiology. Early intervention strategies targeting these mechanisms could improve timely diagnosis, symptom management and long-term outcomes in BD. Further studies are warranted to validate GRIN2B methylation as both a diagnostic biomarker and therapeutic target for BD.

 Acknowledgements

Not applicable.

 Availability of data and materials

The datasets generated and/or analyzed during the current study are not publicly available due to ethical issues involving the participants' data and privacy but may be requested from the corresponding author.

 Authors' contributions

SZ and HY conducted and designed the study. HY and YW collected the data. HY analyzed the data and drafted the manuscript. SZ revised the manuscript. SZ and YW have independently checked and verified the authenticity of the raw data. All authors have read and approved the final manuscript.

 Ethics approval and consent to participate

This study was approved by the Human Research and Ethics Committee of Xinjiang Uygur Autonomous Region People's Hospital (Urumqi, China; approval no. KY2023020968). This study adhered to the guidance listed in the latest version of the Declaration of Helsinki. All subjects volunteered to participate in the study provided written informed consent prior to the study. The participants were also informed that they could withdraw from the study at any time without any reason or consequence.

 Patient consent for publication

Not applicable.

 Competing interests

The authors declare that they have no competing interests.

 References GBD 2019 Mental Disorders Collaborators: Global, regional, and national burden of 12 mental disorders in 204 countries and territories, 1990-2019: A systematic analysis for the global burden of disease study 2019Lancet Psychiatry913715020223502613910.1016/S2215-0366(21)00395-3 GrandeIBerkMBirmaherBVietaEBipolar disorderLancet3871561157220162638852910.1016/S0140-6736(15)00241-X PavlovaBPerlisRHAldaMUherRLifetime prevalence of anxiety disorders in people with bipolar disorder: A systematic review and meta-analysisLancet Psychiatry271071720152624930210.1016/S2215-0366(15)00112-1 LopesFLZhuKPurvesKLSongCAhnKHouLAkulaNKassemLBergenSELandenMPolygenic risk for anxiety influences anxiety comorbidity and suicidal behavior in bipolar disorderTransl Psychiatry1029820203283943810.1038/s41398-020-00981-5 GamageNSenanayakeSKumbukageMMendisJJayasekaraAThe prevalence of anxiety and its association with the quality of life and illness severity among bipolar affective disorder patients in a developing countryAsian J Psychiatr5210204420203234428010.1016/j.ajp.2020.102044 BuckleyVYoungAHSmithPChild and adolescent anxiety as a risk factor for bipolar disorder: A systematic review of longitudinal studiesBipolar Disord2527828820233694961210.1111/bdi.13322 OakesDJPearceHARobertsCGehrmanPGLewisCJonesILewisKJSAssociations between comorbid anxiety and sleep disturbance in people with bipolar disorder: Findings from actigraphy and subjective sleep measuresJ Affect Disord30916517120223542770910.1016/j.jad.2022.04.065 ChoiJKangJKimTNehsCJSleep, mood disorders, and the ketogenic diet: Potential therapeutic targets for bipolar disorder and schizophreniaFront Psychiatry15135857820243841990310.3389/fpsyt.2024.1358578 UherRPavlovaBNajafiSAdepalliNRossBHowesVEFreemanKParkerRPropperLPalaniyappanLAntecedents of major depressive, bipolar, and psychotic disorders: A systematic review and meta-analysis of prospective studiesNeurosci Biobehav Rev16010562520243849412110.1016/j.neubiorev.2024.105625 GhasemiMPhillipsCTrilloLDe MiguelZDasDSalehiAThe role of NMDA receptors in the pathophysiology and treatment of mood disordersNeurosci Biobehav Rev4733635820142521875910.1016/j.neubiorev.2014.08.017 TangYPShimizuEDubeGRRamponCKerchnerGAZhuoMLiuGTsienJZGenetic enhancement of learning and memory in miceNature401636919991048570510.1038/43432 CarrierJSembaKDeurveilherSDrogosLCyr-CronierJLordCSekerovickZSex differences in age-related changes in the sleep-wake cycleFront Neuroendocrinol47668520172875711410.1016/j.yfrne.2017.07.004 NakamuraTJNakamuraWYamazakiSKudoTCutlerTColwellCSBlockGDAge-related decline in circadian outputJ Neurosci31102011020520112175299610.1523/JNEUROSCI.0451-11.2011 BielloSMBonsallDRAtkinsonLAMolyneuxPCHarringtonMELallGSAlterations in glutamatergic signaling contribute to the decline of circadian photoentrainment in aged miceNeurobiol Aging66758420182954775010.1016/j.neurobiolaging.2018.02.013 SteponenaiteABielloSMLallGSAging clocks: Disrupted circadian rhythmsAging (Albany NY)103065306620183042518510.18632/aging.101642 CevikOSCevikKTemelGOSahinLMaternal separation increased memory function and anxiety without effects of environmental enrichment in male ratsBehav Brain Res44111428020233658648810.1016/j.bbr.2022.114280 HealeyKWatersRCKnightSGWandlingGMHallNIJonesBNShobandeMJMeltonJGPandeySCSwartzwelderHSAdolescent intermittent ethanol exposure alters adult exploratory and affective behaviors, and cerebellar Grin2b expression in C57BL/6J miceDrug Alcohol Depend25311102620233800666810.1016/j.drugalcdep.2023.111026 Shirvani-FarsaniZMaloumZBagheri-HosseinabadiZVilor-TejedorNSadeghiIDNA methylation signature as a biomarker of major neuropsychiatric disordersJ Psychiatr Res141344920213417176110.1016/j.jpsychires.2021.06.013 Papanicolau-SengosAAldapeKDNA methylation profiling: An emerging paradigm for cancer diagnosisAnnu Rev Pathol1729532120223473634110.1146/annurev-pathol-042220-022304 FriesGRLiQMcAlpinBReinTWalss-BassCSoaresJCQuevedoJThe role of DNA methylation in the pathophysiology and treatment of bipolar disorderNeurosci Biobehav Rev6847448820162732878510.1016/j.neubiorev.2016.06.010 GoudACEtainBBellivierFMarie-ClaireCDNA methylation as a biomarker of treatment response variability in serious mental illnesses: A systematic review focused on bipolar disorder, schizophrenia, and major depressive disorderInt J Mol Sci19302620183028775410.3390/ijms19103026 BundoMUedaJNakachiYKasaiKKatoTIwamotoKDecreased DNA methylation at promoters and gene-specific neuronal hypermethylation in the prefrontal cortex of patients with bipolar disorderMol Psychiatry263407341820213387580010.1038/s41380-021-01079-0 CeylanDScolaGTuncaZIsaacs-TrepanierCCanGAndreazzaACYoungLTÖzerdemADNA redox modulations and global DNA methylation in bipolar disorder: Effects of sex, smoking and illness statePsychiatry Res26158959620182940772710.1016/j.psychres.2017.12.051 CarrardASalzmannAMalafosseAKaregeFIncreased DNA methylation status of the serotonin receptor 5HTR1A gene promoter in schizophrenia and bipolar disorderJ Affect Disord13245045320112145397610.1016/j.jad.2011.03.018 JeremianRChenYADe LucaVVincentJBKennedyJLZaiCCStraussJInvestigation of correlations between DNA methylation, suicidal behavior and agingBipolar Disord19324020172827665710.1111/bdi.12466 LimaCSuchtingRScainiGCuellarVAFavero-CampbellADWalss-BassCSoaresJCQuevedoJFriesGREpigenetic GrimAge acceleration and cognitive impairment in bipolar disorderEur Neuropsychopharmacol62102120223581061410.1016/j.euroneuro.2022.06.007 ShiXLiMYaoJLiMDYangZAlcohol drinking, DNA methylation and psychiatric disorders: A multi-omics Mendelian randomization study to investigate causal pathwaysAddiction1191226123720243852359510.1111/add.16465 PiercontiFRossiEDCenciTCarlinoAFiorentinoVTotaroASaccoEPalermoGIacovelliRLaroccaLMDNA methylation analysis in urinary samples: A useful method to predict the risk of neoplastic recurrence in patients with urothelial carcinoma of the bladder in the high-risk groupCancer Cytopathol13115816420233626208410.1002/cncy.22657 WeiWFanPZhangZWuDLiuJWangLDuanXZhangXDingDA urine-based liquid biopsy for detection of upper tract urothelial carcinoma: A self-matched studyBMC Cancer24118020243933397310.1186/s12885-024-12913-3 ZhuJHBoHHLiuBPJiaCXThe associations between DNA methylation and depression: A systematic review and meta-analysisJ Affect Disord32743945020233671703310.1016/j.jad.2023.01.079 SrivastavaADadaOQianJAl-ChalabiNFatemiABGerretsenPGraffADe LucaVEpigenetics of schizophreniaPsychiatry Res30511421820213463805110.1016/j.psychres.2021.114218 GaynorSCBreenMEMonsonETde KlerkKParsonsMDeLucaAPScheetzTEZandiPPPotashJBWillourVLA targeted sequencing study of glutamatergic candidate genes in suicide attempters with bipolar disorderAm J Med Genet B Neuropsychiatr Genet1711080108720162748050610.1002/ajmg.b.32479 DalvieSHornNNossekCvan der MerweLSteinDJRamesarRPsychosis and relapse in bipolar disorder are related to GRM3, DAOA, and GRIN2B genotypeAfr J Psychiatry (Johannesbg)1329730120102095733010.4314/ajpsy.v13i4.61880 ZhangWTianFZhengJLiSQiangMChronic administration of Benzo(a)pyrene induces memory impairment and anxiety-like behavior and increases of NR2B DNA methylationPLoS One11e014957420162690115510.1371/journal.pone.0149574 LiYXiaoXWangLWangQLiangRZhengCYangJMingDComparison effects of chronic sleep deprivation on juvenile and young adult miceJ Sleep Res31e1339920223413710710.1111/jsr.13399 HorvathSDNA methylation age of human tissues and cell typesGenome Biol14R11520132413892810.1186/gb-2013-14-10-r115 JohanssonAEnrothSGyllenstenUContinuous aging of the human DNA methylome throughout the human lifespanPLoS One8e6737820132382628210.1371/journal.pone.0067378 HannumGGuinneyJZhaoLZhangLHughesGSaddaSKlotzleBBibikovaMFanJBGaoYGenome-wide methylation profiles reveal quantitative views of human aging ratesMol Cell4935936720132317774010.1016/j.molcel.2012.10.016 FirstMSpitzeRGibbonMWilliamsJStructured clinical interview for DSM-IV-TR axis I disorders, research version, patient edition. (SCID-I/P). New York: Biometrics Research, New York State Psychiatric Institute, 2002. HAMILTONMA rating scale for depressionJ Neurol Neurosurg Psychiatry23566219601439927210.1136/jnnp.23.1.56 YoungRCBiggsJTZieglerVEMeyerDAA rating scale for mania: Reliability, validity and sensitivityBrit J Psychiatry133429435197872869210.1192/bjp.133.5.429 APA. Diagnostic and Statistical Manual of Mental Disorders, Text Revision (DSM-IV-TR), 4th Edn. Washington, DC: American psychiatric association; 1994. HAMILTONMThe assessment of anxiety states by ratingBr J Med Psychol32505519591363850810.1111/j.2044-8341.1959.tb00467.x BuysseDJReynoldsCR IIIMonkTHBermanSRKupferDJThe pittsburgh sleep quality index: A new instrument for psychiatric practice and researchPsychiatry Res281932131989274877110.1016/0165-1781(89)90047-4 AvramopoulosDLasseterVKFallinMDWolyniecPSMcGrathJANestadtGValleDPulverAEStage II follow-up on a linkage scan for bipolar disorder in the Ashkenazim provides suggestive evidence for chromosome 12p and the GRIN2B geneGenet Med974575120071800714310.1097/gim.0b013e318159a37c ZhaoQCheRZhangZWangPLiJLiYHuangKTangWFengGLindpaintnerKPositive association between GRIN2B gene and bipolar disorder in the Chinese Han PopulationPsychiatry Res18529029220112053772010.1016/j.psychres.2009.11.026 LiCTianHLiRJiaFWangLMaXYangLZhangQZhangYYaoKZhuoCMolecular mechanisms of quetiapine bidirectional regulation of bipolar depression and mania based on network pharmacology and molecular docking: Evidence from computational biologyJ Affect Disord35552853920243851885710.1016/j.jad.2024.03.096 WeissFCarusoVDe RosaUBeatinoMFBarbutiMNicolettiFPerugiGThe role of NMDA receptors in bipolar disorder: A systematic reviewBipolar Disord2562463620233720896610.1111/bdi.13335 BeneytoMMeador-WoodruffJHLamina-specific abnormalities of NMDA receptor-associated postsynaptic protein transcripts in the prefrontal cortex in schizophrenia and bipolar disorderNeuropsychopharmacology332175218620081803323810.1038/sj.npp.1301604 RiazaBCPerez-RodriguezMMVaquero-LorenzoCBaca-GarciaENew perspectives in glutamate and anxietyPharmacol Biochem Behav10075277420122156978910.1016/j.pbb.2011.04.010 BannermanDMSprengelRSandersonDJMcHughSBRawlinsJNMonyerHSeeburgPHHippocampal synaptic plasticity, spatial memory and anxietyNat Rev Neurosci1518119220142455278610.1038/nrn3677 GuoHHuWCXianHShiYXLiuYYMaSBPanKQWuSXXuLYLuoCXieRGCCL2 potentiates inflammation pain and related anxiety-like behavior through NMDA signaling in anterior cingulate cortexMol Neurobiol614976499120243815711910.1007/s12035-023-03881-z RenDLiJNQiuXTWanFPWuZYFanBYZhangMMChenTLiHBaiYLiYQAnterior cingulate cortex mediates hyperalgesia and anxiety induced by chronic pancreatitis in ratsNeurosci Bull3834235820223490749610.1007/s12264-021-00800-x YanZJiaoFYanXOuHMaternal chronic folate supplementation ameliorates behavior disorders induced by prenatal high-fat diet through methylation alteration of BDNF and Grin2b in offspring hippocampus. Mol Nutr Food Res 61: doi.org/10.1002/mnfr.201700461, 2017. BarkusCMcHughSBSprengelRSeeburgPHRawlinsJNBannermanDMHippocampal NMDA receptors and anxiety: At the interface between cognition and emotionEur J Pharmacol626495620101983637910.1016/j.ejphar.2009.10.014 TullyJLDahlenADHaggartyCJSchiothHBBrooksSKetamine treatment for refractory anxiety: A systematic reviewBr J Clin Pharmacol884412442620223551034610.1111/bcp.15374 ArinoHMunoz-LopetegiAMartinez-HernandezEArmangueTRosa-JusticiaMEscuderoDMatosNGrausFSugranyesGCastro-FornielesJSleep disorders in anti-NMDAR encephalitisNeurology95e671e68420203257663510.1212/WNL.0000000000009987 BurgdorfJSVitaternaMHOlkerCJSongEJChristianEPSorensenLTurekFWMadsenTMKhanMAKroesRAMoskalJRNMDAR activation regulates the daily rhythms of sleep and moodSleep42zsz13520193150497110.1093/sleep/zsz135 MiraccaGAnuncibay-SotoBTossellKYustosRVyssotskiALFranksNPWisdenWNMDA receptors in the lateral preoptic hypothalamus are essential for sustaining NREM and REM sleepJ Neurosci425389540920223564972610.1523/JNEUROSCI.0350-21.2022 KocsisBState-dependent increase of cortical gamma activity during REM sleep after selective blockade of NR2B subunit containing NMDA receptorsSleep351011101620122275404810.5665/sleep.1972

(A) CpG islands predicted by EMBOSS. CpG island locations: Island 1 (1,157-1,475, 319 bp); Island 2 (1,670-1,908, 239 bp); Core criteria: Obs/Exp, >0.6; GC%, >50; length, >200 bp. (B) The target GRIN2B sequences: The black boxes highlight the contiguous CpG sites analyzed, with the reported values representing the average methylation level across these sites. Undetectable CpG sites are indicated in gray, while the 12 successfully interrogated CpG sites are marked in yellow. Obs, observed; Exp, expected.

Target gene fragments. (A) Candidate Programs for Targeted Regions at a Glance. (B) Program 14 information: The sequences shown in the figure are forward sequences. Dots indicate CpG sites, with blue-marked CpG sites representing those that can be detected. Red-labeled CpG sites, however, cannot be detected due to issues with the sequence.

Comparative analysis of GRIN2B methylation profiles in BD and HC cohorts. Boxplots display the median (central line), mean (black square), interquartile range (boxes), theoretical normal distribution (black dashed curve), individual measurements (pink dots) and error bars represent the standard deviation. Significance gradient (group comparisons by independent samples t-test): *P<0.05, **P<0.01, ***P<0.001 (two-tailed). BD, bipolar disorder; HC, healthy controls.

Primer information.

Primer 5' end primer sequence 3' end primer sequence
Start, bp 1,259 1,755
Size, bp 28 27
Tm, ˚C 58.14 57.06
GC% 25 22
Cs 4 5
Original sequence CTGATTTATGGAAAATACAGCAAGGGTC TCTGGATTTGGGTCTCACACTCAAAAA
Methylation sequence TTGATTTATGGAAAATATAGTAAGGGTT TCTAAATTTAAATCTCACACTCAAAAA
Insert sequence aggaagagag cagtaatacgactcactatagggagaaggct

Product size, 497; no. of CpGs, 30; coverage, 18. Tm, melting temperature.

Demographic and clinical information of BD and HC groups.

Item BD (n=31) HC (n=32) χ2/t/Z P-value
Age, years 23.0 (20.0-39.0) 26.5 (22.0-37.5) -1.343 0.179
Education, years 16.0 (15.0-16.0) 16.0 (16.0-16.0) -0.748 0.455
Sex, male/female (8,23) (11,21) 0.207 0.649
Smoking, yes/no (6,25) (8,24) 0.290 0.590
Drinking, yes/no (6,25) (7,25) 0.061 0.805
Age of onset, years 20 (16.58-31.00) - - -
Disease duration, years 4 (1.42-8.00) - - -
HAMD-24 32 (23-36) - - -
YMRS 2 (2-3) - - -
HAMA-14 19 (15-29) - - -
PSQI 14.32±4.05 - - -
Subtype (BDI/BDII) (13,18) - - -
Depression severity (moderate/severe) (18,13) - - -

Age, education, age of onset, disease duration, HAMD-24, YMRS, HAMA-14 and PSQI are expressed as the median (interquartile range). HAMD-24 (total score range: 0-76 to distinguish clinical severity thresholds from the HAMD-17) severity criteria: 20-34, moderate (n=18); ≥35, severe (n=13). BD, bipolar disorder; HC, healthy controls; HAMD, Hamilton Depression Rating Scale; YMRS, Young Mania Rating Scale; HAMA, Hamilton anxiety scale; PSQI, Pittsburgh Sleep Quality Index scale.

Binary logistic regression analysis of the effect of GRIN2B DNA methylation on bipolar disorder.

CpG methylation site B SE Wald P-value OR 95%CI
CpG3 0.076 0.024 9.759 0.002 1.079 1.029-1.132
CpG5 0.082 0.034 5.798 0.016 1.085 1.015-1.160
CpG10 0.107 0.034 10.058 0.002 1.113 1.042-1.190
CpG12 0.045 0.022 4.153 0.042 1.046 1.002-1.093

SE, standard error; OR, odds ratio.

Correlation analysis of GRIN2B DNA methylation with anxiety and insomnia in bipolar disorder.

  HAMA score PSQI score
Methylation % at CpG site r P-value r P-value
CpG1 -0.178 0.383 -0.172 0.402
CpG2 0.098 0.635 -0.033 0.874
CpG3 -0.036 0.862 -0.061 0.767
CpG4 0.107 0.602 0.194 0.342
CpG5 -0.043 0.833 -0.286 0.157
CpG6 0.169 0.408 -0.029 0.887
CpG7 -0.240 0.237 -0.198 0.332
CpG8 0.159 0.439 0.419 0.033
CpG9 0.408 0.038 0.312 0.121
CpG10 0.144 0.484 0.251 0.215
CpG11 -0.081 0.696 0.057 0.783
CpG12 -0.313 0.119 -0.021 0.921

Control variables: Age, gender, education level and HAMD. HAMD, Hamilton Depression Rating Scale; HAMA, Hamilton Anxiety Scale; PSQI, Pittsburgh Sleep Quality Index Scale.