The present study was approved by the Ethical Committee of the Affiliated Hospital of Qingdao University, Qingdao, China (approval no. QYFY WZLL28477). The present study included 103 patients (68 males, 35 females; aged 27–73 years) diagnosed with CRSwNP who underwent surgical treatment at the Department of Otolaryngology-Head and Neck Surgery, Affiliated Hospital of Qingdao University, Qingdao, China between January 2019 and June 2020. For the control group, the middle turbinate mucosal tissue was collected during procedures such as septoplasty, middle turbinate reduction, optic nerve decompression, orbital wall fracture repair or cerebrospinal fluid leak repair. The inclusion criteria required patients to meet the EPOS2020 guidelines (3) and have postoperative histopathological confirmation of NP tissue. Patients with the following conditions were excluded: Use of antibiotics or oral corticosteroids within 3 months prior to surgery and coexisting parasitic infection, cystic fibrosis, aspirin-exacerbated respiratory disease, hematological disorder or psychiatric conditions. All patients were followed up for a duration of 26–41 months to assess clinical outcomes and disease progression. Follow-up included in-person hospital visits once monthly for the first 3 months, every 2 months from months 3 to 9, every 3 months from months 9 to 12 and annually thereafter via telephone or in-person visits when disease progression was suspected.

All patients were examined by paranasal sinus computed tomography (PNCT) using Discovery CT750 HD (GE Healthcare), endoscopic nasal examination and symptoms such as nasal obstruction, purulent nasal discharge, headache and olfactory dysfunction by physical examination. For endoscopic nasal examination, Lund-Kennedy was used as the endoscopic scoring system (19). For PNCT examination, the Lund-Mackay scoring system was applied (20,21). To quantify the symptoms of patients, the visual analogue scale (VAS) was applied (22).

Control and CRSwNP samples were removed during endoscopic sinus surgery and fixed in 10% formalin at room temperature for 24 h for embedding, sectioned at 5 µm and stained with hematoxylin (10 min) and eosin (3 min) at room temperature. An additional segment from each sample was stored at −80°C for reverse transcription-quantitative (RT-q)PCR and western blotting analyses.

Antibodies against IL-1β (ab283818) were purchased from Abcam. Antibodies against GAPDH (60004-1-1g), NLRP3 (19771-1-AP) and GSDMD (20770-1-AP) were purchased from Proteintech Group, Inc. Antibodies against Caspase-1 (cat. no. 2225T) and cleaved Caspase-1 (4199T) were purchased from Cell Signaling Technology, Inc. The secondary antibodies Donkey anti-Rabbit IgG (H+L) Cross-Adsorbed Secondary Antibody, DyLight™ 488 (SA5-10038), Donkey anti-Mouse IgG (H+L) Cross-Adsorbed Secondary Antibody, DyLight™ 650 (SA5-10169) and DAPI (D1306) were purchased from Invitrogen. The secondary antibodies Goat Anti-Rabbit IgG(H+L) (peroxidase/HRP conjugated) (E-AB-1003) and Goat Anti-Mouse IgG(H+L)(peroxidase/HRP conjugated) (E-AB-1001) were purchased from Elabscience. Recombinant human IL-5 protein (90106ES10) was purchased from Shanghai Yeasen Biotechnology Co., Ltd. Recombinant human IL-17A (200-17) protein was purchased from PeproTech, Inc. ECL substrate kit (MA0186-2) was purchased from Dalian Meilun Biology Technology Co., Ltd.

Primary human nasal epithelial cells (HNEpCs) were derived as previously described (23). In brief, nasal tissue samples were cut into small pieces, washed with PBS, centrifuged at 300 g at room temperature for 5 mins, incubated with dispase II (2.4 U/ml, Stem Cell Technology) overnight at 4°C, centrifuged, incubated with trypsin (Invitrogen; Thermo Fisher Scientific, Inc.) at 37°C for 15 min, and passed through a 100-µm filter. To recapitulate airway epithelial architecture, HNEpCs were seeded in the upper chamber of Transwell inserts (Corning) pre-coated with collagen I (Sigma). The upper chamber contained DMEM supplemented with 10% fetal bovine serum (FBS; Invitrogen), while the lower chamber was filled with a 1:1 mixture of bronchial epithelial growth medium and DMEM/F12 (Sigma). Cells were allowed to differentiate under this air-liquid interface conditions.

Basal RPMI-2650 cells were obtained from the Cell Bank of the Chinese Academy of Sciences, and maintained in RPMI-1640, 10% FBS (both Gibco; Thermo Fisher Scientific, Inc.) and penicillin-streptomycin at 37°C and 5% CO₂. Cells were passaged every 3–4 days by adding 2.5% trypsin (Gibco; Thermo Fisher Scientific, Inc.) for 3–5 min at 37°C and re-plating at a 1:4 ratio.

For stimulation assays, confluent HNEpCs or RPMI-2650 cells were treated with either human serum collected preoperatively from whole blood (5 ml) obtained from patients clinically diagnosed with ECRSwNP or non-ECRSwNP, or IL-5, 100 ng/ml; PeproTech) or interleukin-17A (IL-17A, 100 ng/mL; PeproTech) for 72 h at 37°C. Control cells were exposed to the same cytokine concentrations for 72 h or co-treated with dimethyl fumarate (DMF, 50 µM; Sigma).

For immunohistochemistry (IHC), paraffin-embedded sections (5-µm thick) were deparaffinized in fresh xylene for 10 min, rehydrated through a graded ethanol series (100%, 95% and 70% ethanol), washed with water, blocked with 5% BSA (Yeasen) in PBS at room temperature for 1 h, incubated with primary antibodies (all 1:500) against NLRP3, IL-1β, cleaved Caspase 1, cleaved GSDMD, IL-5 and IL-17A overnight at 4°C, followed by a 60 min incubation with goat anti-rabbit IgG(H+L) secondary antibody (1:1,000). The sections were stained with 3,3′diaminobenzidine tetrahydrochloride for 5 mins and counterstained with hematoxylin for 2 mins at room temperature. Images of the immunostained samples were captured using a light microscope.

For the IF experiment, NP sections or fixed nasal epithelial cells treated with serum from human patients were blocked with 5% BSA (Yeasen) in PBS at room temperature for 1 h, treated with primary antibodies against Cleaved GSDMD or Cleaved Caspase-1 overnight at 4°C, followed by a 60 min incubation with secondary antibodies conjugated to fluorescein. The nuclei were counterstained with DAPI for 5 min at room temperature. High-resolution images were obtained using a Nikon ECLIPSE Ti confocal microscope (Nikon Corporation).

Total protein from tissue or cell samples was extracted using RIPA (Yeasen) buffer. The protein concentrations were assessed using a BCA Protein Assay kit (Beyotime Institute of Biotechnology). A total of 40 µg of total protein were loaded onto SDS-PAGE gels (4–20%) for separation and transferred to a PVDF membrane. After blocking in 5% skimmed milk for 1 h at room temperature, dissolved in Tris-buffered saline with 0.1% Tween-20 (TBST), the PVDF membrane was incubated with the primary antibodies overnight at 4C° as follows: GAPDH (1:4,000), IL-1β (1:5,000), NLRP3 (1:1,000), GSDMD (1:2,000), Caspase-1 (1:1,000) and cleaved Caspase-1 (1:2,000). After washing the PVDF membranes three times with TBST for 5 min each, they were incubated with secondary antibodies (1:5,000) at room temperature for 60 min. Signal detection was performed using the ChemiDoc XRS+ Imaging System (Bio-Rad Laboratories, Inc). Band density was quantified using Image Lab Software 6.0 (Bio-Rad Laboratories, Inc.). All expression values were normalized to GAPDH.

Total RNA was extracted from RPMI-2650 cells (1×10⁶) using Total RNA Extraction Reagent (Vazyme Biotech Co., Ltd.). A total of 1 µg total RNA was reverse-transcribed with HiScript III RT SuperMix for qPCR according to the manufacturer's protocol (Vazyme Biotech Co., Ltd.). qPCR was conducted using the Taq Pro Universal SYBR qPCR Master Mix according to the manufacturer's protocol (Vazyme Biotech Co., Ltd.). The thermocycling conditions were as follows: initial denaturation at 95°C for 3 min, followed by 40 cycles of denaturation at 95°C for 15 sec and annealing/extension at 60°C for 30 sec. Melt curve analysis was performed at the end of amplification by increasing the temperature from 65°C to 95°C in 0.5°C increments every 5 sec to confirm the specificity of the amplification products. Standard curves were generated for each primer set and were used to calculate Cq values with the expression threshold set to 100 RFU (24). Expression values were normalized to GAPDH. The forward and reverse primer sequences (5′→3′) were as follows: GAPDH (GGCTGAGAACGGGAAGCTTGTCAT; CAGCCTTCTCCATGGTGGTGAAGA); dynein axonemal Intermediate Chain 2 (DNAI2) (CGATCAGCATGTCGGAACAC; CGAGCTGCATGATGGCGTTA); Chloride Channel Accessory 1 (CLCA1) (ACAACAATGGCTATGAAGGCA; GGTCTCAAGTTTTGGTCTCACAT); Mucin 5AC (MUC5AC) (ACCAATGCTCTGTATCCTTCCC; TGGTGGACGGACAGTCAC T) and Forkhead Box J1 (FOXJ1) (TCTGAGCCAGGCACCACATA; CCATGTCTGCGGGGACTCT).

The quality and integrity of total RNA samples were analyzed using the Agilent 2100 Bioanalyzer (Agilent Technologies) according to the manufacturer's instructions, and libraries were prepared utilizing the VAHTS^® Universal V8 RNA-Seq Library Prep kit (NRM605-02) for MGI and VAHTS^® RNA Adapters Set 8 for MGI (NM208-01) (both Vazyme Biotech Co., Ltd.), according to the manufacturer's instructions. Final libraries were quantified using the Qubit 4.0 Fluorometer (Thermo Fisher Scientific) and their size distribution was confirmed via the Agilent 2100 Bioanalyzer. The libraries were diluted to a final loading concentration of 1.5 nM. Sequencing was performed as paired-end 150 bp reads, with strand-specific sequencing using the MGI-SEQ 2000 platform at BGI Group. The demultiplexed reads were mapped to the GRCh38 version of the human genome using HISAT2 (25). To quantify transcripts and analyze differential expression, the demultiplexed reads were processed with feature Counts using R package (version 4.4.1) (26). Differential expression was evaluated using DESeq2 (27). Additionally, Gene Ontology (28) and Kyoto Encyclopedia of Genes and Genomes (KEGG) (29) pathway enrichment analyses were conducted using Database for Annotation, Visualization and Integrated Discovery (DAVID; david.ncifcrf.gov/).

Statistical analyses were performed using SPSS 19.0 (IBM Corp.) and GraphPad Prism 5.0 (Dotmatics). Comparisons between three groups were conducted using one-way analysis of variance with Tukey's HSD (Honest Significant Difference) Test. Fisher's Exact Test was used to assess associations between two categorical variables and the data were represented as frequency and percentages. Independent samples t-test was used to assess the continuous variables. All assays were repeated at least three times to ensure reproducibility. Data are presented as the mean ± standard deviation. A power analysis was carried out using R-package (pwr) to validate the sample size, with the α level set at 0.01. For datasets with n≤50, the Shapiro-Wilk test was used to assess the normality of data distribution. P<0.05 was considered to indicate a statistically significant difference.

To mitigate the influence of potential confounding variables, the demographic and clinical data between patients with ECRSwNP or nECRSwNP groups were compared. The present study involved 103 patients diagnosed with CRSwNP, of whom 58 met the inclusion criteria. Of these, 27 were excluded based on the aforementioned criteria. Among the included 31 patients, 15 were classified as nECRSwNP and 16 as ECRSwNP. To enhance the robustness of the findings, a control group comprising 13 individuals without CRSwNP was included. These controls were matched to the patient cohort for age and sex, and screened to exclude any nasal pathology or systemic inflammatory conditions. There were no significant disparities in key parameters such as age, sex distribution, prevalence of asthma, allergic rhinitis, history of NP surgery, smoking status or allergy to food or drugs between the ECRSwNP and nECRSwNP groups, with marked difference for Total VAS scores, Endoscopy scores, and CT scores (Table I), indicating heterogeneous clinical features.

Shapiro-Wilk test was conducted to assess normality. Age, total VAS, and CT scores in ECRSwNP and nECRSwNP groups, as well as endoscopy scores in the nECRSwNP group were normally distributed. While endoscopy scores in the ECRSwNP group showed slight deviation, absolute skewness (<3) and kurtosis (<10) values indicated acceptable approximation to normality, justifying the use of parametric tests (Table II). The total VAS was 15.88±3.05 for patients with ECRSwNP and 11.47±2.92 for patients with nECRSwNP. However, notable distinctions were observed in the endoscopy and CT scores between the ECRSwNP and nECRSwNP cohorts. The mean endoscopy score was 10.81±1.22 for patients with ECRSwNP and 6.60±1.92 for patients with nECRSwNP, while the mean CT score was 20.13±3.20 for ECRSwNP and 11.93±5.40 for nECRSwNP. These discrepancies in endoscopy and CT score reflect variations in disease severity between the two CRSwNP phenotypes as the power analysis demonstrated statistical power values of 0.9019, 0.9999 and 0.9891 for total VAS, endoscopy and CT scores, respectively.

To assess pyroptosis in patients with nECRSwNP and ECRSwNP, the expression of NLRP3 and IL-1β was analyzed. H&E staining was used to evaluate morphological changes and the infiltration of inflammatory cells in NP samples from patients with CRSwNP (Fig. 1A). Consistent with clinical observations, the control group showed no notable infiltration of inflammatory cells. By contrast, the ECRSwNP group exhibited a substantial infiltration of eosinophils. Conversely, the nECRSwNP group displayed few eosinophils and basement membrane thickening and infiltration of inflammatory cells, including neutrophils, plasma cells and lymphocytes. Immunohistochemical staining demonstrated a significant increase in the number of NLRP3- and IL-1β-positive cells in both nECRSwNP and ECRSwNP groups compared with the control (Fig. 1B-D). To validate these findings, cleaved GSDMD and Caspase-1 expression was assessed using IF staining. Consistently, >80% of the cells were positive for both cleaved GSDMD and Caspase-1, indicating the activation of the pyroptosis signaling pathway. The intensity of cleaved GSDMD and cleaved caspase-1 signals was stronger in the nECRSwNP group compared with the ECRSwNP group (Fig. 2). These results suggest an association between pyroptosis and the development of CRSwNP, particularly in patients with nECRSwNP.

To assess the potential of serum from patients with CRSwNP to induce pyroptosis in basal cells, RPMI-2650 cells were treated with diluted serum from patients with either nECRSwNP or CRSwNP for 72 h. Immunocytochemistry revealed a notable increase in the expression of cleaved GSDMD in both groups compared with the control group, with a pronounced increase observed in the nECRSwNP group (Fig. 3A). The expression of total GSDMD, Caspase-1, cleaved GSDMD, cleaved Caspase-1 and NLRP3 was further investigated by western blotting. Consistent with the immunocytochemistry results, cleaved GSDMD and Caspase-1 and NLRP3 showed a notable increase in expression in cells treated with serum from patients with nECRSwNP and ECRSwNP compared with the control group, despite no substantial changes in the total protein levels of GSDMD and Caspase-1. The levels of these proteins were significantly higher in the nECRSwNP compared with the ECRSwNP group (Fig. 3B and C). These findings implicated that components present in the serum from patients with CRSwNP may induce pyroptosis, with a more pronounced effect in nECRSwNP, contributing to the manifestation of CRSwNP.

Previous studies indicate that IL-5 and IL-17A are the dominant immune cytokines in the peripheral venous serum of patients with ECRSwN (30) and nECRSwNP (31), respectively. To investigate whether these trigger pyroptosis in CRSwNP, their expression in nECRSwNP and ECRSwNP samples was investigated. IHC revealed increased expression of IL-5 in patients with ECRSwNP and IL-17A in patients with nECRSwNP (Fig. 4A). RPMI-2650 cells were treated with IL-5 or IL-17A for 24 h to assess the activation of pyroptosis. No differences were observed in cell morphology and number between groups (Fig. 4B). However, western blot analysis revealed the induction of cleaved GSDMD and cleaved Caspase-1 stimulated by IL-5 and IL-17A compared with the control group, despite no substantial changes for total GSDMD and Caspase-1. Conversely, the addition of pyroptosis inhibitor DMF) resulted in significantly reduced levels of cleaved GSDMD and cleaved Caspase-1 compared with the IL5- or IL17-alone groups (Fig. 4C).

To gain molecular insight into the effects of IL-5 and IL-17A on RPMI-2650 cells, RNA-seq analysis was performed on control cells and cells stimulated with either IL-5 or IL-17 to analyze associated genes and signaling pathways involved. Relative to the control cells, 105 genes were up- and 12 genes were downregulated in the IL-5 group, while 245 genes were up- and 484 genes were downregulated in the IL-17A group. Among these genes, 12 were up- and one was downregulated in the IL-5 vs. IL-17A overlap. KEGG analysis revealed that inflammatory signaling pathways such as ‘cytokine-cytokine receptor interaction’, ‘NOD-like receptor signaling pathway’, ‘TNF signaling’, ‘NF-κβ signaling pathway’, ‘toll-like receptor signaling pathway’ and ‘IL-17 signaling pathway’ were associated with IL-5 stimulation. Conversely, ‘coronavirus disease-COVlD-19’ and ‘ribosome’ were ranked as top in the IL-17A-stimulated group (Fig. 4D and E).

To understand the role of pyroptosis in the development of CRSwNP, its impact on basal cell differentiation capacity was examined. RT-qPCR revealed that the expression of CLCA1, the key marker of goblet cells, was upregulated in RPMI-2650 cells treated with either IL-5 or IL-17A, indicating a shift towards goblet cell differentiation. Conversely, the expression of DNAI2, the key regulator of ciliated cells, was downregulated, suggesting a decrease in ciliated cell differentiation (Fig. 5A). DMF, a pyroptosis inhibitor, rescued this differentiation imbalance, implicating the activation of pyroptosis as a key trigger of the differentiation imbalance in basal cells (Fig. 5A and B). These results were validated in HNEpCs, demonstrating that pyroptosis inhibition partially rescued the differentiation imbalance, particularly in IL-17A-treated cells (Fig. 4C).

RNA-seq analysis revealed a significant reversal of gene expression patterns after DMF administration, particularly in the IL-17A-treated group. Gene Ontology function analysis of differentially expressed genes in the IL-5-treated group revealed enrichment in ‘angiogenesis’, ‘cell adhesion’, ‘regulation of nitric oxide-mediated signal transduction’, ‘neutrophil chemotaxis’ and ‘extracellular space’, as well as ‘hydrogen sulfide biosynthetic process’, ‘heparin binding’ and ‘carbon monoxide binding’. By contrast, in the IL-17A-treated group, targeting pyroptosis by DMF resulted in enrichment of ‘cell adhesion’, ‘positive regulation of canonical Wnt signaling pathway’, ‘mitochondrion’, ‘cytoskeleton’ and ‘plasma membrane protein complex’, as well as ‘nervous system development’, ‘sphingolipid biosynthetic process’ and ‘iron-sulfur cluster assembly complex’ (Fig. 5C and D). These findings suggest that pyroptosis may contribute to the impairment of basal cell differentiation in the nasal epithelium of patients with CRSwNP.