Molecular Medicine Reports Molecular Medicine Reports 1791-2997 1791-3004 D.A. Spandidos 10.3892/mmr.2025.13602 MMR-32-3-13602 Articles DDX3X/MAVS alleviates doxorubicin-induced cardiotoxicity by regulating stress granules ZhaoKaixiang 1 WangShaochen 1 FengDandan 2 WangDongwei 1 YangGuang 1 LangFangfang 3 Department of Cardiology, The First Affiliated Hospital of Shandong First Medical University (Shandong Provincial Qianfoshan Hospital), Jinan, Shandong 250014, P.R China Department of Cardiology, Shandong First Medical University, Jinan, Shandong 250017, P.R. China Department of Obstetrics and Gynecology, Maternal and Child Health Hospital of Shandong Province, Jinan, Shandong 250013, P.R. China Correspondence to: Professor Guang Yang, Department of Cardiology, The First Affiliated Hospital of Shandong First Medical University (Shandong Provincial Qianfoshan Hospital), 16766 Jingshi Road, Jinan, Shandong 250014, P.R. China, E-mail: yangg1972@126.com Professor Fangfang Lang, Department of Obstetrics and Gynecology, Maternal and Child Health Hospital of Shandong Province, 238 Jingshi East Road, Jinan, Shandong 250013, P.R. China, E-mail: langff77@163.com 092025 24062025 32 3 237 24012025 16052025 Copyright: © 2025 Zhao et al. 2025 This is an open access article distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivs License, which permits use and distribution in any medium, provided the original work is properly cited, the use is non-commercial and no modifications or adaptations are made.

The specific mechanisms of doxorubicin (Dox)-induced cardiotoxicity (DIC) remain unclear. In the present study, H9c2 cardiomyocytes were treated with Dox, and it was revealed that DEAD-box RNA helicase 3 X-linked (DDX3X), mitochondrial antiviral signaling (MAVS) and stress granules (SGs) were present at lower levels in the treated H9c2 cardiomyocytes compared with those in the control cells. The present study further investigated the mechanisms through which DIC occurs. Pretreatment with arsenite, which pharmacologically accelerates SGs, alleviated the myocardial injury caused by Dox. By contrast, anisomycin, an SG inhibitor, increased cardiomyocyte apoptosis induced by Dox. In addition, both DDX3X knockdown and pretreatment with RK-33 (a DDX3X pharmacological inhibitor) decreased SG expression, whereas DDX3X overexpression promoted SG generation. These results indicated that DDX3X mitigated DIC through the regulation of SGs. In addition, MAVS knockdown inhibited SG assembly and reduced the expression of the anti-apoptotic inhibitor Bcl2, and MAVS was influenced by DDX3X, thereby serving as a connector between DDX3X and SGs. The results from western blotting, reverse transcription-quantitative PCR, immunofluorescence and flow cytometry analysis demonstrated that DDX3X, MAVS, and SGs may serve as key protective factors in DIC.

 DEAD-box RNA helicase 3 X-linked stress granules mitochondrial antiviral signaling doxorubicin-induced cardiotoxicity apoptosis Shandong Provincial Maternal and Child Health Hospital Talent Fund and the Qingdao Science and Technology Benefaction & Demonstration Special Project 22-3-7-smjk-8-nsh The present study was supported by the Shandong Provincial Maternal and Child Health Hospital Talent Fund and the Qingdao Science and Technology Benefaction & Demonstration Special Project (grant no. 22-3-7-smjk-8-nsh). Introduction

Anthracycline drugs such as doxorubicin (Dox) interfere with DNA synthesis by embedding itself into the double-stranded DNA and inhibiting topoisomerase II, thus exerting antitumor effects (1–4). Dox is important in clinical practice due to its precision and efficacy in treating solid tumors and hematological malignancies. However, Dox has multiple side effects, such as myelosuppression, neurological disturbances, hair loss and cardiotoxicity, which is the most serious effect (5–8). Dox-induced cardiotoxicity (DIC) is dose-dependent, and the incidence of congestive heart failure is proportional to the dose of Dox (9). Left ventricular ejection fraction continues to decline as a characteristic of DIC; however, patients may have no symptoms in the early stages. Clinical manifestations can occur years later and are difficult to treat (10,11). Dox has a high affinity for cardiolipin in the inner mitochondrial membrane, and the mitochondrial density of the heart is higher than that of the majority of other tissues, making the heart the main target of Dox (12–14). Dox is a potent oxidant that produces reactive oxygen species (ROS) through the NADH dehydrogenase in the mitochondria, damaging normal mitochondrial function (15,16). Glutathione peroxidase 1 (GPx1) antagonizes ROS, and the P/O ratio of mitochondria in GPx1-deficient mice is decreased compared with that of controls; the hearts of such mice are more susceptible to Dox-induced damage (17–19). The specific mechanism of DIC remains unclear although various theories, such as those involving oxidative stress, calcium overload and iron metabolism disorder, have been proposed. The present study considered DEAD-box RNA helicase 3 X-linked (DDX3X), mitochondrial antiviral signaling (MAVS) and stress granules (SGs) to further explore the molecular mechanisms of DIC.

DDX3X is a member of the DEAD-box helicase family in superfamily 2. The two RecA-like domains in the helicase core contain 12 characteristic conserved motifs, which form RNA substrate channels that bind to ligands such as ATP (20,21). DDX3X has become a research hotspot for a variety of diseases, such as nervous system diseases, viral infection and inflammatory disorders, because DDX3X is involved in a variety of RNA metabolic processes, such as pre-mRNA splicing, ribosome biogenesis, mRNA translation initiation and RNA decay (22–27). DDX3X enables nucleocytoplasmic shuttling via interacting with chromosomal maintenance 1 and nuclear RNA export factor 1, which are associated with the development of tumors (28,29). In addition, DDX3X promotes the spread of cancer cells by enhancing RAC1 signaling and SG assembly, and upregulating other pathways (30,31). The phosphorylation and ubiquitination of DDX3X serve important roles in the antiviral process, such as DDX3X phosphorylation under the action of IKKε or TANK-binding kinase 1. NLR family pyrin domain containing (NLRP)11 can weaken the IKKε-mediated phosphorylation of DDX3X, resulting in reductions in type I interferon induction after viral infection (32–34). DDX3X induces pyroptosis by promoting NLRP3 activation, whereas the assembly of SGs leads to DDX3X isolation, thereby inhibiting NLRP3 activation (35).

MAVS has a key role in host resistance to viral infections. MAVS is localized to the mitochondrial outer membrane via the C-terminal transmembrane domain and is directly associated with the C-terminus of DDX3X via the N-terminal caspase recruitment domain. MAVS thus enhances the activation of RIG-I-like receptor (RLR) antiviral signaling (36). MAVS carries out an antiviral role by activating protein kinase R (PKR), which recruits PKR to dsRNA-induced SGs (37). The RNA-binding protein nudix hydrolase 21 physically associates with MAVS and mediates its localization to SGs, inducing interferon production (38). Research on the role of MAVS in cardiovascular disease is scarce. MAVS-deficient mice have decreased cardiac function and ventricular dilation, and the nucleotide binding oligomerization domain 1/receptor-interacting protein 2/MAVS trigonal signaling complex carries out an important role in hypertrophic myocardial remodeling (39).

SGs are reversible membraneless cytoplasmic compartments that enable cells to resist damage from various stressors, such as oxidative or endoplasmic reticulum stress, heat shock, viral infections, toxic drugs, arsenite (Ar) and X-rays (40–42). SGs protect mRNA and proteins from external stress through liquid-liquid phase separation (LLPS) (43,44). Key proteins such as ras GTPase-activating protein-binding protein 1 (G3BP1), cytotoxic granule-associated RNA binding protein 1 and polyadenylate-binding protein 1 bind to mRNA in the nucleus to form messenger ribonucleoprotein, which is transferred to the cytoplasm as the core of SGs. The SG kernel is further fused through protein-protein interactions and forms a liquid shell through the microtubule structure. The SG shell and core are relatively dynamic and stable, respectively (45–47). Imbalances in the assembly and disassembly of SGs are associated with a variety of diseases, such as neurodegenerative diseases, viral infections and cancer (48–51).

Notably, SGs have a cardioprotective effect. CUG binding protein 2 contributes to homeostasis in H9c2 cells by promoting the coordinated translocation of cyclooxygenase-2 mRNA to SGs (52). G3BP1 controls the genes required for cardiomyocyte growth by negatively regulating microRNA-1 (53). In a model of arrhythmia, G3BP1 overexpression has been shown to substantially reduce ROS levels and calcium overload in HL-1 cells with atrial fibrillation (54). In addition, SGs are resistant to viral myocarditis and septic cardiomyopathy (55,56). However, to the best of our knowledge, neither SGs nor MAVS have been investigated in DIC.

MAVS and SGs have cardioprotective effects, and DDX3X is their positive regulator; therefore, the present study assessed the relationship and influence of DDX3X, MAVS and SGs on DIC. H9c2 cells were induced with Dox for 24 h to construct a DIC model. In the DIC model, the present study examined alterations in the anti-apoptotic marker Bcl-2 through inhibition of DDX3X, suppression of SGs, and knockdown of MAVS. These findings provide insights into the molecular mechanisms of DIC and suggest a therapeutic target for DIC.

 Materials and methods <sec> <title>Cell culture, reagents and transfection

H9c2 cells (cat. no. CL-0089; Wuhan Pricella Biotechnology, Ltd; http://m.procell.com.cn/view/690.html) were cultured in a humidified atmosphere at 37°C and 5% CO2 using complete medium consisting of DMEM (cat. no. C3113-0500; Shanghai VivaCell Biosciences, Ltd.), 10% fetal bovine serum (cat. no. FSP500; Shanghai ExCell Biology, Inc.) and 1% penicillin/streptomycin (cat. no. C3420-0100; Shanghai VivaCell Biosciences, Ltd.). Dox (cat. no. HY-15142; MedChemExpress) was administered to H9c2 cells at a concentration of 2 µmol/l and incubated at 37°C for 24 h. The negative control (NC) group received no drug treatment. RK-33 (cat. no. S8246; Selleck Chemicals) was administered at 5 µmol/l with the following protocol: H9c2 cells were pretreated with RK-33 for 30 min at 37°C, then co-treated with Dox for 24 h. The NC group received Dox treatment alone for 24 h. Anisomycin (An; cat. no. S17105; Shanghai Yuanye Biotechnology; http://www.shyuanye.com/goods-S17105.html) was used at 20 ng/ml with the following treatment protocol: H9c2 cells were pretreated with An for 30 min at 37°C followed by 24 h co-incubation with Dox. The NC group received Dox treatment alone for 24 h. Ar (cat. no. S463149; Shanghai Aladdin Biochemical Technology) was administered at 10 µmol/l under the following conditions: After 12 h of Dox treatment, H9c2 cells were co-treated with Ar and Dox for an additional 12 h at 37°C. The NC group received Dox treatment alone for 24 h.

H9c2 cells at 85% confluency were transfected for 24 h at 37°C with 2.5 µg DDX3X pcDNA3.1–3×Flag-C or negative control plasmids (Research Cloud, http://www.keyybio.com/) using Lipo8000 (cat. no. C0533; Beyotime Institute of Biotechnology), followed immediately by 24 h treatment with 2 µmol/l Dox at 37°C. In addition, H9c2 cells at 85% confluency were transfected with 50 nM DDX3X, MAVS, or nontargeting scramble small interfering (si) RNA (GENECREATE, http://www.genecreate.cn/) using Lipo8000 transfection reagent at 37°C for 24 h. Nontargeting scramble siRNA was used as negative control. Immediately following transfection, cells were treated with 2 µmol/l Dox for 24 h at 37°C. The siRNA sequences are shown in Table I.

 Detection of protein expression by western blotting

H9c2 cells were lysed on ice using RIPA Lysis Buffer (cat. no. P0013B; Beyotime Institute of Biotechnology) for 10 min, after which, they were disrupted three times (12 sec/pulse; 20% power; 4°C) using an ultrasonic disruptor (cat. No JY88-IIN; Ningbo Scientz Biotechnology Co., Ltd.) and centrifuged at 12,000 × g for 5 min at 4°C to remove cell debris. Protein concentration was detected using a BCA Protein Assay Kit (cat. no. P0012S; Beyotime Institute of Biotechnology). Protein loading buffer (cat. no. P0015; Beyotime Institute of Biotechnology) was then added, mixed and boiled for 10 min. Total protein (20–50 µg) was subsequently separated by SDS-PAGE on 12.5% gels (cat. no. PG113; Epizyme; Ipsen Pharma) and transferred to 0.45-µm PVDF membranes (cat. no. IPVH00010; MilliporeSigma). The PVDF membranes were blocked with 5% skim milk powder at room temperature for 2 h, incubated with specific primary antibodies at 4°C overnight, washed three times with TBS containing 0.1% Tween-20 and incubated with HRP-conjugated secondary antibodies at room temperature for 1 h. The blots were visualized using ECL Enhanced Plus Kit (cat. no. RM00021P; ABclonal Biotech Co., Ltd.), images were acquired using a gel imager (ChemiDoc; Bio-Rad Laboratories, Inc.) and image grayscale values were analyzed using ImageJ v1.8.0.112 software (National Institutes of Health). The primary antibodies used were as follows: Anti-DDX3 antibody (1:1,000; cat. no. ab196032; Abcam), anti-G3BP1 polyclonal antibody (1:10,000; cat. no. 13057-2-AP; Proteintech Group, Inc.), anti-MAVS polyclonal antibody (1:10,000; cat. no. 14341-1-AP; Proteintech Group, Inc.), anti-Bcl2 polyclonal antibody (1:1,000; cat. no. 26593-1-AP; Proteintech Group, Inc.) and anti-GAPDH polyclonal antibody (1:10,000; cat. no. 10494-1-AP; Proteintech Group, Inc.). The following secondary antibodies were used: HRP-conjugated Goat Anti-Rabbit IgG (1:10,000; cat. no. SA00001-2; Proteintech Group, Inc.) and HRP-conjugated Goat Anti-Mouse IgG (1:10,000; cat. no. SA00001-1; Proteintech Group, Inc.).

 Detection of mRNA expression by reverse transcription-quantitative PCR (RT-qPCR)

Total RNA Isolation Kit V2 (cat. no. RC112-01; Vazyme Biotech Co., Ltd.) was used to extract total RNA from each group of cells. RNA concentration and purity were determined using a spectrophotometer (cat. no. SMA4000; Merinton Instrument, Ltd.). RNA was then reverse transcribed into cDNA using Hifair III 1st Strand cDNA Synthesis SuperMix for qPCR (cat. no. 11141ES60; Shanghai Yeasen Biotechnology Co., Ltd.) following the manufacturer's protocol. Hieff qPCR SYBR Green Master Mix (cat. no. 11201ES60; Shanghai Yeasen Biotechnology Co., Ltd.) was used to perform qPCR on the obtained cDNA. The thermocycling conditions were as follows: 95°C for 30 sec; followed by 40 cycles at 95°C 10 sec and 60°C 30 sec. Fluorescent quantitative detection was carried out using the CFX96 RT-qPCR instrument (Bio-Rad Laboratories, Inc.) and quantitative analysis was performed using the 2−ΔΔCq method (57). Primer sequences used for RT-qPCR are listed in Table II.

 Immunofluorescence detection of SGs

Cells were fixed with 4% paraformaldehyde (cat. no. BL539A; Biosharp Life Sciences) for 15 min at room temperature, washed three times with PBS (cat. no. P1020; Beijing Solarbio Science & Technology Co., Ltd.) and permeabilized with Triton X-100 (cat. no. P0096; Beyotime Institute of Biotechnology) for 20 min at room temperature. After washing three times with PBS, the cells were blocked with goat serum (cat. no. C0265; Beyotime Institute of Biotechnology) for 1 h at room temperature and were then incubated with a specific G3BP1 polyclonal antibody (1:1,000; cat. no. 13057-2-AP; Proteintech Group, Inc.) overnight at 4°C. After washing three times with PBS, the cells were incubated with a CoraLite488-conjugated Goat Anti-Rabbit IgG secondary antibody (1:1,000; cat. no. SA00013-2; Proteintech Group Inc.) for 1 h at room temperature. After a further three washes with PBS, cell nuclei were stained with DAPI (1:1,000; cat. no. C1002; Beyotime Institute of Biotechnology) for 5 min at room temperature and the cells were imaged using a fluorescence microscope (Leica Microsystems GmbH).

 Detection of apoptosis rate using flow cytometry

The Annexin V-FITC/PI apoptosis detection kit (cat. no. 40302ES60; Shanghai Yeasen Biotechnology Co., Ltd.) was used to detect levels of apoptosis. After 24 h treatment with 2 µmol/l Dox, H9c2 cells were digested with 0.25% EDTA-free Trypsin (cat. no. T1350; Beijing Solarbio Science & Technology Co., Ltd.) and then centrifuged at 300 × g and 4°C for 5 min to collect ~200,000 cells. The cells were washed with precooled PBS twice and centrifuged at 300 × g and 4°C for 5 min each time. After resuspension with 100 µl 1X binding buffer, the cells were treated with 5 µl Annexin V-FITC and 10 µl PI staining solution at room temperature for 15 min in the dark. After 400 µl binding buffer was added, the early and late apoptosis rate of cells was detected by a FACSAria™ II cell sorter (BD Biosciences). The data were analyzed using FlowJo_v10.8.1 software (FlowJo; BD Biosciences).

 Cell viability assay

H9c2 cells were seeded into 96-well plates at 1,000 cells/well and incubated at 37°C for 24 h. The cells were stimulated with 10 µmol/l Ar at 37°C for various durations (0, 12, 24 and 48 h), and then cell viability was assessed using a Cell Counting Kit-8 (CCK-8; cat. no. K1018; APExBIO Technology LLC.) with 4 h incubation at 37°C. The optical density value was measured using an enzyme-labeling instrument at a wavelength of 450 nm.

 Statistical analysis

Data analysis was performed using GraphPad Prism 9.0 software (Dotmatics). Statistical significance was determined using an unpaired Student's t-test (for 2 groups) or one-way ANOVA with Tukey's multiple comparisons test (≥3 groups). All data are presented as the mean ± SEM and all experiments were repeated at least three times. P<0.05 was considered to indicate a statistically significant difference.

 Results <sec> <title>DDX3X and SGs are downregulated in Dox-induced H9c2 cells

H9c2 cells were treated with 2 µmol/l Dox for 24 h to induce myocardial injury (58–60). Flow cytometry analysis revealed that the apoptotic rate of H9c2 cardiomyocytes was increased after 24 h of Dox treatment (Fig. 1A). Western blotting revealed the anti-apoptotic marker Bcl2 was downregulated after treatment (Fig. 1B). Next, using RT-qPCR and western blotting, the mRNA and protein expression levels of the SG marker G3BP1 were used to quantify SGs, and to detect changes in the expression levels of DDX3X and G3BP1. The protein and mRNA expression levels of both DDX3X and G3BP1 were decreased after 24 h of Dox treatment (Fig. 1C and D). These results indicated that DDX3X expression and SG levels were reduced in Dox-treated H9c2 cells compared with the control.

 DDX3X alleviates Dox-induced cardiomyocyte apoptosis and positively regulates SGs

siRNA targeting DDX3X was used to verify the relationship between DDX3X and SGs in DIC, given the similarity in the DDX3X and SG expression changes after Dox treatment. The knockdown efficiency of the DDX3X siRNA in H9c2 cells was verified using RT-qPCR (Fig. 2B). The difference in G3BP1 expression between the DDX3X knockdown and control groups did not considerably differ in the absence of Dox stimulation; however, DDX3X knockdown exacerbated the decrease in G3BP1 protein levels in the Dox-treated H9c2 cells as well as the reduction in the levels of the anti-apoptotic marker Bcl2 (Fig. 2A). In the rescue experiment, the DDX3X pcDNA3.1–3×Flag-C plasmid was used to transfect H9c2 cells. The RT-qPCR analysis revealed that the mRNA expression levels of DDX3X in the transfected group were increased when compared with those in the control group (Fig. 2C). DDX3X overexpression did not affect the protein expression levels of G3BP1 and Bcl2 in the absence of Dox intervention, whereas DDX3X overexpression reversed the inhibitory effects of Dox on G3BP1 and Bcl2 (Fig. 2D). The DDX3X RNA helicase inhibitor RK-33 did not affect DDX3X protein levels (Fig. 2E). Furthermore, RK-33 did not inhibit G3BP1 protein expression levels in the absence of Dox intervention; however, G3BP1 protein expression levels were reduced in the Dox-treated H9c2 cell group after RK-33 pretreatment, and the protein expression levels of the anti-apoptotic marker Bcl2 were also decreased in the RK-33 + Dox group (Fig. 2E). These results indicated that DDX3X may be a protective factor against DIC and may serve a key regulatory role in the regulation of SGs in Dox-treated H9c2 cells.

 SGs ameliorate Dox-induced cardiomyocyte apoptosis

An was used to pretreat H9c2 cells and inhibit SG levels. The G3BP1 protein levels and the expression levels of the anti-apoptotic marker Bcl2 were reduced in the Dox + An group when compared with the Dox group (Fig. 3A). Next, immunofluorescence was used to locate the SGs. Green fluorescence labeled G3BP1 and blue fluorescence labeled the nucleus of H9c2 cells (Fig. 3B). Pretreatment with An exacerbated the reduction in the levels of SGs in Dox-treated H9c2 cells. Our previous study revealed that the apoptosis induced by Dox in H9c2 cells mainly occurred after 12 h (61); therefore, to stimulate SGs formation, H9c2 cells were treated with Ar after 12 h of Dox treatment. A CCK-8 assay was used to measure cell viability because of the cardiotoxicity of Ar. The stimulation of H9c2 cells with 10 µmol/l Ar for 12 h was considered safe (Fig. 3E). Ar treatment reversed the inhibitory effect of Dox on G3BP1 protein levels, and the Bcl2 protein levels did not differ between the Ar and control groups (Fig. 3C). In addition, the stimulation of SGs with Ar upregulated the expression of Bcl2 protein in the Dox group. The results of immunofluorescence analysis revealed that the G3BP1 green fluorescence signal in the Dox + Ar group was increased compared with that in the Dox group, indicating that Ar treatment reversed the Dox-induced inhibition of the number of SGs (Fig. 3D). These results indicated that SGs can resist the harmful effects of Dox on H9c2 cells, potentially attenuating Dox-induced myocardial apoptosis.

 MAVS bridges DDX3X and SGs

MAVS is a key adapter of the RLR antiviral signaling pathway. Analysis revealed that the mRNA and protein levels of MAVS were decreased in H9c2 cells treated with Dox for 24 h compared with those in the control group (Fig. 4A). DDX3X is the main upstream regulator of MAVS and exerts antiviral effects (36). It was therefore hypothesized that DDDX3X downregulation may inhibit MAVS signaling in DIC because low levels of DDX3X and MAVS were present after Dox treatment. The MAVS protein levels did not differ between the DDX3X siRNA-transfected and control groups, whereas the MAVS protein levels in the Dox + DDX3X siRNA group were substantially decreased compared with those in the Dox group (Fig. 4B). However, whether DDX3X ATPase serves a role in MAVS in DIC remains unknown; therefore, RK-33 (a DDX3X ATPase activity inhibitor) was used to investigate this. RK-33 pretreatment had no effect on MAVS protein expression in the control group, but aggravated the decrease in MAVS protein levels in the Dox group (Fig. 4C). This result indicated that the ATPase activity of DDX3X is key in the DDX3X regulation of MAVS. The expression of MAVS was inhibited in H9c2 cells by transiently transfecting the cells with MAVS siRNA. Knockdown efficiency of MAVS was verified using RT-qPCR (Fig. 4D). MAVS knockdown intensified the decrease in Bcl2 protein levels in the Dox group (Fig. 4E), suggesting that MAVS may carry out a role in resisting the myocardial damage caused by Dox treatment. Analysis also revealed that the G3BP1 protein levels in the Dox + MAVS siRNA group were reduced when compared with the Dox group, indicating that MAVS may be a key factor promoting SG assembly in DIC (Fig. 4E). The aforementioned results suggested that DDX3X and SGs may require a bridge, MAVS, to connect them in the process of resolving DIC. Fig. 5 shows the potential mechanism through which DDX3X may regulate MAVS and SGs in a model of DIC.

 Discussion

Dox damages contractile proteins, such as actin and titin, by stimulating pathways such as the calpain pathway, and it reduces norepinephrine-mediated vasoconstriction through downregulation of α1-adrenergic receptors (62–64). The impact of Dox on cardiovascular contractile function eventually leads to acute or chronic heart failure. This effect has limited the application of Dox as a first-line chemotherapeutic agent; therefore, the molecular mechanisms underlying DIC must be identified.

Dox induces cardiotoxicity through various modes of cell death, including apoptosis, pyroptosis and ferroptosis. Topoisomerase (TOP)2β is highly expressed in cardiomyocytes; Dox forms complexes with TOP2β and causes apoptosis by regulating genes such as P53 (65,66). We previously revealed that DDX3X attenuates the Dox-induced apoptosis of H9c2 cardiomyocytes through regulating Wnt/β-catenin signaling (61). The present study revealed that treatment of H9c2 cells with Dox for 24 h downregulated the expression levels of the anti-apoptotic marker Bcl2; increased the apoptosis rate; and decreased the mRNA and protein levels of DDX3X, MAVS and G3BP1. Subsequently, RK-33, Ar, An and siRNAs were used to thoroughly study the relationship between DDX3X/MAVS/SGs and myocardial apoptosis. Finally, the role of DDX3X in alleviating DIC through positively regulating MAVS and SGs was revealed.

SGs have been extensively studied in a variety of neurodegenerative diseases, such as amyotrophic lateral sclerosis. The normal function of SGs is disturbed once pathogenic proteins (such as tau protein) are involved in SG formation, ultimately damaging neurons (67–69). The SGs induced by chronic persistent stress in neurodegenerative diseases are non-dynamically stable complexes that are difficult to disassemble. The SGs formed under acute stress undergo dynamic and rapid aggregation and dissociation, which promote cell survival (68,70,71). SG levels have been reported to peak at 6 h and reduce to a minimum at 24 h in a rat model of brain tissue ischemia-reperfusion. The apoptosis level and cerebral infarction volume were also revealed to be inversely proportional to SG levels (72).

Ar was used to induce H9c2 cells from the 12 h mark after Dox treatment. The addition of Ar increased the protein expression levels of G3BP1 and anti-apoptotic marker Bcl2 after Dox treatment. Subsequently, H9c2 cells were pretreated with An, which, in contrast to Ar, aggravated DIC by suppressing G3BP1 protein expression levels. An increased number of SGs may thus prevent the damage to cardiomyocytes caused by Dox in the acute stress model. By contrast, a decreased number of SGs could weaken the defensive ability of cardiomyocytes against Dox, which is consistent with SGs being protective against the effects of acute stress.

SGs protect a large number of proteins, as well as mRNAs, and stop translation when cells are damaged through external stressors. SGs antagonize apoptosis by sequestering the receptor for activated protein C kinase 1 and other factors (73,74). This may be a mechanism through which SGs mitigate the effects of DIC. The heart lacks antioxidant enzymes such as superoxide dismutase and catalase (75,76), whereas Dox produces ROS and superoxide anions by inducing oxidative stress in cardiomyocytes, which further weakens the defensive abilities of cardiomyocytes (77,78). The core protein G3BP1 of SGs can weaken the inhibition of the antioxidant enzyme USP10 under the stressed state induced by Ar and other stimulants, thus reducing the production of ROS and levels of apoptosis (79). SG levels were reported to peak after 6 h of pacing in a cardiomyocyte model of atrial fibrillation, and G3BP1 overexpression were revealed to decrease ROS levels induced by rapid pacing (54). Therefore, the antioxidant effect of SGs and ROS downregulation may be additional mechanisms by which increased SG levels resolve DIC.

The gene encoding DDX3X is located on p11.3–11.23 of the X chromosome and is widely expressed in the majority of tissues, including the myocardium and blood vessels (80). DDX3X induces neural crest development by promoting RAC1/AKT (81). DDX3X mutations occur in 1–3% of women with unexplained intellectual disability (82). Molina-Navarro et al (83) tested the genetic sequences of 31 patients undergoing heart transplant and revealed that DDX3X is related to ischemic cardiomyopathy.

RK-33 is a small-molecule DDX3X inhibitor that functions by inhibiting the ATP-binding domain of DDX3X. RK-33 is expected to become a broad-spectrum antiviral agent because it can effectively treat SARS-CoV-2 (84). The anti-apoptotic protein Bcl2 was significantly downregulated compared with that in the Dox group when H9c2 cells were treated with RK-33 for 30 min before Dox, which suggests that the ATP domain of DDX3X may be key in DIC regulation by DDX3X. In the present study, H9c2 cells were transfected with DDX3X siRNA before Dox treatment, which revealed that DDX3X knockdown intensified Bcl2 downregulation in the Dox group. Conversely, DDX3X overexpression reversed the inhibitory effect of Dox on Bcl2. These results indicated that DDX3X may be a protective gene against DIC that serves an important role in the pathological mechanism of DIC, providing ideas for the treatment of cardiac dysfunction caused by Dox.

Hepatitis C induces the production of SGs through DDX3X to promote their expression and replication (85). In addition, G3BP1 and DDX3X are necessary for effective SARS-CoV-2 replication (86,87). DDX3X deficiency in non-alcoholic steatohepatitis obstructs SG assembly and activates the pyroptosis marker, NLRC4, exacerbating the progression of hepatitis (88). The present study demonstrated that DDX3X knockdown and RK-33-mediated inhibition of DDX3X ATPase activity reduced G3BP1 protein expression levels in the Dox-treated group, whereas DDX3X overexpression increased G3BP1 protein expression levels in the Dox treatment group. These findings indicated that DDX3X may also be a key factor in the SG assembly process in DIC, with ATPase activity being key to this process. It could be hypothesized that Dox induces myocardial damage by inhibiting DDX3X to decrease SG production.

DDX3X, an RNA helicase, may manage the RNA encapsulated within SGs through its ATPase activity, thereby assisting SGs in protecting RNA. HDAC6 deacetylates the intrinsically disordered region of DDX3X to enhance LLPS propensity, which is necessary for SG maturation (45). DDX3X and G3BP1 interact with their RG/RGG domains and subsequently bind eIF4A, inducing SG formation (89). Thus, DDX3X may promote SG formation in DIC by regulating LLPS and physically combining with G3BP1 to stabilize the SGs. This may be the mechanism through which DDX3X regulates SGs in the DIC model. The regulation of the compositional factors of SGs will be a key approach in future research on SGs.

MAVS is a key line of defense against viral infections. RIG-I/MAVS/TRAF is an antiviral signaling pathway, which participates in the natural immune response triggered by numerous viruses (90). MAVS protects cardiac function and promotes myocardial remodeling (39). In the present study, MAVS knockdown downregulated Bcl2 protein expression in the Dox-treated group, indicating that MAVS resists Dox-induced myocardial apoptosis and verifying that MAVS is an important protective factor against DIC.

Dox forms an irreversible complex with cardiolipin in the mitochondrial membrane, increasing oxide production (91,92). Knocking out MAVS in cardiomyocytes can destroy the mitochondrial structure and increase ROS production in the mitochondria (93). In addition, Dox causes an imbalance in glucose and fatty acid metabolism in the mitochondria (94), whereas MAVS knockout increases fat accumulation in cells (95). Therefore, MAVS may alleviate DIC by protecting mitochondrial function and increasing cardiomyocyte metabolism.

DDX3X promotes interferon production via regulating MAVS after viral stimulation, and MAVS also activates the host antiviral response via promoting SG formation (37). Therefore, it was hypothesized that MAVS carries out a role in protecting DDX3X and SGs against DIC. Analysis revealed that DDX3X knockdown and the RK-33-induced inhibition of DDX3X ATPase activity both decreased the levels of MAVS in the Dox-treated group, whereas MAVS knockdown exacerbated the reduction in G3BP1 protein expression levels induced by Dox treatment, suggesting that MAVS may bridge the SG assembly promoted by DDX3X in the DIC model.

DDX3X has been shown to directly bind to the caspase activation and recruitment domain of MAVS to promote MAVS activation (36), and activated MAVS co-localizes with the core SG proteins (38). DDX3X may therefore physically interact with MAVS in DIC, and the DDX3X-MAVS complex could facilitate SG formation through stabilizing core proteins such as G3BP1.

In summary, the present study validated that the DDX3X/MAVS/SGs signaling pathway may be involved in the occurrence of DIC. DDX3X could mitigate the damage caused by Dox treatment on cardiomyocytes by regulating MAVS and SG depolymerization. Notably, it was suggested that the ATPase activity of DDX3X may serve a key role in this process. The present study not only expands the understanding of the mechanisms of DIC but also provides novel information for future DIC treatment.

The present study also has limitations. The protective effect of DDX3X/MAVS/SGs on DIC was only verified at the cellular level and this conclusion was not studied using further in vivo experiments. Although analysis revealed that DDX3X downregulated MAVS and SGs in the DIC model, the specific regulatory mechanism requires further exploration. Therefore, a comprehensive investigation of the specific mechanisms through which DDX3X regulates MAVS and SGs in DIC through cellular and animal experiments will be the key focus of future research. Additionally, determining the optimal timing for targeting SGs and elucidating the precise mechanisms of SG formation are also key areas for future studies because the SGs formed under acute stress are dynamic and unstable.

 Acknowledgements

Not applicable.

 Availability of data and materials

The data generated in the present study may be requested from the corresponding author.

 Authors' contributions

KZ, SW, DF, DW, GY and FL were involved in the study design. KZ and SW performed the experiments. KZ analyzed the data and drafted the initial manuscript. KZ and GY confirm the authenticity of all the raw data. All authors have read and approved the final manuscript.

 Ethics approval and consent to participate

Not applicable.

 Patient consent for publication

Not applicable.

 Competing interests

The authors declare that they have no competing interests.

 References MomparlerRLKaronMSiegelSEAvilaFEffect of adriamycin on DNA, RNA, and protein synthesis in cell-free systems and intact cellsCancer Res36289128951277199 FornariFARandolphJKYalowichJCRitkeMKGewirtzDAInterference by doxorubicin with DNA unwinding in MCF-7 breast tumor cellsMol Pharmacol45649656199410.1016/S0026-895X(25)10149-18183243 PommierYCapranicoGOrrAKohnKWLocal base sequence preferences for DNA cleavage by mammalian topoisomerase II in the presence of amsacrine or teniposideNucleic Acids Res1959735980199110.1093/nar/19.24.70031658748 TeweyKMRoweTCYangLHalliganBDLiuLFAdriamycin-induced DNA damage mediated by mammalian DNA topoisomerase IIScience226466468198410.1126/science.60932496093249 ZamoranoJLLancellottiPRodriguez MuñozDAboyansVAsteggianoRGalderisiMHabibGLenihanDJLipGYHLyonAR2016 ESC Position Paper on cancer treatments and cardiovascular toxicity developed under the auspices of the ESC Committee for Practice Guidelines: The Task Force for cancer treatments and cardiovascular toxicity of the European Society of Cardiology (ESC)Eur Heart J3727682801201610.1093/eurheartj/ehw21127567406 CuiLHuangJZhanYQiuNJinHLiJHuangHLiHAssociation between the genetic polymorphisms of the pharmacokinetics of anthracycline drug and myelosuppression in a patient with breast cancer with Anthracycline-based chemotherapyLife Sci276119392202110.1016/j.lfs.2021.11939233774021 RamalingayyaGVCherukuSPNayakPGKishoreAShenoyRRaoCMKrishnadasNRutin protects against neuronal damage in vitro and ameliorates doxorubicin-induced memory deficits in vivo in Wistar ratsDrug Des Devel Ther1110111026201710.2147/DDDT.S10351128408800 DeanJCSalmonSEGriffithKSPrevention of doxorubicin-induced hair loss with scalp hypothermiaN Engl J Med30114271429197910.1056/NEJM197912273012605514322 SwainSMWhaleyFSEwerMSCongestive heart failure in patients treated with doxorubicin: A retrospective analysis of three trialsCancer9728692879200310.1002/cncr.1140712767102 FornaroAOlivottoIRigacciLCiaccheriMTomberliBFerrantiniCCoppiniRGirolamiFMazzarottoFChiostriMComparison of long-term outcome in anthracycline-related versus idiopathic dilated cardiomyopathy: A single centre experienceEur J Heart Fail20898906201810.1002/ejhf.104929148208 CardinaleDColomboABacchianiGTedeschiIMeroniCAVegliaFCivelliMLamantiaGColomboNCuriglianoGEarly detection of anthracycline cardiotoxicity and improvement with heart failure therapyCirculation13119811988201510.1161/CIRCULATIONAHA.114.01377725948538 BerthiaumeJMWallaceKBAdriamycin-induced oxidative mitochondrial cardiotoxicityCell Biology Toxicol231525200610.1007/s10565-006-0140-y GoormaghtighEHuartPPraetMBrasseurRRuysschaertJMStructure of the adriamycin-cardiolipin complex. Role in mitochondrial toxicityBiophys Chem35247257199010.1016/0301-4622(90)80012-V2204444 HoyeATDavorenJEWipfPFinkMPKaganVETargeting mitochondriaAcc Chem Res418797200810.1021/ar700135m18193822 ChenYJungsuwadeePVoreMButterfieldDASt ClairDKCollateral damage in cancer chemotherapy: Oxidative stress in nontargeted tissuesMol Interv7147156200710.1124/mi.7.3.617609521 DengSKrugerAKleschyovALKalinowskiLDaiberAWojnowskiLGp91phox-containing NAD(P)H oxidase increases superoxide formation by doxorubicin and NADPHFree Radic Biol Med42466473200710.1016/j.freeradbiomed.2006.11.01317275678 DoroshowJHEsworthyRSChuFFControl of doxorubicin-induced, reactive oxygen-related apoptosis by glutathione peroxidase 1 in cardiac fibroblastsBiochem Biophys Rep21100709202031799454 KongCYGuoZSongPZhangXYuanYPTengTYanLTangQZUnderlying the mechanisms of doxorubicin-induced acute cardiotoxicity: Oxidative stress and cell deathInt J Biol Sci18760770202210.7150/ijbs.6525835002523 XiongYLiuXLeeCPChuaBHLHoYSAttenuation of doxorubicin-induced contractile and mitochondrial dysfunction in mouse heart by cellular glutathione peroxidaseFree Radic Biol Med414655200610.1016/j.freeradbiomed.2006.02.02416781452 SharmaDJankowskyEThe Ded1/DDX3 subfamily of DEAD-box RNA helicasesCrit Rev Biochem Mol Biol49343360201410.3109/10409238.2014.93133925039764 HögbomMCollinsRvan den BergSJenvertRMKarlbergTKotenyovaTFloresAKarlsson HedestamGBSchiavoneLHCrystal structure of conserved domains 1 and 2 of the human DEAD-box helicase DDX3X in complex with the mononucleotide AMPJ Mol Biol372150159200710.1016/j.jmb.2007.06.05017631897 TantravediSVesunaFWinnardPTJrVan VossMRHVan DiestPJRamanVRole of DDX3 in the pathogenesis of inflammatory bowel diseaseOncotarget8115280115289201710.18632/oncotarget.2332329383159 SchröderMViruses and the human DEAD-box helicase DDX3: Inhibition or exploitation?Biochem Soc Trans39679683201110.1042/BST039067921428961 LinderPJankowskyEFrom unwinding to clamping-the DEAD box RNA helicase familyNat Rev Mol Cell Biol12505516201110.1038/nrm315421779027 LeeCSDiasAPJedrychowskiMPatelAHHsuJLReedRHuman DDX3 functions in translation and interacts with the translation initiation factor eIF3Nucleic Acids Res3647084718200810.1093/nar/gkn45418628297 KellarisGKhanKBaigSMTsaiICZamoraFMRuggieriPNatowiczMRKatsanisNA hypomorphic inherited pathogenic variant in DDX3X causes male intellectual disability with additional neurodevelopmental and neurodegenerative featuresHum Genomics1211201810.1186/s40246-018-0141-y29490693 JankowskyAGuentherUPJankowskyEThe RNA helicase databaseNucleic Acids Res39D338D341201110.1093/nar/gkq100221112871 LaiMCLeeYHTarnWYThe DEAD-box RNA helicase DDX3 associates with export messenger ribonucleoproteins as well as tip-associated protein and participates in translational controlMol Biol Cell1938473858200810.1091/mbc.e07-12-126418596238 BrennanRHaap-HoffAGuLGautierVLongASchröderMInvestigating nucleo-cytoplasmic shuttling of the human DEAD-box helicase DDX3Eur J Cell Biol97501511201810.1016/j.ejcb.2018.08.00130131165 ChenHHYuHIChoWCTarnWYDDX3 modulates cell adhesion and motility and cancer cell metastasis via Rac1-mediated signaling pathwayOncogene3427902800201510.1038/onc.2014.19025043297 Valentin-VegaYAWangYDParkerMPatmoreDMKanagarajAMooreJRuschMFinkelsteinDEllisonDWGilbertsonRJCancer-associated DDX3X mutations drive stress granule assembly and impair global translationSci Rep625996201610.1038/srep2599627180681 SoulatDBürckstümmerTWestermayerSGoncalvesABauchAStefanovicAHantschelOBennettKLDeckerTSuperti-FurgaGThe DEAD-box helicase DDX3X is a critical component of the TANK-binding kinase 1-dependent innate immune responseEMBO J2721352146200810.1038/emboj.2008.12618583960 KienesIBauerSGottschildCMirzaNPfannstielJSchröderMKuferTADDX3X links NLRP11 to the regulation of type I interferon responses and NLRP3 inflammasome activationFront Immunol12653883202110.3389/fimmu.2021.65388334054816 GuLFullamABrennanRSchröderMHuman DEAD box helicase 3 couples IκB kinase ε to interferon regulatory factor 3 activationMol Cell Biol3320042015201310.1128/MCB.01603-1223478265 SamirPKesavardhanaSPatmoreDMGingrasSMalireddiRKSKarkiRGuyCSBriardBPlaceDEBhattacharyaADDX3X acts as a live-or-die checkpoint in stressed cells by regulating NLRP3 inflammasomeNature573590594201910.1038/s41586-019-1551-231511697 OshiumiHSakaiKMatsumotoMSeyaTDEAD/H BOX 3 (DDX3) helicase binds the RIG-I adaptor IPS-1 to up-regulate IFN-beta-inducing potentialEur J Immunol40940948201010.1002/eji.20094020320127681 ZhangPLiYXiaJHeJPuJXieJWuSFengLHuangXZhangPIPS-1 plays an essential role in dsRNA-induced stress granule formation by interacting with PKR and promoting its activationJ Cell Sci12724712482201424659800 Aoyama-IshiwatariSOkazakiTIemuraSINatsumeTOkadaYGotohYNUDT21 links mitochondrial IPS-1 to RLR-containing stress granules and activates host antiviral defenseJ Immunol206154163202110.4049/jimmunol.200030633219146 LinHBNaitoKOhYFarberGKanaanGValapertiADawoodFZhangLLiGHSmythDInnate Immune Nod1/RIP2 signaling is essential for cardiac hypertrophy but requires mitochondrial antiviral signaling protein for signal transductions and energy balanceCirculation14222402258202010.1161/CIRCULATIONAHA.119.04121333070627 LiWYYangFLiXWangLWWangYStress granules inhibit endoplasmic reticulum stress-mediated apoptosis during hypoxia-induced injury in acute liver failureWorld J Gastroenterol2913151329202310.3748/wjg.v29.i8.131536925453 AndersonPKedershaNRNA granules: Post-transcriptional and epigenetic modulators of gene expressionNat Rev Mol Cell Biol10430436200910.1038/nrm269419461665 KedershaNStoecklinGAyodeleMYaconoPLykke-AndersenJFritzlerMJScheunerDKaufmanRJGolanDEAndersonPStress granules and processing bodies are dynamically linked sites of mRNP remodelingJ Cell Biol169871884200510.1083/jcb.20050208815967811 ProtterDSWParkerRPrinciples and properties of stress granulesTrends Cell Biol26668679201610.1016/j.tcb.2016.05.00427289443 MolliexATemirovJLeeJCoughlinMKanagarajAPKimHJMittagTTaylorJPPhase separation by low complexity domains promotes stress granule assembly and drives pathological fibrillizationCell163123133201510.1016/j.cell.2015.09.01526406374 SaitoMHessDEglingerJFritschAWKreysingMWeinertBTChoudharyCMatthiasPAcetylation of intrinsically disordered regions regulates phase separationNat Chem Biol155161201910.1038/s41589-018-0180-730531905 WheelerJRMathenyTJainSAbrischRParkerRDistinct stages in stress granule assembly and disassemblyElife5e18413201610.7554/eLife.1841327602576 JainSWheelerJRWaltersRWAgrawalABarsicAParkerRATPase-modulated stress granules contain a diverse proteome and substructureCell164487498201610.1016/j.cell.2015.12.03826777405 ZhaoJFuXChenHMinLSunJYinJGuoJLiHTangZRuanYG3BP1 interacts with YWHAZ to regulate chemoresistance and predict adjuvant chemotherapy benefit in gastric cancerBr J Cancer124425436202110.1038/s41416-020-01067-132989225 WangXChenTLiCLiWZhouXLiYLuoDZhangNChenBWangLCircRNA-CREIT inhibits stress granule assembly and overcomes doxorubicin resistance in TNBC by destabilizing PKRJ Hematol Oncol15122202210.1186/s13045-022-01345-w36038948 OhSWOnomotoKWakimotoMOnoguchiKIshidateFFujiwaraTYoneyamaMKatoHFujitaTLeader-containing uncapped viral transcript activates RIG-I in antiviral stress granulesPLoS Pathog12e1005444201610.1371/journal.ppat.100544426862753 LiYRKingODShorterJGitlerADStress granules as crucibles of ALS pathogenesisJ Cell Biol201361372201310.1083/jcb.20130204423629963 MoraesKCMonteiroCJPacheco-SoaresCA novel function for CUGBP2 in controlling the pro-inflammatory stimulus in H9c2 cells: Subcellular trafficking of messenger moleculesCell Biol Int3711291138201310.1002/cbin.1012723661609 AlikunjuSNiranjanNMohsinMSayedNSayedDG3bp1-microRNA-1 axis regulates cardiomyocyte hypertrophyCell Signal91110245202210.1016/j.cellsig.2022.11024535017014 DongGLiangFSunBWangCLiuYGuanXYangBXiuCYangNLiuFPresence and function of stress granules in atrial fibrillationPLoS One14e0213769201910.1371/journal.pone.021376930943206 WangYLiuRWuKYangGWangYWangHRuiTStress granule activation attenuates lipopolysaccharide-induced cardiomyocyte dysfunctionBMC Cardiovasc Disord23277202310.1186/s12872-023-03281-037312024 GuoYHinchmanMMLewandrowskiMCrossSTSutherlandDMWelshOLDermodyTSParkerJSLThe multi-functional reovirus σ3 protein is a virulence factor that suppresses stress granule formation and is associated with myocardial injuryPLoS Pathog17e1009494202110.1371/journal.ppat.100949434237110 LivakKJSchmittgenTDAnalysis of relative gene expression data using Real-time quantitative PCR and the 2(−Delta Delta C(T)) methodMethods25402408200110.1006/meth.2001.126211846609 JiangYLiuYXiaoWZhangDLiuXXiaoHYouSYuanLXinmailong Attenuates Doxorubicin-induced lysosomal dysfunction and oxidative stress in H9c2 cells via HO-1Oxid Med Cell Longev20215896931202110.1155/2021/589693133854694 ZhangHPanJHuangSChenXChangACYWangCZhangJZhangHHydrogen sulfide protects cardiomyocytes from doxorubicin-induced ferroptosis through the SLC7A11/GSH/GPx4 pathway by Keap1 S-sulfhydration and Nrf2 activationRedox Biology70103066202410.1016/j.redox.2024.10306638359744 HuCZhangXSongPYuanYPKongC-YWuHMXuSCMaZGTangQZMeteorin-like protein attenuates doxorubicin-induced cardiotoxicity via activating cAMP/PKA/SIRT1 pathwayRedox Biology37101747202010.1016/j.redox.2020.10174733045622 FengDLiJGuoLLiuJWangSMaXSongYLiuJHaoEDDX3X alleviates doxorubicin-induced cardiotoxicity by regulating Wnt/β-catenin signaling pathway in an in vitro modelJ Biochem Mol Toxicol36e23077202210.1002/jbt.2307735467791 RawatPSJaiswalAKhuranaABhattiJSNavikUDoxorubicin-induced cardiotoxicity: An update on the molecular mechanism and novel therapeutic strategies for effective managementBiomed Pharmacother139111708202110.1016/j.biopha.2021.11170834243633 LimCCZuppingerCGuoXKusterGMHelmesMEppenbergerHMSuterTMLiaoRSawyerDBAnthracyclines induce calpain-dependent titin proteolysis and necrosis in cardiomyocytesJ Biol Chem27982908299200410.1074/jbc.M30803320014676206 AhmadiaslNRostamiAMohammadiNMRajabiFEffects of noradrenaline and KCl on peripheral vessels in doxorubicin induced model of heart failurePathophysiology8259262200210.1016/S0928-4680(02)00012-312100971 LinRWHoCJChenHWPaoYHChenLEYangMCHuangSBWangSChenCHWangCP53 enhances apoptosis induced by doxorubicin only under conditions of severe DNA damageCell Cycle1721752186201810.1080/15384101.2018.152056530198376 CuiNWuFLuWJBaiRKeBLiuTLiLLanFCuiMDoxorubicin-induced cardiotoxicity is maturation dependent due to the shift from topoisomerase IIα to IIβ in human stem cell derived cardiomyocytesJ Cell Mol Med2346274639201910.1111/jcmm.1434631106979 ZhangXWangFHuYChenRMengDGuoLLvHGuanJJiaYIn vivo stress granule misprocessing evidenced in a FUS knock-in ALS mouse modelBrain14313501367202010.1093/brain/awaa07632358598 WolozinBIvanovPStress granules and neurodegenerationNat Rev Neurosci20649666201910.1038/s41583-019-0222-531582840 CuiQBiHLvZWuQHuaJGuBHuoCTangMChenYChenCDiverse CMT2 neuropathies are linked to aberrant G3BP interactions in stress granulesCell186803820.e25202310.1016/j.cell.2022.12.04636738734 AsadiMRSadat MoslehianMSabaieHJalaieiAGhafouri-FardSTaheriMRezazadehMStress granules and neurodegenerative disorders: A scoping reviewFront Aging Neurosci13650740202110.3389/fnagi.2021.65074034248597 ArimotoKFukudaHImajoh-OhmiSSaitoHTakekawaMFormation of stress granules inhibits apoptosis by suppressing stress-responsive MAPK pathwaysNat Cell Biol1013241332200810.1038/ncb179118836437 SiWYeSRenZLiuXWuZLiYZhouJZhangSLiYDengRChenDmiR-335 promotes stress granule formation to inhibit apoptosis by targeting ROCK2 in acute ischemic strokeInt J Mol Med4314521466201930747210 KedershaNIvanovPAndersonPStress granules and cell signaling: More than just a passing phase?Trends Biochem Sci38494506201310.1016/j.tibs.2013.07.00424029419 ThedieckKHolzwarthBPrentzellMTBoehlkeCKläsenerKRufSSonntagAGMaerzLGrellscheidSNKremmerEInhibition of mTORC1 by astrin and stress granules prevents apoptosis in cancer cellsCell154859874201310.1016/j.cell.2013.07.03123953116 DoroshowJHLockerGYMyersCEEnzymatic defenses of the mouse heart against reactive oxygen metabolites: Alterations produced by doxorubicinJ Clin Invest651281235198010.1172/JCI1096427350193 do NascimentoTCCazarinCBBMarósticaMRJrMercadanteAZJacob-LopesEZepkaLQMicroalgae carotenoids intake: Influence on cholesterol levels, lipid peroxidation and antioxidant enzymesFood Res Int128108770202010.1016/j.foodres.2019.10877031955741 MihmMJYuFWeinsteinDMReiserPJBauerJAIntracellular distribution of peroxynitrite during doxorubicin cardiomyopathy: Evidence for selective impairment of myofibrillar creatine kinaseBr J Pharmacol135581588200210.1038/sj.bjp.070449511834605 DeavallDGMartinEAHornerJMRobertsRDrug-induced oxidative stress and toxicityJ Toxicol2012645460201210.1155/2012/64546022919381 TakahashiMHiguchiMMatsukiHYoshitaMOhsawaTOieMFujiiMStress granules inhibit apoptosis by reducing reactive oxygen species productionMol Cell Biol33815829201310.1128/MCB.00763-1223230274 KimYSLeeSGParkSHSongKGene structure of the human DDX3 and chromosome mapping of its related sequencesMol Cells12209214200110.1016/S1016-8478(23)17085-311710523 PerfettoMXuXLuCShiYYousafNLiJYienYYWeiSThe RNA helicase DDX3 induces neural crest by promoting AKT activityDevelopment148dev184341202133318149 Snijders BlokLMadsenEJuusolaJGilissenCBaralleDReijndersMRVenselaarHHelsmoortelCChoMTHoischenAMutations in DDX3X Are a common cause of unexplained intellectual disability with Gender-specific effects on wnt signalingAm J Hum Genet97343352201510.1016/j.ajhg.2015.07.00426235985 Molina-NavarroMMTriviñoJCMartínez-DolzLLagoFGonzález-JuanateyJRPortolésMRiveraMFunctional networks of nucleocytoplasmic transport-related genes differentiate ischemic and dilated cardiomyopathies. A new therapeutic opportunityPLoS One9e104709201410.1371/journal.pone.010470925137373 VesunaFAkhrymukISmithAWinnardPTJrLinSCPannyLScharpfRKehn-HallKRamanVRK-33, a small molecule inhibitor of host RNA helicase DDX3, suppresses multiple variants of SARS-CoV-2Front Microbiol13959577202210.3389/fmicb.2022.95957736090095 PèneVLiQSodroskiCHsuCSLiangTJDynamic interaction of stress granules, DDX3X, and IKK-α mediates multiple functions in Hepatitis C virus infectionJ Virol8954625477201510.1128/JVI.03197-1425740981 HeSGouHZhouYWuCRenXWuXGuanGJinBHuangJJinZZhaoTThe SARS-CoV-2 nucleocapsid protein suppresses innate immunity by remodeling stress granules to atypical fociFASEB J37e23269202310.1096/fj.202201973RR37889852 CiccosantiFDi RienzoMRomagnoliAColavitaFRefoloGCastillettiCAgratiCBraiAManettiFBottaLProteomic analysis identifies the RNA helicase DDX3X as a host target against SARS-CoV-2 infectionAntiviral Res190105064202110.1016/j.antiviral.2021.10506433781803 YangSZhouLZhaoTZhuHLuoTJiangKShiXChenCZhangHZhaoSProtective and adverse roles of DDX3X in different cell types in nonalcoholic steatohepatitis progressionResearch (Wash D C)60275202338090607 ChenHLiBZhaoXYangCZhouSMaWCell-free analysis reveals the role of RG/RGG motifs in DDX3X phase separation and their potential link to cancer pathogenesisInt J Biol Macromol279135251202410.1016/j.ijbiomac.2024.13525139222785 GuLFullamAMcCormackNHöhnYSchröderMDDX3 directly regulates TRAF3 ubiquitination and acts as a scaffold to co-ordinate assembly of signalling complexes downstream from MAVSBiochem J474571587201710.1042/BCJ2016095627980081 Ventura-ClapierRGarnierAVekslerVEnergy metabolism in heart failureJ Physiol555113200410.1113/jphysiol.2003.05509514660709 OliveiraPJWallaceKBDepletion of adenine nucleotide translocator protein in heart mitochondria from doxorubicin-treated rats-relevance for mitochondrial dysfunctionToxicology220160168200610.1016/j.tox.2005.12.00916427179 WangQSunZCaoSLinXWuMLiYYinJZhouWHuangSZhangAReduced immunity regulator MAVS contributes to Non-hypertrophic cardiac dysfunction by disturbing energy metabolism and mitochondrial homeostasisFront Immunol13919038202210.3389/fimmu.2022.91903835844503 CarvalhoRASousaRPCadeteVJLopaschukGDPalmeiraCMBjorkJAWallaceKBMetabolic remodeling associated with subchronic doxorubicin cardiomyopathyToxicology2709298201010.1016/j.tox.2010.01.01920132857 FuJHuFMaTZhaoWJTianHZhangYHuMZhouJZhangYJianCA conventional immune regulator mitochondrial antiviral signaling protein blocks hepatic steatosis by maintaining mitochondrial homeostasisHepatology75403418202210.1002/hep.3212634435375

DDX3X and stress granules are downregulated in Dox-induced H9c2 cells. (A) H9c2 cells were treated with Dox (2 µmol/l) for 24 h, and then the apoptosis rate was detected by flow cytometry. (B) Bcl2 protein levels in H9c2 cells treated with Dox (2 µmol/l) for 24 h were analyzed by western blotting. (C) mRNA levels of DDX3X and G3BP1 in Dox (2 µmol/l)-induced H9c2 cells for 24 h were detected by reverse transcription-quantitative PCR. (D) H9c2 cells were treated with Dox (2 µmol/l) for 24 h, and the protein expression levels of DDX3X and G3BP1 were detected by western blotting. Data are presented as the mean ± SEM. Significance was determined by an unpaired Student's t-test. *P≤0.05, **P≤0.01, ***P≤0.001, ****P≤0.0001. Dox, doxorubicin; DDX3X, DEAD-box RNA helicase 3 X-linked; G3BP1, ras GTPase-activating protein-binding protein 1; NC, negative control.

Figure 1. DDX 3X and stress granules are downregulated in Dox–induced H9c2 cells. (A) H9c2 cells were treated with Dox (2 µmol / l) for 24 h, and then the apoptosis rate was detected by flow cytometry...

DDX3X alleviates Dox-induced cardiomyocyte apoptosis and positively regulated SGs. (A) H9c2 cells were transfected with DDX3X siRNA, then treated with Dox (2 µmol/l) for 24 h, and the protein changes of DDX3X, G3BP1 and Bcl2 in each group were detected by western blotting. (B) mRNA expression in H9c2 cells transfected with DDX3X siRNA and (C) after DDX3X overexpression was analyzed by reverse transcription-quantitative PCR. (D) H9c2 cells after DDX3X overexpression were treated with Dox (2 µmol/l) for 24 h, and then western blotting was carried out to detect G3BP1, DDX3X and Bcl2 protein expression. (E) H9c2 cells pretreated with RK-33 for 30 min were induced with Dox (2 µmol/l) for 24 h, and the protein expression levels of G3BP1, DDX3X and Bcl2 in each group were detected by western blotting. All experiments were repeated at least three times. Data are presented as the mean ± SEM. Significance was determined by an unpaired Student's t-test (2 groups) or one-way ANOVA with Tukey's multiple comparisons test (≥3 groups), ns, P>0.05, *P≤0.05, **P≤0.01, ***P≤0.001, ****P≤0.0001. Dox, doxorubicin; DDX3X, DEAD-box RNA helicase 3 X-linked; G3BP1, ras GTPase-activating protein-binding protein 1; siRNA, small interfering RNA.

Figure 2. DDX3X alleviates Dox–induced cardiomyocyte apoptosis and positively regulated SGs. (A) H9c2 cells were transfected with DDX3X siRNA, then treated with Dox (2 µmol / l) for 24 h, and the prot...

SGs ameliorate Dox-induced cardiomyocyte apoptosis. (A) H9c2 cells pretreated with An were stimulated with Dox (2 µmol/l) for 24 h, and then western blotting was carried out to detect G3BP1 and Bcl2 protein expression. (B) SGs in H9c2 cells induced by Dox (2 µmol/l) for 24 h after An pretreatment were observed by immunofluorescence. SGs were detected using anti-G3BP1 (green) and the nuclei were stained with DAPI (blue). (C) H9c2 cells were first treated with Dox (2 µmol/l) for 12 h, then with Ar in the continued presence of Dox for another 12 h (total Dox exposure: 24 h). Protein levels of G3BP1 and Bcl-2 were analyzed by western blotting. (D) Immunofluorescence was used to observe SGs in H9c2 cells induced by Ar and Dox (2 µmol/l). SGs were detected using anti-G3BP1 (green) and the nuclei were stained with DAPI (blue). Scale bar, 50 µm. (E) Cell viability of H9c2 cells treated with Ar (10 µmol/l) for 0, 12, 24 and 48 h was detected using the Cell Counting Kit-8 assay. All experiments were repeated at least three times. Data are presented as the mean ± SEM. Significance was determined by one-way ANOVA with Tukey's multiple comparisons test. ns, P>0.05, *P≤0.05, **P≤0.01, ***P≤0.001, ****P≤0.0001. Dox, doxorubicin; DDX3X, DEAD-box RNA helicase 3 X-linked; G3BP1, ras GTPase-activating protein-binding protein 1; Ar, arsenite; An, anisomycin; SGs, stress granules.

Figure 3. SGs ameliorate Dox–induced cardiomyocyte apoptosis. (A) H9c2 cells pretreated with An were stimulated with Dox (2 µmol / l) for 24 h, and then western blotting was carried out to detect G3BP...

MAVS bridges DDX3X and SGs. (A) mRNA and protein levels of MAVS in H9c2 cells induced by Dox (2 µmol/l) for 24 h were detected by RT-qPCR and western blotting, respectively. (B) H9c2 cells were transfected with DDX3X siRNA, then treated with Dox (2 µmol/l) for 24 h, and the changes in MAVS protein expression in each group were detected by western blotting. (C) H9c2 cells pretreated with RK-33 for 30 min were induced with Dox (2 µmol/l) for 24 h, and then western blotting was carried out to detect MAVS protein expression. (D) Knockdown efficiency of MAVS was determined by RT-qPCR. (E) H9c2 cells transfected with MAVS siRNA were induced with Dox (2 µmol/l) for 24 h, and the protein levels of MAVS, G3BP1 and Bcl2 were determined by western blotting. All experiments were repeated at least three times. Data are presented as the mean ± SEM. Significance was determined by an unpaired Student's t-test (2 groups) or one-way ANOVA with Tukey's multiple comparisons test (≥3 groups). ns, P>0.05, *P≤0.05, **P≤0.01, ***P≤0.001, ****P≤0.0001. Dox, doxorubicin; DDX3X, DEAD-box RNA helicase 3 X-linked; G3BP1, ras GTPase-activating protein-binding protein 1; RT-qPCR, reverse transcription-quantitative PCR; SGs, stress granules; MAVs, mitochondrial antiviral signaling; siRNA, small interfering RNA; NC, negative control.

Figure 4. MAVS bridges DDX3X and SGs. (A) mRNA and protein levels of MAVS in H9c2 cells induced by Dox (2 µmol / l) for 24 h were detected by RT–qPCR and western blotting, respectively. (B) H9c2 cells...

Schematic diagram of the role of DDX3X/MAVS/SGs in Dox-induced cardiotoxicity. When Dox enters cardiomyocytes, the expression of DDX3X is inhibited, which in turn downregulates the expression of the mitochondrial antiviral signal MAVS. The reduction of the DDX3X and MAVS complex inhibits the assembly of SGs, thereby decreasing the production of anti-apoptotic marker Bcl2. Dox, doxorubicin; DDX3X, DEAD-box RNA helicase 3 X-linked; G3BP1, ras GTPase-activating protein-binding protein 1; MAVs, mitochondrial antiviral signaling; SGs, stress granules.

Figure 5. Schematic diagram of the role of DDX3X / MAVS / SGs in Dox–induced cardiotoxicity. When Dox enters cardiomyocytes, the expression of DDX3X is inhibited, which in turn downregulates the expre...

siRNA sequences.

Gene Sequence (5′-3′)
DDX3X siRNA Sense, GGAGGAUUUCUUAUACCAUTT
Antisense, AUGGUAUAAGAAAUCCUCCTT
MAVS siRNA Sense, GGUCACAGUAUCAGCUCUA
Antisense, UAGAGCUGAUACUGUGACC
Negative control siRNA Sense, UUCUCCGAACGUGUCACGUTT
Antisense, ACGUGACACGUUCGGAGAATT

DDX3X, DEAD-box RNA helicase 3 X-linked; MAVS, mitochondrial antiviral signaling; siRNA, small interfering RNA.

Primer sequences used for quantitative PCR.

Gene Sequence (5′-3′)
GAPDH Forward, GTATTGGGCGCCTGGTCACC
Reverse, CGCTCCTGGAAGATGGTGATGG
DDX3X Forward, GAGAAAAGAGACTTGATGGCTTGTG
Reverse, ATCTGACTCAAGATGGGCAAGAG
G3BP1 Forward, ATGAGGTCTTCGGTGGCTTTG
Reverse, ATGTTCCTCCAAGTCATTGCTAAC
MAVS Forward, GTCCCCAGTAGAGAATTCGGA
Reverse, CCCAGTTCGGGTTCTTGCTC

DDX3X, DEAD-box RNA helicase 3 X-linked; G3BP1, ras GTPase-activating protein-binding protein 1; MAVS, mitochondrial antiviral signaling.