DMEM and 0.25% trypsin/EDTA solution used for cell passing were purchased from Thermo Fisher Scientific, Inc. BMS-202 (cat. no. HY-19745; MedChemExpress) is a non-peptide inhibitor of the PD-1/PD-L1 complex that binds to PD-L1, effectively blocking the interaction between human PD-1 and PD-L1. GW604714X (GW; cat. no. HY-138559; MedChemExpress) is a highly specific inhibitor of the mitochondrial pyruvate carrier, which markedly suppresses mitochondrial respiration. For western blotting, various primary antibodies were used including β-tubulin (1:5,000; cat. no. FD0064, Hangzhou Fude Biotechnology Co., Ltd.), mitochondrial cytochrome c oxidase subunit 1 (MT-CO1; 1:1,000; cat. no. ab14705), Bax (1:100; cat. no. ab32503) and Bcl-2 (1:1,000; cat. no. ab182858) (all from Abcam), as well as horseradish peroxidase-conjugated anti-rabbit (1:1,000, cat. no. ab6721) and anti-mouse (1:1,000, cat. no. ab6728) secondary antibodies (both from Abcam). GAPDH (1:10,000; cat. no. 10494-1-AP), Mitochondrially encoded NADH dehydrogenase 4 (MT-ND4; 1:1,000; cat. no. 26736-1-AP) and MT-ND5 (1:1,000; cat. no. 66613-1-Ig) antibodies were obtained from Proteintech Group, Inc. The antibodies against caspase-3 (1:1,000; cat. no. 9662), poly(ADP-ribose) polymerase (PARP; 1:1,000; cat. no. 9542) and cleaved-caspase-3 (1:1,000; cat. no. 9664T) were obtained from Cell Signaling Technology. PD-L1 (1:5,000, cat. no. ET1701-41, http://huabio.cn/products/PD-L1-antibody-ET1701-41) Inc., whereas antibodies used for the immunofluorescence assay, including those against caspase-3 (1:50; cat. no. 66470-2-Ig) and caspase-8 (1:50; cat. no. A19549) were purchased from Proteintech Group, Inc and ABclonal Biotech Co., Ltd., respectively. Additionally, BMS-202 fluorescently labeled with Cy-3 excitation wavelength, 561 nm) from Guangzhou Weihua Biotechnology Co., Ltd. The mitochondrial dye PKMITO DEEP RED was obtained from Nanjing Puhai Jingshan Biotechnology Co., Ltd., while Hoechst 33342 and DAPI were sourced from Beyotime Institute of Biotechnology.

Melanoma A375 cells were acquired from Wuhan Sean Biotechnology Co., Ltd. (cat. no. CL-0014, l) and have already undergone short tandem repeat profiling. The cells were cultured in DMEM containing 10% fetal bovine serum (cat. no. FSP500; Shanghai ExCell Biology, Inc.), and 1% penicillin and streptomycin, and were maintained in a cell culture incubator at 37°C and 5% CO₂. Cells in the logarithmic growth phase were selected for experimentation.

Cells were treated with 5 µM BMS-202 and 10 µM GW after adherence, and incubated in a cell culture incubator for 24 h before subsequent experiments. In the IC₅₀ assay, cell viability was measured using concentration gradients of 0.3125, 0.625, 1.25, 2.5, 5, 10, 20, and 40 µM for BMS-202, and 0.3125, 0.625, 1.25, 2.5, 5, 10, 20, 40, and 80 µM for GW, with an incubation time of 24 h. In the CCK-8 assay, cells were treated with 5 µM BMS-202 and 10 µM GW604714X, and cell viability was measured every 24 h for a total duration of 120 h.

The viability of A375 cells was determined using the Cell Counting Kit-8 (CCK-8) (cat. no. C0038; Beyotime Institute of Biotechnology) assay. Cells were seeded in a 96-well plate at a density of ~5×10³ cells/cm² and then incubated at 37°C for 24 h. With the exception of the blank group, 10 µl CCK-8 solution was then added to each well, and the cells were further incubated for 1–2 h. The optical density (OD) values were measured at 450 nm using a microplate reader. This process was used to determine the cell viability under different concentration treatments and to select the optimal experimental concentration for each group.

Total proteins were extracted using lysis buffer [RIPA(cat. no. P0013B; Beyotime Institute of Biotechnology):PMSF (cat. no. P1045; Beyotime Institute of Biotechnology), 100:1] and protein concentration was determined using a BCA quantification kit, the proteins were denatured at 100°C for 8 min. Briefly, (20 µg protein) of the extracts were loaded onto SDS-polyacrylamide gels (10.0 and 12.5%), separated by electrophoresis and then transferred to PVDF membranes The membranes were blocked with 5% skimmed milk at room temperature for 60 min., and were subsequently incubated with primary antibodies overnight at 4°C. Next, the membranes were incubated with secondary antibodies at room temperature for 60 min and detected using the Signaler ECL bioluminescence kit (cat. no. P10100; Suzhou Xinsaimei Biotechnology Co., Ltd.). Protein bands were visualized using bioluminescence imaging systems (Syngene). Grayscale values for semi-quantitative analysis were determined using ImageJ (version 1.54; National Institutes of Health).

Total RNA was extracted from cells using the RNA easy kit (cat. no. R701-01; Vazyme Biotech Co., Ltd.,), according to the manufacturer's instructions. This was followed by RT utilizing the HiScript III RT SuperMix for qPCR (cat. no. R323-01; Vazyme Biotech Co., Ltd.). RT-qPCR was performed using the qPCR kit (cat. no. Q711-02; Vazyme Biotech Co., Ltd.). The thermocycling conditions were as follows: initial denaturation at 95°C for 30 sec; 40 cycles of 95°C for 5 sec (denaturation) and 60°C for 30 sec (annealing/extension); melt curve analysis from 65 to 95°C. Primers were designed based on the gene sequences listed in the NCBI GenBank (hncbi.nlm.nih.gov/), using Primer premier (version 5.0; Premier Biosoft International). The selected primers (5′→3′) encompassed those for MT-CO1 (19), forward CTTTTCACCGTAGGTGGCCT and reverse AGTGGAAGTGGGCTACAACG; MT-CO3 (20), forward, ATGACCCACCAATCACATGC and reverse, ATCACATGGCTAGGCCGGA; MT-ND4 (21), forward 5′-3′ GCCCAAGAACTATCAAACTCCTGA and reverse 5′-3′ CGGCAAGTACTATTGACCCAGC; MT-ND5 (22), forward 5′-3′ GGCTACAAGATATCCGCTGCT and reverse 5′-3′ AAAGCCGCATAAGAACCAAA; Bax, forward 5′-3′ AGAGGATGATTGCCGCCGT and reverse, CAACCACCCTGGTCTTGGATC; Bcl-2, forward GGTGGGGTCATGTGTGTGG and reverse CGGTTCAGGTACTCAGTCATCC; β-actin, forward CTTCGCGGGCGACGAT and reverse CCACATAGGAATCCTTCTGACC. The qPCR assays were conducted on a CFX2 system (Bio-Rad Laboratories, Inc.). β-actin served as the internal control for normalization, and the relative gene expression levels were quantified using the 2^−ΔΔCq method (23), ensuring precise and reliable data analysis.

Cells were scraped and homogenized using PBS, followed by centrifugation (4°C, 10,000 × g, 10 min) to collect the supernatant. The protein concentration was determined using a BCA protein assay kit. According to the manufacturer's protocol, mitochondrial respiratory chain complex I and IV, and Mn-SOD levels in cells were assessed using the MEIMIAN Human Mitochondrial Respiratory Chain Complex I and IV ELISA kits (cat. nos. MM-60819H2 and MM-61261H2; Jiangsu ELISA Industry Co., Ltd.), and the Beyotime CuZn/Mn-SOD Activity Assay Kit (cat. no. S0103; Beyotime Institute of Biotechnology). OD values were measured at 450 nm using a full-wavelength microplate reader (Multiskan SkyHigh; Thermo Fisher Scientific, Inc.)

A total of 1×10⁶ cells were seeded in each well of 12-well plate and then proceeded with drug treatment. Adherent cells in 6-well plates were scraped and homogenized following the addition of an appropriate amount of Cell lysis buffer (cat. no. S0131S; Beyotime Institute of Biotechnology), the mixture was centrifuged (4°C, 10,000 × g, 10 min) to obtain the supernatant. The protein concentration was measured using a BCA protein assay kit. To assess the content of MDA, an MDA detection kit was used (cat. no. S0131S; Beyotime Institute of Biotechnology) following the manufacturer's instructions. OD values were measured at 532 nm using a full-wavelength microplate reader (Multiskan SkyHigh; Thermo Fisher Scientific, Inc.).

A total of 1×10⁶ cells were seeded in each well of 6-well plate, then proceed with drug treatment. According to the manufacturer's instructions (cat. no. S0026; Beyotime Institute of Biotechnology), cells were lysed using an ATP detection lysis buffer and ATP content in the cells was extracted. The relative luminescence unit values were measured using a full-wavelength fluorescence microplate reader with a luminometric measurement module (Varioskan Flash; Thermo Fisher Scientific, Inc.).

MitoSOX Red (cat. no. M36005; Thermo Fisher Scientific, Inc.), a superoxide indicator, is a novel fluorescent probe that specifically targets and stains live cell mitochondria. Upon oxidation by mitochondrial superoxide, it generates bright red fluorescence. This assay was carried out following the manufacturer's instruction. Briefly, 1×10⁶ cells were seeded in each well of 12-well plate, the supernatant of the cell culture treated with drug was discarded after 24 h. A total of 1 ml of Hoechst 33342 live cell staining solution (5 µg/ml, 1:1,000) diluted in serum-free medium was added to each well and incubated at 37°C in the dark for 15 min. Subsequently, the cells were washed three times with warm PBS and then treated with 2.5 µM MitoSOX Red diluted in serum-free medium, and incubated at 37°C in the dark for 10 min; finally, the cells were washed three times with warm PBS. The fluorescence intensity of mtROS was observed and captured using an inverted fluorescence microscope (DMi8; Leica Biosystems) with an excitation wavelength of 396 nm and an emission wavelength of 610 nm.

JC-1 is an ideal fluorescent probe used for detecting ∆Ψm (24). When the ∆Ψm is high, JC-1 aggregates in the mitochondrial matrix to form J-aggregates, producing red fluorescence; however, when the ∆Ψm is low, JC-1 remains in a monomeric state and emits green fluorescence. According to the manufacturer's instructions (cat. no. C2003S; Beyotime Institute of Biotechnology), 1×10⁴ cells were seeded in a 12-well plate and treated with drugs. For the positive control group, carbonyl cyanide m-chlorophenyl hydrazone (10 mM, cat. no. C2003S-3; Beyotime Institute of Biotechnology) was added to the cell culture medium at a 1:1,000 dilution to achieve a final concentration of 10 µM. Cells were incubated in the dark at 37°C for 20 min to abolish the membrane potential. Next, cells were incubated with prepared JC-1 working solution at 37°C in the dark for 20 min. Cells were washed twice with JC-1 buffer solution and 500 µl serum-free culture medium was added, DAPI staining solution was then added at room temperature for 5 min. An inverted fluorescence microscope was used (DMi8; Leica Biosystems) to observe and capture images of JC-1 monomers under an excitation wavelength of 490 nm and an emission wavelength of 530 nm. Subsequently, images of JC-1 aggregates were captured under an excitation wavelength of 525 nm and an emission wavelength of 590 nm.

A total of 10,000 cells were treated with BMS-202 (5 µM) labeled with Cy-3 for 24 h. After washing three times with warm PBS, PKMITO DEEP RED (250 µM) was diluted to a 1:2,500 ratio with preheated medium at 37°C and incubated with the cells in the dark for 10 min. After washing three times with warm PBS, mitochondria were observed and captured using super-resolution SIM.

Cells (5×10⁴ cells) were seeded in each well of a 6-well plate and allowed to adhere until the cell coverage reached ≥80%. A sterile 200-µl pipette tip was then used to scratch a straight line in each well. Subsequently, the medium was removed and the cells were washed three times with PBS. For the control group, 2 ml complete DMEM was added, whereas for the experimental group, BMS-202 and GW were added separately and cultured for an additional 24 h during the assay. The plate was then placed under an inverted fluorescence microscope for image capture, and the area of the scratch was measured using ImageJ (version1 441, imagej.net/ij/features.html).

Cell invasion assay was performed using a 24-well Transwell chamber (8 µm, cat, 3422, Corning) coated with Matrigel (cat, 356234, Corning) at 37°C for 2 h. A total of 1×10⁵ cells were dispersed in 200 µl serum-free culture medium and were seeded in the upper chamber. The lower chamber contained 800 µl DMEM supplemented with 10% FBS. For the experimental groups, 5 µM BMS-202 and 10 µM GW were added separately to the upper chambers, while the lower chambers remained unchanged. The cells were incubated at 37°C for 24 h and the upper chamber was washed with PBS. Next, the Transwell insert was fixed in 4% paraformaldehyde at room temperature for 15 min, followed by another wash with PBS. The insert was then stained with hematoxylin solution at room temperature for 15 min. Finally, the insert was rinsed with PBS, placed under a light microscope for imaging and ImageJ was used to calculate the number of A375 cells invading through the insert.

A total of 200 cells were evenly seeded into each well of a 12-well culture plate. After cells adhered, they were treated with complete medium containing different drugs for 24 h. Following this, the medium was replaced with a drug-free complete medium. The medium was replaced every 3 days and cells were cultured for a total of 15 days. The colonies were fixed with 4% paraformaldehyde at room temperature for 15 min and stained with 1% crystal violet, both at room temperature for 15 min. The colonies (consisted of >50 cells) were quantified using ImageJ software (version 1.441).

For cell preparation, 10,000 cells were seeded at an confocal dishes. After the cells adhered, they were treated for 24 h. For fixation, cells were washed twice with PBS, fixed with 4% paraformaldehyde at room temperature for 15 min and then washed with PBS twice. For permeabilization, cells were treated with 0.1% Triton X-100 at room temperature for 10 min and then washed twice with PBS. For blocking, non-specific binding was blocked by incubating the cells with 5% BSA (cat. no. ST023; Beyotime Institute of Biotechnology) at room temperature for 1 h. The primary antibodies were diluted according to the manufacturer's instructions and added to the corresponding samples at 4°C overnight, after which, the cells were washed three times with PBS. An Alexa Fluor^® 561-conjugated secondary antibody (1:500, cat. no. A31572; Thermo Fisher Scientific, Inc.) was then used to incubate the cells at room temperature for 2 h, before being washed three times with PBS. DAPI staining solution was then added at room temperature for 5 min and the cells were washed three times with PBS. Finally, a fluorescence microscope (Leica Biosystems) was used for imaging followed by processing using ImageJ.

According to the manufacturer's instructions of the Annexin V-FITC Apoptosis Detection Kit (cat. no. C1062M; Beyotime Institute of Biotechnology), 1×10⁶ cells were seeded into 6-well plates and treated with drugs according to the experimental groups. After treatment, the cells were collected and stained with binding buffer containing PI and Annexin V-FITC for 15 min as per the protocol. Subsequently, the stained cells were analyzed by flow cytometry using BD FACSuite (version1.0.6, BD Biosciences,).BD FACS Aria III cell sorter (BD Biosciences).

A total of 20 4-week-old female BALB/c mice (average body weight, 15±0.5 g) were included in the present study. The BALB/c nude mice utilized in the present study were obtained from the Guangdong Provincial Medical Laboratory Animal Center and were subsequently housed in the Experimental Animal Center of Guangzhou Medical University (Guangzhou, China). The mice were maintained in 22–28°C, humidity of 40–60%, and a 12-h light/dark cycle, with free access to water and food. Female mice of specific pathogen-free grade were employed in all experimental procedures. The animal protocol was reviewed and approved by the Institutional Animal Care and Use Committee of The First Affiliated Hospital of Guangzhou Medical University (approval no. 20250034). All experimental procedures were conducted in strict accordance with the 3R principles (25) to ensure the humane treatment of animals.

Mice were randomly divided into the following four groups (n=5/group): Ctrl, BMS-202 20 mg/kg, GW 10 mg/kg, and BMS-202 20 mg/kg + GW 10 mg/kg. The mice initially received a subcutaneous injection of 100 µl culture medium containing 5×10⁶ A375 cells into the dorsal region. When the tumor size reached 50–100 mm³ (length × width²/2), therapeutic treatments were initiated according to the experimental groups via intraperitoneal injection: BMS-202 (20 mg/kg), GW (10 mg/kg) or an equivalent volume of saline for the control group. Treatments were administered every 3 days. Mouse body weight was monitored using a microbalance every 3 days, and tumor size was measured with calipers every 3 days. The maximum tumor volume was set as 1,500 mm³. On the third day after the third drug injection, mice were anesthetized with 5% isoflurane and were euthanized by cervical dislocation. Death was confirmed by observing the cessation of breathing and heartbeat.

Following euthanasia, tumor tissue was harvested from the dorsal region of tumor-bearing mice. Tumor samples were fixed overnight in 4% paraformaldehyde at 4°C and subsequently embedded in paraffin. Sections (5 µm) were prepared and dewaxed, followed by antigen retrieval using citrate buffer at 98°C for 5 min and permeabilized with 0.1% Triton X-100. Endogenous enzymatic activity was quenched with 3% H₂O₂ at room temperature for 20 min. Blocking was performed with 10% goat serum (cat. no. PN0038; Pinuofei Biological) at 37°C for 30 min. Sections were then incubated with primary antibodies specific to modified Ki67 (1:500, cat. no. ABB00008; Shanghai Huilan Biotechnology Co., Ltd.) at 4°C overnight. Subsequently, sections were incubated with biotinylated secondary antibody (1:500, Peroxidase-Labeled, cat, 5220-0336, SeraCare Life Sciences) at room temperature for 1 h, followed by incubation with the DAB complex (cat, DAB-4033, Fuzhou Maixin Biotechnology Co., Ltd.) at room temperature for 5 min. Target protein expression was visualized using DAB substrate. H&E was performed at room temperature for 5 min. Image acquisition was performed using a light microscope(PANNORAMIC SCAN; 3DHISTECH).

Each experiment was repeated at least 3 times. The experimental results were analyzed using GraphPad Prism (version 9.0; Dotmatics). The significance of differences between two groups was determined using an unpaired Student's t-test. For comparisons between >2 groups, one-way ANOVA was performed, followed by Tukey's test. All data are presented as the mean ± standard deviation. P<0.05 was considered to indicate a statistically significant difference.

BMS-202 (Fig. 1A) is a small molecule PD-L1 inhibitor that exerts its effects by directly binding to PD-L1 and blocking the interaction between human PD-1 and PD-L1. In the present study, western blotting revealed that BMS-202 reduced the expression levels of PD-L1 in A375 cells (Fig. 1C). Subsequently, a cell viability assay was carried out to determine the IC₅₀ of BMS-202; for subsequent experiments, a concentration of 5 µM and a treatment time of 24 h. BMS-202 inhibited cell viability (Fig. 1B). Analysis of tumor cell functions, including migration and invasion revealed that BMS-202 significantly reduced both (Fig. 1D and E). Furthermore, RT-qPCR analysis revealed an increase in the mRNA expression levels of the pro-apoptotic factor Bax and a decrease in the mRNA expression levels of the anti-apoptotic factor Bcl-2 (Fig. 1F), suggesting that BMS-202 promotes apoptosis. This finding was further confirmed by western blotting, which showed similar results at the protein level (Fig. 1G). These data collectively indicated that BMS-202 may inhibit tumor cell functions and promote apoptosis.

MT-CO1, MT-CO3 and MT-ND4 are mitochondrial genes that encode key proteins of the mitochondrial respiratory chain, which participate in the functions of the cytochrome c oxidase complex and the NADH dehydrogenase (ND) complex during cellular respiration (26). They are essential for maintaining mitochondrial energy metabolism and ATP production. The present study revealed that BMS-202 increased the expression levels of the mitochondrial genes MT-CO1 and MT-ND4, whereas no significant change was observed in MT-CO3 expression levels (Fig. 2A). Further analysis of the mitochondrial respiratory chain complex expression revealed an upregulation of complexes I and IV (Fig. 2B), along with a significant increase in ATP levels (Fig. 2C). These results suggested that BMS-202 may enhance mitochondrial function by promoting the expression of key respiratory chain complexes and boosting ATP production.

To identify the effects of BMS-202 on tumor cells, the impact of BMS-202 on mitochondrial function was investigated by labelling the compound with Cy-3. First, A375 cells were incubated with 5 µM BMS-202-Cy-3 for 24 h. Using low magnification (magnification, ×10), it was observed that BMS-202 entered the cells (Fig. 3A). To further investigate the intracellular dynamics, live-cell imaging was carried out using SIM at high magnification (×100), which revealed that BMS-202 was localized to the mitochondria (Fig. 3B). To confirm the binding of BMS-202 to mitochondrial PD-L1, samples were fixed and immunofluorescence was carried out. Analysis revealed that BMS-202 specifically bound to PD-L1 within the mitochondria (Fig. 3C). Furthermore, Mitochondrial proteins were extracted and PD-L1 expression was assessed by western blotting but failed to detect PD-L1 in mitochondrial isolates, likely due to its low abundance below detection limits (data not shown). Notably, the relationship between increased apoptosis and tumor activity inhibition caused by BMS-202, and its concurrent enhancement of mitochondrial function remains unclear.

To further investigate the surprising impact of BMS-202 on mitochondrial function, the pyruvate carrier inhibitor GW was used to block these effects on mitochondria. First, cell viability was assessed using the CCK-8 assay and the IC₅₀ of GW was determined (Fig. 4A), based on the result of IC₅₀, 10 µM was selected as the experimental concentration. Analysis revealed that GW effectively inhibited the BMS-202-induced increase in MT-CO1, MT-ND4 and MT-ND5 (another core part of ND complex I), mRNA levels (Fig. 4B); this finding was confirmed by western blotting (Fig. 4C). Additionally, ELISA demonstrated that GW successfully reduced the levels of mitochondrial respiratory chain complex I and IV (Fig. 4D), and ATP (Fig. 4E). The results indicated that GW effectively attenuated the increase in mitochondrial respiratory chain function induced by BMS-202. To comprehensively evaluate the changes in mitochondrial function, the ∆Ψm was further assessed, revealing that BMS-202 increased the ∆Ψm in A375 cells, whereas GW inhibited this increase (Fig. 4F). In conclusion, GW effectively suppressed the mitochondrial function enhancement induced by BMS-202.

Given the close relationship between mitochondria and oxidative stress, the effects of BMS-202 on oxidative stress were investigated further. Compared with the control group, BMS-202 effectively reduced intracellular MDA levels (Fig. 5B) and increased Mn-SOD activity in mitochondria (Fig. 5A). while GW exhibited the opposite effects. Notably, BMS-202 reduced the elevated Mt-ROS levels induced by GW (Fig. 5C), indicating its role in stabilizing intracellular ROS levels. These findings suggested that BMS-202 may alleviate oxidative stress.

To investigate the relationship between increased mitochondrial function and apoptosis, the effect of combined GW and BMS-202 treatment on apoptosis was examined. Bax, caspase-3, caspase-8 and PARP are well-known pro-apoptotic factors, whereas Bcl-2 is a common anti-apoptotic factor (27). RT-qPCR revealed that the combination of GW and BMS-202 significantly upregulated Bax expression, whereas it downregulated Bcl-2 expression compared with BMS-202 (Fig. 6A). This was corroborated by western blotting results (Fig. 6B), where the expression and activation of caspase-3 and PARP were specifically assessed to evaluate apoptosis levels. GW and BMS-202 increased expression of cleaved caspase-3 and cleaved PARP compared to the BMS-202 (Fig. 6B). Additionally, cell immunofluorescence assays indicated that the BMS-202+GW group exhibited stronger caspase-3 and caspase-8 fluorescence intensity compared to the BMS-202 group (Fig. 6C). Furthermore, flow cytometry was carried out to assess apoptosis and confirmed GW can promote apoptosis induced by BMS-202 (Fig. 6D). These findings suggested that the inhibition of BMS-202-induced mitochondrial function enhancement further promotes apoptosis. The use of GW alone also promoted apoptosis, suggesting that short-term inhibition of mitochondrial respiration can enhance apoptotic processes.

To further investigate the role of the mitochondrial pathway in the tumor cell function changes induced by BMS-202, the combined effects of GW and BMS-202 on tumor proliferation, migration and invasion were examined. Analysis revealed that GW significantly enhanced the inhibitory effects of BMS-202 on tumor cell proliferation (Fig. 7A), migration (Fig. 7B) and invasion (Fig. 7C). Moreover, GW treatment notably reduced colony formation induced by BMS-202(Fig. 7D). These findings suggested that targeting the mitochondrial pathway may amplify the direct antitumor effects of BMS-202.

To validate the antitumor effects, xenograft tumors were established in nude mice and the drugs were administered via intraperitoneal injection. The detailed experimental workflow is shown in Fig. 8A and Tumor-bearing mice is shown in Fig. 8B. Tumor proliferation was evaluated by measuring tumor size and volume. The results revealed that GW significantly enhanced the inhibitory effect of BMS-202 on tumor proliferation (Fig. 8C and E), while no significant changes were observed in mouse body weight (Fig. 8D). Ki-67, a nuclear protein associated with cell cycle progression, serves as a biomarker indicative of the proportion of cells in active proliferation. Tumor specimens collected from the subcutaneous tissues of tumor-bearing mice were sectioned and subjected to both H&E staining and Ki-67 immunohistochemical analysis. H&E results revealed that after the combination treatment with BMS-202 and GM, the cell density in the tumor tissue was markedly reduced, the cellular atypia was alleviated, the pathological mitosis decreased and the vascular distribution was improved (Fig. 8F). The Ki-67-positive cell rate was significantly reduced by BMS-202 treatment compared to the control group, whereas the Ki-67 positivity ratio was further decreased by coadministration with GW (Fig. 8G). Collectively, the in vivo experiments corroborated the findings from the in vitro experiments, demonstrating consistent antitumor effects.