The human GC cell lines, NCI-N87 (exhibiting human epidermal growth factor receptor type 2 gene amplification; cat. no. CRL-5822, American Type Culture Collection), KATOIII [exhibiting fibroblast growth factor receptor type 2 gene amplification; cat. no. JCRB0611, Japan Collection of Research Bioresources (JCRB) Cell Bank] and MKN74 (without amplification of RTK genes; cat. no. JCRB0255, JCRB), and the human normal fibroblast cell line, TIG-1-20 (cat. no. JCRB0501, JCRB), were used in the present study. The cells were cultured in RPMI-1640 medium (cat. no. 30264-56; Nacalai Tesque, Inc.) containing a 10% fetal bovine serum and 0.5% penicillin and streptomycin mixture (cat. no. 09367-34; Nacalai Tesque, Inc.) at 37˚C in an atmosphere containing 5% CO₂. The cell cultures were grown in a CO₂ incubator (cat. no. MHE-S1301A2-PJ; PHC Holdings Corporation).

The NCI-N87, KATOIII, MKN74 and TIG-1-20 cells were seeded into 4-well culture slides (cat. no. 192-004; Watson Bio Lab) and cultured for 24 h at 37˚C. After 24 h, the cells were transfected with small interfering RNA (siRNA) targeting KNTC1, as described below. Following transfection, the cells are incubated for an additional 3 days and fixed for 20 min at room temperature with 4% paraformaldehyde (cat. no. 006775-1L; Bioenno Tech, LLC). The slides were washed twice for 5 min each with phosphate-buffered saline (cat. no. 73111; Kanto Chemical Co.) and sealed using coverslips and VECTASHIELD Vibrance Antifade Mounting Medium with DAPI (cat. no. H-1800; Vector Laboratories, Inc.). A total of 50 cells in anaphase, defined according to visible sister chromatid separation, were then observed using a fluorescence microscope (BX53F; Olympus Corporation). Among these 50 cells, the number of lagging chromosomes was counted (Figs. 1 and S1), and the percentage was calculated.

Total RNA was extracted from the NCI-N87, KATOIII, MKN74 and TIG-1-20 cells using an RNeasy mini kit (cat. no. 74104; Qiagen, Inc.). cDNA synthesis was performed using reverse transcription with Superscript Ⅳ VILO Master Mix with ezDNase (cat. no. 11766050; Invitrogen; Thermo Fisher Scientific, Inc.). cDNA synthesis reaction was performed at 25˚C for 10 min, 50˚C for 10 min, and 85˚C for 5 min. KNTC1 (Hs00938554_m1) and GAPDH (No. 1902206) primers were obtained from Thermo Fisher Scientific, Inc. (primer sequence information not available). qPCR was performed using TaqMan Fast Advanced Master Mix (cat. no. 4444556; Applied Biosystems; Thermo Fisher Scientific, Inc.) using the following reaction conditions: An initial denaturation at 95˚C for 20 sec, then 40 cycles at 95˚C for 3 sec and 60˚C for 30 sec. mRNA expression was analyzed using the 2^-ΔΔCq calculation (19).

The NCI-N87, KATOIII, MKN74 and TIG-1-20 cells were lysed in RIPA buffer (cat. no. 08714-04; Nacalai Tesque, Inc.). The cell lysates were then treated using ultrasound and centrifuged at 20,630 x g for 10 min at room temperature. The lysates were mixed with sample buffer (cat. no. 30566-22; Nacalai Tesque, Inc.) with 2-mercapto ethanol and incubated at 100˚C for 3 min. Lysates containing 5-7 µg protein were separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis using Mini Trans-Blot^® Cell (cat. no. 153BR78145; Bio-Rad Laboratories, Inc.). The separated proteins were then transferred from the gel to polyvinylidene fluoride membranes (cat. no. 1704272; Bio-Rad Laboratories, Inc.) using the Trans-Blot^®Turbo^TM System (cat. no. 690BR009070; Bio-Rad Laboratories, Inc.). The membranes were blocked for 5 min at room temperature with Every Blot blocking buffer (cat. no. 12010020; Bio-Rad Laboratories, Inc.) and incubated with anti-ZW10 (1:1,000; cat. no. 24561-1-AP, Proteintech, Inc.) and anti-α-tubulin (1:5,000; cat. no. 3873, clone DM1A, Cell Signaling Technology, Inc.) antibodies overnight at 4˚C. Following incubation, the membranes were washed in Tris-buffered saline containing 0.1% Tween-20 (TBS-T). The membranes were then incubated with appropriate secondary antibodies (1:5,000; anti-mouse IgG, cat. no. 7076, Cell Signaling Technology, Inc. and 1:5,000; anti-rabbit IgG, cat. no. 7074, Cell Signaling Technology, Inc.) for 1 h at room temperature and washed with TBS-T. Protein bands were detected using a ChemiDoc MP Imaging System (Bio-Rad Laboratories, Inc.). Quantitative analysis was performed using ImageLab software version 4.1 (Bio-Rad Laboratories, Inc.).

The sequence (GGAAUGAUAUUGAGCUGCUAACAAA) of human KNTC1 siRNA was designed from Thermo Fisher Scientific, Inc. (cat. no. HSS114610). KNTC1 siRNA or negative control (cat. no. 12935-300; Invitrogen; Thermo Fisher Scientific, Inc.) was combined with Lipofectamine RNAiMAX (cat. no. 13778-030; Invitrogen; Thermo Fisher Scientific, Inc.) and incubated for 15 min at room temperature. The NCI-N87, KATOIII, MKN74 and TIG-1-20 cells were transfected with the KNTC1 siRNA or negative control-Lipofectamine RNAiMAX complexes and incubated at 37˚C for 3 days. At 3 days following the addition of the KNTC1 siRNA or negative control-Lipofectamine RNAiMAX complexes, the cells were harvested and processed for RT-qPCR and western blot analysis, and for the analysis of the frequency of lagging chromosomes.

All the statistical analyses were performed using Statcel 4 (https://oms-publ.main.jp/main/4steps4-hyo1/). The one-way ANOVA and Tukey-Kramer test were performed to assess differences in frequency of lagging chromosomes and KNTC1 mRNA expression. The Student's t test was used to assess the efficiency of KNTC1 knockdown and the frequency of lagging chromosomes and ZW10 protein expression following KNTC1 knockdown. Data are presented as the mean ± standard deviation. P-values #x003C;0.05 were considered to indicate statistically significant differences.

To investigate the CIN status in GC cells, the frequency of lagging chromosomes was analyzed. The frequency of lagging chromosomes was significantly higher in the NCI-N87 and KATOIII cells, which exhibited the amplification of RTK genes, than in the MKN74 cells, which did not exhibit the amplification of RTK genes (Fig. 2). Only a small number of lagging chromosomes were observed in the TIG-1-20 cells.

The expression levels of KNTC1 mRNA were higher in the MKN74 cells than in the NCI-N87 and KATOIII cells, and were inversely associated with the frequency of lagging chromosomes (Fig. 3). In addition, the mRNA expression level of KNTC1 in the NCI-N87 cells was significantly lower than that in TIG-1-20 cells.

The present study then investigated whether the knockdown of KNTC1 increased the frequency of lagging chromosomes. The confirmation of the knockdown efficiency KNTC1 siRNA was performed using RT-qPCR (Fig. 4). The NCI-N87, KATOIII and MKN74 cells exhibited increased frequencies of lagging chromosomes following the knockdown of KNTC1 (Fig. 5A). These differences were statistically significant in the NCI-N87 and KATOIII cells. By contrast, no increases in lagging chromosomes were observed in the TIG-1-20 cells following the knockdown of KNTC1.

In addition, to determine whether ZW10 compensated for KNTC1 function, ZW10 protein expression was investigated following KNTC1 knockdown. However, no changes in ZW10 protein expression were observed in any of the cell lines tested (Fig. 6).