Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), the virus responsible for coronavirus disease 2019 (COVID-19), uses the angiotensin-converting enzyme 2 (ACE2) receptor and transmembrane serine protease 2 (TMPRSS2) to enter host cells. Variability in gene expression of these entry factors has been hypothesized to influence susceptibility and disease severity. The present study aimed to evaluate the expression of ACE2 and TMPRSS2 in nasopharyngeal cells and their association with COVID-19 infection and clinical outcomes. Nasopharyngeal samples from 491 individuals (aged 18-80 years) treated in public hospitals in Brazil during 2020 were analyzed. Patients were categorized based on SARS-CoV-2 reverse transcription-quantitative polymerase chain reaction (RT-qPCR) results and disease severity (including intensive care unit admission). Gene expression levels of ACE2 and TMPRSS2 were quantified using RT-qPCR, and statistical analyses assessed associations with infection status, age, sex, and disease severity. The findings revealed that infected individuals were significantly older (P=0.0010) and predominantly male (52.9%). ACE2 expression was significantly reduced in SARS-CoV-2-positive individuals compared with negative individuals (P<0.001), but no association with severity or sex was observed. By contrast, high ACE2 levels were found in moderately symptomatic SARS-CoV-2-negative individuals. TMPRSS2 expression did not significantly differ by infection status or disease severity. In summary, ACE2 downregulation appeared to be associated with SARS-CoV-2 infection, potentially reflecting viral evasion mechanisms. However, neither ACE2 nor TMPRSS2 gene expression in the nasopharynx served as a reliable biomarker for predicting COVID-19 severity. These findings underscore the need for multifactorial models integrating host, viral, and clinical factors to improve our understanding disease progression.
coronavirus disease 2019severe acute respiratory syndrome coronavirus 2molecular diagnosticsgene expressioncoronavirus disease 2019 severitydisease severityFunding: No funding was received.Introduction
The coronavirus disease 2019 (COVID-19) pandemic, caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), had a profound impact on global health and society. The World Health Organization (WHO) officially declared COVID-19 a pandemic on March 11, 2020, acknowledging the widespread and severe nature of the disease (1,2). Morbidity and mortality due to COVID-19 markedly increase with age and pre-existing health conditions, such as cancer and cardiovascular diseases. While most patients recover from the illness, even the youngest and healthiest can unexpectedly succumb to COVID-19(3). These observations raise questions about how much these variations in disease severity are due to the genetic susceptibility of the patient: Genetic factors may contribute both to increased transmissibility of the virus and to the worsening of the disease, as observed in a small fraction of those affected (4).
The SARS-CoV-2 virus enters host cells through a specific mechanism involving the angiotensin-converting enzyme 2 (ACE2) receptor located on the host cell membrane and the viral spike (S) protein (5-7). The spike protein (S) is initially synthesized in an inactive precursor form and is converted by host cell proteases into its active form in a process known as activation (8). After the binding of the spike protein to the ACE2 receptor, transmembrane serine protease 2 (TMPRSS2) cleaves the spike protein (9), inducing the fusion of the viral envelope's plasma membrane and the direct entry of SARS-CoV into the cells and its activation (10).
Research indicates that the expression of the ACE2 receptor may increase with age, which accounts for the greater susceptibility of older individuals to COVID-19 (11,12). Furthermore, increased expression of TMPRSS2 is associated with worse prognosis in infections by the H1N1 virus and susceptibility to infections by the H7N9 virus (13). Understanding these molecular interactions between the virus and host cell receptors is crucial for developing targeted therapies and interventions to disrupt viral entry and replication (14). In fact, identifying host factors involved in viral entry, such as TMPRSS2, has emerged as a potential therapeutic approach to prevent COVID-19 infection (15). By unraveling the mechanisms of viral entry and pathogenesis, effective antiviral strategies and treatments can be developed to combat the spread and impact of COVID-19.
The aim of the present study was to evaluate changes in the expression of ACE2 and TMPRSS2 genes in nasopharyngeal cells from patients with varying degrees of COVID-19, with the aim of determining their prognostic potential.
Patients and methodsPatient samples and classification
The present study collected nasopharyngeal cell samples from individuals attended at hospitals and emergency services within the public health network of the municipalities of Santo André, São Bernardo do Campo, São Caetano and São Mateus (São Paulo, Brazil) during 2020. The inclusion criteria were as follows: Participants of both sexes, aged between 18 and 80 years, with symptoms of respiratory diseases and who underwent SARS-CoV-2 detection tests, with or without the need for intensive care unit (ICU) admission, from April to December 2020. Samples were collected prior to the initiation of the National COVID-19 Vaccination Operationalization Plan.
The exclusion criteria were as follows: Patients under the age of 18 years and those who were hospitalized for reasons unrelated to respiratory diseases.
Disease severity classification in this study followed the clinical criteria established by the World Health Organization (WHO), which define mild cases as those with symptoms such as fever, cough, sore throat, malaise, headache, muscle pain, nausea, or anosmia, but without dyspnea, abnormal imaging, or the need for hospitalization (16). Moderate cases present with clinical or radiological signs of lower respiratory disease and maintain SpO2 ≥90% on room air. Severe cases are defined by respiratory distress, SpO2 <90%, respiratory rate >30 breaths per minute, or the need for intensive care. In the present study, these WHO clinical definitions were combined with the level of care required (such as outpatient, hospital ward, or ICU admission) to classify patients accordingly. In cases of discrepancy between the WHO-defined clinical severity and the level of care received, for example, a patient with SpO2 ≥90% admitted to the ICU due to comorbidities or precautionary monitoring, the clinical criteria were prioritized whenever sufficient data were available. However, if clinical data were insufficient to confidently determine severity, the level of care served as a surrogate marker for disease severity.
Although symptom information was documented during routine triage in 2020, a standardized and complete symptom survey was not systematically applied across all patients, as data collection occurred during routine clinical care under overwhelming operational constraints at the peak of the COVID-19 pandemic.
The study was approved by the Ethics Committee of FMABC University Center (protocol number 5.610.755; São Paulo, Brazil) on August 29, 2022. This is a retrospective analysis of nasopharyngeal samples that were obtained during the COVID-19 pandemic as part of routine diagnostics. The samples were promptly processed and stored under appropriate conditions according to established guidelines, including storage at -80˚C for long-term storage, ensuring the integrity and stability of the specimens for subsequent research analysis. Patients registered at public health units in the region, or their families, were subsequently approached by the research team to obtain written informed consent for the use of their samples and participation in the study.
Total RNA isolation
Total RNA was isolated from the nasal swab samples using the PureLink™ Total RNA Blood Kit (cat no. K156001), following the manufacturer's protocol, and quantified using a Qubit 4 fluorometer (cat no. Q33238) with the Qubit RNA HS Assay Kit (cat no. Q32852; all from ThermoFisher Scientific, Inc.). RNA samples (100 ng) were converted into cDNA using the QuantiTect Reverse Transcription Kit (cat no. 205311; QIAGEN), following the manufacturer's instructions.
Gene expression
The expression of the ACE2 and TMPRSS2 genes in nasopharyngeal cells was evaluated by quantitave polymerase chain reaction (qPCR). Specific primers were designed using the Primer3 Input 0.4.0 software (https://bioinfo.ut.ee/primer3-0.4.0/) and validated for specificity using the Primer-BLAST program (https://www.ncbi.nlm.nih.gov/tools/primer-blast/). The sequences of the primers and characteristics of the amplicons are described in Table I.
The relative expression of the target genes was normalized by the reference RPL13α gene expression (17-19). RPL13α was selected as the reference gene because its Ct values consistently remained below 35 and its amplification showed greater stability compared with other candidate reference genes tested (including GUSB, TFRC, GAPDH, and β-actin). Amplifications were performed in an ABI 7500 thermocycler (Applied Biosystems; ThermoFisher Scientific, Inc.) in a final volume of 15 µl containing 1X SYBR Green (QuantiFast® SYBR Green PCR kit; cat. no. 204054; QIAGEN), 10 pmol of each specific primer, and 2 µl of cDNA. The amplification parameters consisted of an initial hot start at 95˚C for 10 min, followed by 40 cycles at 95˚C for 15 sec and 60˚C for 25 sec. Differential expression was determined using the formula 2-ΔΔCq(20).
Statistical analysis
An initial descriptive statistical analysis was performed, expressing categorical variables as absolute and relative frequencies. Quantitative variables were summarized using medians, interquartile ranges (IQR), minimum, and maximum values. The assumption of normality for quantitative variables was formally assessed through the Shapiro-Wilk test. Based on the distribution, comparisons between two groups were performed using the Mann-Whitney U test for non-normal data, and comparisons among more than two groups were performed using the Kruskal-Wallis test. Graphical representations were standardized according to data distribution: Variables with a normal distribution are presented as the means ± standard deviation, whereas non-normally distributed variables are shown as medians and interquartile ranges (IQR).
To evaluate the expression levels of the ACE2 and TMPRSS2 genes across different COVID-19 severity groups, the non-parametric Kruskal-Wallis test was used (version 10.4.1 GraphPad Prism; Dotmatics). When significant differences were detected, Dunn's post hoc test was applied for pairwise comparisons. Correlation analyses were performed using Spearman's rank correlation. All statistical tests were two-tailed, and P<0.05 was considered to indicate a statistically significant difference.
Results
The study included samples from 491 individuals, of whom 158 tested negative and 333 tested positive for SARS-CoV-2 via molecular testing. The demographic and clinical characteristics of the patients are summarized in Table II. Among the 158 individuals with a negative test, only 3 required ICU admission for reasons unrelated to COVID-19. By contrast, among the 333 individuals who tested positive, 208 experienced mild to moderate symptoms and did not require ICU admission, while 125 developed severe symptoms and required intensive care. Although a standardized symptom survey was not employed in the present study, the symptoms most frequently documented in patients classified as mild cases included fever, cough, sore throat, and fatigue. For moderate cases, in addition to these symptoms, patients often presented dyspnea and tachypnea, consistent with clinical signs of pneumonia. Severe cases predominantly exhibited respiratory distress, hypoxia (oxygen saturation <90%), and altered mental status, which aligned with the WHO criteria for severe COVID-19 and frequently justified ICU admission (16). While exact frequencies could not be uniformly quantified due to variability in record completeness, these symptom patterns were consistent with the clinical stratification applied throughout the cohort.
Men represented the majority of participants infected with the virus: 176 (52.9%) compared with 157 (47.1%) women; among participants without SARS-CoV-2 infection, 93 (58.9%) were female and 65 (41.1%) were male. Additionally, infected participants had a higher mean age (47.4±19) than those without the virus (41.8±18) (P=0.001), as shown in Table II. Regarding severity, as expected, there was a higher proportion of severe cases (37.5%) and a lower proportion of moderate cases (14.4%) among those with SARS-CoV-2 infection compared with the group without the infection (Table III).
The analysis of gene expression data for ACE2 and TMPRSS2 among patients diagnosed with COVID-19 was conducted to investigate possible associations with sex, age and disease severity.
Both ACE2 [men (n=125), 0.3021±0.5056 vs. women (n=104), 0.3686±0.6313] and TMPRSS2 [men (n=102), 0.0463±0.0896 vs. women (n=89) 0.0745±0.1192] expression levels were slightly higher in women than in men; however, the difference was not statistically significant for ACE2 (P=0.24), while TMPRSS2 expression showed a trend toward significance (P=0.07) (Table IV). These values refer only to the subset of samples in which the respective gene expression was detected.
The analysis of the age of patients revealed no significant difference between sexes (P=0.42), with a mean age of 48±19 years for men and 46±18 years for women, as shown on Table IV. Similarly, no significant correlation was found between age and the expression of ACE2 or TMPRSS2 in either SARS-CoV-2-positive or -negative groups (Fig. 1). These findings indicated that gene expression in the nasal epithelium is not directly associated with age or SARS-CoV-2 infection status.
ACE2 expression was revealed to be significantly higher in uninfected individuals (2.750±1.775) compared with those with SARS-CoV-2 infection (0.122±0.528) (Fig. 2A). While reduced ACE2 expression in SARS-CoV-2-infected individuals may initially appear counterintuitive given the receptor's role in viral entry, an alternative explanation is that this reduction reflects a host-mediated defense mechanism aimed at limiting viral spread. By downregulating ACE2, host tissues may decrease the number of entry points available to the virus, thereby restricting replication and dissemination (21).
Analysis of TMPRSS2 expression revealed greater variability among individuals, with no significant difference between SARS-CoV-2-infected and uninfected groups (Fig. 2B). This suggests that TMPRSS2 levels in the nasopharyngeal epithelium are not directly affected by infection, although the presence of TMPRSS2 may still facilitate viral entry when ACE2 is available.
The present study analyzed the expression dynamics of the ACE2 and TMPRSS2 receptors in the nasopharyngeal epithelium and their relationship with COVID-19 severity. While no direct association was observed between ACE2 expression and disease severity, the TMPRSS2/ACE2 ratio more effectively distinguished individuals with SARS-CoV-2 infection from those without it (with SARS-CoV-2, 3.094±10.920 vs. without SARS-CoV-2, 0.024±0.047; P<0.0001), indicating a possible synergistic interaction between these receptors in viral pathogenesis (Fig. 3). On the other hand, when evaluating whether this ratio varied according to disease severity within the COVID-19-positive group, it appeared to be independent of severity (r=-0.033; P=0.67) (Fig. 4).
To further explore the association between ACE2 and TMPRSS2 expression levels and COVID-19 severity, patients were categorized according to clinical presentation. Among individuals with respiratory symptoms caused by agents other than SARS-CoV-2, ACE2 expression was significantly increased in nasopharyngeal cells from patients with moderate symptoms (Fig. 5A). By contrast, this pattern was not observed among SARS-CoV-2-infected individuals: ACE2 expression remained downregulated following infection, regardless of clinical severity (Fig. 5B).
Gene expression patterns differed between COVID-19 patients and those with other respiratory infections. In non-COVID infections, ACE2 expression increased during moderate symptoms, whereas in COVID-19 patients, ACE2 remained suppressed even after infection, suggesting a potential viral strategy to evade host defenses. Additionally, both ACE2 and TMPRSS2 showed age-related increases, with males over 65 having significantly higher ACE2 levels, which may help explain the higher mortality in this group.
In SARS-CoV-2-infected individuals, opposing patterns were observed: Symptomatic patients had lower baseline ACE2, which increased during active infection, while TMPRSS2 levels, initially elevated, decreased after infection. As previously shown in Fig. 4, the TMPRSS2/ACE2 ratio did not show a significant correlation with clinical severity in COVID-19 cases (Spearman's rs=-0.033; P=0.67), suggesting that this parameter is not associated with disease progression. Despite limitations, such as the small number of severe cases in the non-COVID cohort, sensitivity analyses confirmed the robustness of these findings.
Similarly, an evaluation of TMPRSS2 gene expression was conducted according to symptom severity in individuals without and with SARS-CoV-2 infection (Fig. 6). In both scenarios, no difference in the expression of this gene in the nasopharyngeal cells was associated with disease severity. There was no significant correlation between TMPRSS2 expression and disease severity in patients infected with COVID-19 (Spearman's rs=-0.103; P=0.154; n=191), indicating that TMPRSS2 expression does not appear to be associated with disease severity in this cohort. Likewise, no significant correlation was observed between ACE expression and disease severity in COVID-19 patients (Spearman's rs=-0.030; P=0.649; n=229), as shown in Table V, suggesting that ACE expression is not associated with disease severity in this cohort. However, the decrease in expression observed among infected individuals may indicate a condition of infection that could potentially render the patient more vulnerable, but does not directly determine the severity of the disease.
This observation supports the notion that receptor expression dynamics in COVID-19 may be more reflective of viral evasion mechanisms and host-pathogen interactions, rather than directly predicting disease outcomes. Further investigation into how these changes in receptor expression interact with other factors, such as immune response or co-morbidities, will be essential to fully understand the complex determinants of COVID-19 severity.
Discussion
The presence of COVID-19 is associated with greater severity in patient hospitalizations. Patients diagnosed with COVID-19 are more likely to present severe cases, which can influence clinical decisions and treatment strategies. These findings may support the need for more stringent measures for the prevention and treatment of COVID-19, aiming to reduce the severity of hospitalizations. Therefore, there is strong evidence that the detection of COVID-19 is significantly associated with greater severity in patient hospitalizations. This study aimed to understand how the ACE2 and TMPRSS2 receptors vary in patients with different levels of COVID-19, seeking to determine their potential as prognostic markers. By comparing their expression in respiratory cells of patients with COVID-19 and individuals without the virus, the goal was to identify which receptor is more useful for predicting clinical outcomes. ACE2 and TMPRSS2 are essential proteins for the entry of the SARS-CoV-2 virus into cells and play a crucial role in the pathogenesis of COVID-19(22). The expression of these genes can be influenced by factors such as genetic polymorphisms, cytokines associated with asthma, hormones including testosterone, and even obesity (23,24). Additionally, the expression of these genes can vary across different tissues, such as the lungs, upper respiratory tract, and intestine, which are potential sites of SARS-CoV-2 replication (25).
It is known that ACE2 expression in the airways is high in the nasal epithelium but progressively decreases in the bronchial and alveolar regions, correlating with the levels of SARS-CoV-2 infection in different compartments of the airways (26). However, the results of the present study indicated that ACE2 expression was significantly lower in the nasal epithelial cells of patients infected with SARS-CoV-2 compared with individuals without the virus, suggesting a possible negative regulation of this gene during infection. Research has indicated that SARS-CoV-2 infection can modulate ACE2 function and subsequent inflammatory responses, leading to a decrease in the expression of this gene overtime (22). In fact, there is evidence suggesting that the virus leads to a reduction in ACE2 expression, occurring through various mechanisms, including the release of ACE2 from tissues, the reduction of ACE2 levels in infected cells, the induction of clathrin- and AP2-dependent endocytosis, and subsequent lysosomal degradation (27-29). This downregulation of ACE2 by the virus has been associated with lung injury and inflammation, further exacerbating pathological processes in infected individuals (29). In the intestines, on the other hand, the absence of a positive correlation between susceptibility to infection and ACE2 expression has been described in a subpopulation of enterocytes considered the primary target of the virusAccording to the aforementioned study, infected cells activated strong pro-inflammatory programs and produced interferon, while the expression of interferon-stimulated genes was limited to uninfected cells due to the virus's suppression of interferon (30).
The decrease in ACE2 expression by SARS-CoV-2 may play a role in disease progression and its severity, including the development of acute respiratory distress syndrome (31), as it disrupts the physiological balance between ACE/ACE2 and Ang-II/angiotensin-(1-7), potentially causing severe organ damage (32). Understanding the mechanisms underlying ACE2 downregulation by the virus is essential for the development of targeted therapeutic interventions to mitigate the effects of SARS-CoV-2 infection.
In order to assess whether there is an association between ACE2 expression in the nasal epithelium of individuals with various clinical manifestations of COVID-19, the patients were grouped according to the severity of the disease (mild, moderate, or severe). No significant changes in ACE2 expression associated with COVID-19 severity were observed. In fact, studies indicate that the presence of ACE2 in nasal epithelial cells does not necessarily correlate with an increase in the severity of SARS-CoV-2 infection (33,34). It appears that greater vulnerability to severe outcomes in infected individuals may be attributed to other factors, such as the immune response and the presence of different ACE2 variants, which could influence the severity of the infection (35,36). Therefore, while ACE2 expression is crucial for viral entry into cells, it may not serve as a reliable predictor of disease severity (33).
TMPRSS2, a transmembrane protease, is crucial for the activation of SARS-CoV-2 within human airway cells (35). This protease is expressed in various tissues, including nasal epithelial cells, where it cleaves and activates the viral S protein, facilitating viral entry and infection (36). The co-expression of TMPRSS2 and ACE2 in nasal epithelial cells has been associated with increased SARS-CoV-2 infectivity and transmissibility, suggesting a potential role of these cells in the early stages of infection (37). However, despite the decreased ACE2 expression in infected individuals, the results did not reveal any alteration in TMPRSS2 gene expression between individuals with and without the virus, indicating that the regulation of this gene may not be influenced by its presence. Research conducted on SARS-CoV, a member of the coronavirus family, has revealed that TMPRSS2 expression is indeed not affected during viral production (23). According to this study, TMPRSS2 influences viral entry but not other phases of viral replication, suggesting that the spatial orientation of TMPRSS2 in relation to the S protein is a key mechanism underlying this phenomenon (23).
In the present study, it was observed that the expression of the ACE2 and TMPRSS2 genes does not vary between men and women with COVID-19, nor with the age of infected patients. A previous study suggests that ACE2 expression may vary with age (38), while another study did not find a consistent correlation (39).
Although a relationship between age, the expression of these genes, and susceptibility or severity of SARS-CoV-2 infection was anticipated, other factors beyond this variable appear to have a greater influence on the modulation of the expression of these genes (23,40). Factors such as genetic variations, pre-existing health conditions, environmental exposures, and other biological and social determinants may play a significant role in regulating ACE2 and TMPRSS2 expression, thus influencing SARS-CoV-2 susceptibility and severity.
Additionally, the expression of these genes may be modulated by factors such as inflammation, smoking exposure, and diseases such as asthma and chronic obstructive pulmonary disease (40). Therefore, it is crucial to consider a broad range of factors beyond age when investigating the expression of these genes and their relationship with COVID-19. A potential limitation of the study is that it did not account for pre-infection factors, such as those aforementioned, which may influence gene expression. However, it is important to emphasize that the present study was conducted during the peak of the pandemic in Brazil, a time when strict social isolation rules and regulations imposed significant limitations on data collection and analysis. These constraints may have impacted the ability to fully explore the role of these additional factors in the context of COVID-19 severity. Furthermore, it is important to highlight that, as this classification relied exclusively on RT-qPCR results, the possibility of false-negative results cannot be ruled out. Therefore, some individuals classified as SARS-CoV-2-negative might have actually been infected, especially in cases of improper sample collection or low viral load at the time of testing.
The downregulation of ACE2 observed during SARS-CoV-2 infection, in contrast to the stable expression of TMPRSS2, highlights the importance of considering multiple influences on gene modulation, such as environmental exposures and other external factors. These insights underscore the need for multifactorial approaches in COVID-19 research and treatment to better understand and mitigate susceptibility and disease severity.
In conclusion, the present study demonstrated that ACE2 gene expression is significantly reduced in individuals infected with SARS-CoV-2, regardless of symptom severity, age, or sex, suggesting that this downregulation may be a direct consequence of viral infection. By contrast, TMPRSS2 expression exhibited no significant variation between infected and non-infected individuals, nor across different levels of disease severity. Although both proteins are essential for viral entry, their expression levels in nasopharyngeal cells do not serve as reliable biomarkers for predicting COVID-19 severity. These findings highlight the complexity of COVID-19 pathogenesis and underscore the need for multifactorial approaches, integrating genetic, immunological, and clinical factors, for improved understanding and management of disease progression.
Acknowledgements
Not applicable.
Availability of data and materials
The data generated in the present study may be requested from the corresponding author.
Authors' contributions
All authors (SSC, ACBCS, MYSG, MCP, RSS, IDRT, GLV, FLAF, BCAA) contributed equally to the conception, design, data acquisition, analysis, and writing of the manuscript. SSC and BCAA confirm the authenticity of all the raw data. All authors read and approved the final version of the manuscript.
Ethics approval and consent to participate
The present study was approved by the Ethics Committee of FMABC University Center (protocol number 5.610.755; São Paulo, Brazil) and adheres to Resolution 466/12 of the National Health Council, and all patients received information concerning their participation in the study and provided written informed consent.
Patient consent for publication
Not applicable.
Competing interests
The authors declare that they have no competing interests.
ReferencesRiouJAlthausCLPattern of early human-to-human transmission of Wuhan 2019 novel coronavirus (2019-nCoV), December 2019 to January 2020Euro Surveill25200005820203201966910.2807/1560-7917.ES.2020.25.4.2000058World Health Organization (WHO): Coronavirus disease 2019 (COVID-19) situation report-52. WHO, Geneva, 2020.DongYMoXHuYQiXJiangFJiangZTongSEpidemiology of COVID19 among children in ChinaPediatrics145e2020070220203217966010.1542/peds.2020-0702HouYZhaoJMartinWKallianpurAChungMKJehiLSharifiNErzurumSEngCChengFNew insights into genetic susceptibility of COVID-19: An ACE2 and TMPRSS2 polymorphism analysisBMC Med1821620203266487910.1186/s12916-020-01673-zEjazHAlsrhaniAZafarAJavedHJunaidKAbdallaAEAbosalifKOAAhmedZYounasSCOVID-19 and comorbidities: Deleterious impact on infected patientsJ Infect Public Health131833183920203278807310.1016/j.jiph.2020.07.014HassanpourMRezaieJNouriMPanahiYThe role of extracellular vesicles in COVID-19 virus infectionInfect Genet Evol8510442220203254461510.1016/j.meegid.2020.104422ChaudhryFLavanderoSXieXSabharwalBZhengYYCorreaANarulaJLevyPManipulation of ACE2 expression in COVID-19Open Heart7e00142420203344312110.1136/openhrt-2020-001424ZmoraPMoldenhauerASHofmann-WinklerHPöhlmannSTMPRSS2 isoform 1 activates respiratory viruses and is expressed in viral target cellsPLoS One10e013838020152637904410.1371/journal.pone.0138380HoffmannMHofmann-WinklerHSmithJCKrügerNAroraPSørensenLKSøgaardOSHasselstrømJBWinklerMHempelTCamostat mesylate inhibits SARS-CoV-2 activation by TMPRSS2-related proteases and its metabolite GBPA exerts antiviral activityEbioMedicine6510325520213367689910.1016/j.ebiom.2021.103255MatsuyamaSNagataNShiratoKKawaseMTakedaMTaguchiFEfficient activation of the severe acute respiratory syndrome coronavirus spike protein by the transmembrane protease TMPRSS2J Virol84126581266420102092656610.1128/JVI.01542-10BilinskaKJakubowskaPVon BartheldCSButowtRExpression of the SARS-CoV-2 entry proteins, ACE2 and TMPRSS2, in cells of the olfactory epithelium: Identification of cell types and trends with ageACS Chem Neurosci111555156220203237941710.1021/acschemneuro.0c00210RenHLWenGMZhaoZYLiuDHXiaPCan CD147 work as a therapeutic target for tumors through COVID-19 infection?Int J Med Sci192087209220223648359410.7150/ijms.79162ChengZZhouJToKKWChuHLiCWangDYangDZhengSHaoKBosséYIdentification of TMPRSS2 as a susceptibility gene for severe 2009 pandemic A(H1N1) influenza and A(H7N9) influenzaJ Infect Dis2121214122120152590460510.1093/infdis/jiv246CetinkayaEACoincidence of COVID-19 infection and smell-taste perception disordersJ Craniofac Surg31e625e62620203239862510.1097/SCS.0000000000006601TolouianRTolouianACArdalanMBlocking serine protease (TMPRSS2) by bromhexine; looking at potential treatment to prevent COVID-19 infectionMarshall J Med611142020World Health Organization (WHO): Clinical management of COVID-19: Living guideline, 18 August 2023. WHO, Geneva, 2023.HannemannJSchmidt-HuttenLHannemannJKleinsangFBögerRSelection of reference genes for normalization of gene expression after exposure of human endothelial and epithelial cells to hypoxiaInt J Mol Sci26176320254000422610.3390/ijms26041763HamptonTHKoeppenKBashorLStantonBASelection of reference genes for quantitative PCR: Identifying reference genes for airway epithelial cells exposed to Pseudomonas aeruginosaAm J Physiol Lung Cell Mol Physiol319L256L26520203252116510.1152/ajplung.00158.2020BijiAKhatunOSwarajSNarayanRRajmaniRSSardarRSatishDMehtaSBindhuHJeevanMIdentification of COVID-19 prognostic markers and therapeutic targets through meta-analysis and validation of Omics data from nasopharyngeal samplesEBioMedicine7010352520213439214810.1016/j.ebiom.2021.103525LivakKJSchmittgenTDAnalysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) methodMethods2540240820011184660910.1006/meth.2001.1262BourgonjeARAbdulleAETimensWHillebrandsJLNavisGJGordijnSJBollingMCDijkstraGVoorsAAOsterhausADAngiotensin-converting enzyme 2 (ACE2), SARS-CoV-2 and the pathophysiology of coronavirus disease 2019 (COVID-19)J Pathol25122824820203241819910.1002/path.5471Saheb Sharif-AskariNSaheb Sharif-AskariFAlabedMTemsahMHAl HeialySHamidQHalwaniRAirways expression of SARS-CoV-2 receptor, ACE2, and TMPRSS2 Is lower in children than adults and increases with smoking and COPDMol Ther Methods Clin Dev181620203253747810.1016/j.omtm.2020.05.013KimuraHFranciscoDConwayMMartinezFDVercelliDPolverinoFBillheimerDKraftMType 2 inflammation modulates ACE2 and TMPRSS2 in airway epithelial cellsJ Allergy Clin Immunol1468088.e820203242214610.1016/j.jaci.2020.05.004BaratchianMMcManusJMBerkMPNakamuraFMukhopadhyaySXuWErzurumSDrazbaJPetersonJKleinEAAndrogen regulation of pulmonary AR, TMPRSS2 and ACE2 with implications for sex-discordant COVID-19 outcomesSci Rep111113020213404551110.1038/s41598-021-90491-1SarverDWongGObesity alters Ace2 and Tmprss2 expression in lung, trachea, and esophagus in a sex-dependent manner: Implications for COVID-19Biochem Biophys Res Commun538929620213316818810.1016/j.bbrc.2020.10.066RossiÁDde AraújoJLFde AlmeidaTBRibeiro-AlvesMde Almeida VelozoCAlmeidaJMde Carvalho LeitãoIFerreiraSNda Silva OliveiraJAlvesHJAssociation between ACE2 and TMPRSS2 nasopharyngeal expression and COVID-19 respiratory distressSci Rep11965820213395862710.1038/s41598-021-88944-8GuoJHuangZLinLLvJCoronavirus disease 2019 (COVID-19) and cardiovascular disease: A viewpoint on the potential influence of angiotensin-converting enzyme inhibitors/ angiotensin receptor blockers on onset and severity of severe acute respiratory syndrome coronavirus 2 infectionJ Am Heart Assoc9e01621920203223375510.1161/JAHA.120.016219DattaPKLiuFFischerTRappaportJQinXSARS-CoV-2 pandemic and research gaps: Understanding SARS-CoV-2 interaction with the ACE2 receptor and implications for therapyTheranostics107448746420203264200510.7150/thno.48076LuYZhuQFoxDMGaoCStanleySALuoKSARS-CoV-2 down-regulates ACE2 through lysosomal degradationMol Biol Cell33ar14720223628791210.1091/mbc.E22-02-0045GraceJACaseySBurrellLMAngusPWProposed mechanism for increased COVID-19 mortality in patients with decompensated cirrhosisHepatol Int1488488520203288633210.1007/s12072-020-10084-4TrianaSMetz-ZumaranCRamirezCKeeCDoldanPShahrazMSchraivogelDGschwindARSharmaAKSteinmetzLMSingle-cell analyses reveal SARS-CoV-2 interference with intrinsic immune response in the human gutMol Syst Biol17e1023220213390465110.15252/msb.202110232KubaKYamaguchiTPenningerJMAngiotensin-converting enzyme 2 (ACE2) in the pathogenesis of ARDS in COVID-19Front Immunol1273269020213500305810.3389/fimmu.2021.732690NiWYangXYangDBaoJLiRXiaoYHouCWangHLiuJYangDRole of angiotensin-converting enzyme 2 (ACE2) in COVID-19Crit Care2442220203266065010.1186/s13054-020-03120-0JiJYJoAWonJGilCHShinHKimSJeonYJKimHJThe nasal symbiont Staphylococcus species restricts the transcription of SARS-CoV-2 entry factors in human nasal epitheliumiScience2410317220213460472010.1016/j.isci.2021.103172TakabayashiTYoshidaKImotoYSchleimerRPFujiedaSRegulation of the expression of SARS-CoV-2 receptor angiotensin-converting enzyme 2 in Nasal MucosaAm J Rhinol Allergy3611512220223423277010.1177/19458924211027798FowlerPCNaluaiÅTOscarssonMTorkzadehSBohmanABendeMHarandiAMDifferential expression of angiotensin-converting enzyme 2 in nasal tissue of patients with chronic rhinosinusitis with nasal polyps medRxiv, 2021.PavelABGlickmanJWMichelsJRKim-SchulzeSMillerRLGuttman-YasskyETh2/Th1 cytokine imbalance is associated with higher COVID-19 risk mortalityFront Genet1270690220213433570310.3389/fgene.2021.706902BestleDHeindlMRLimburgHVan Lam vanTPilgramOMoultonHSteinDAHardesKEickmannMDolnikOTMPRSS2 and furin are both essential for proteolytic activation of SARS-CoV-2 in human airway cellsLife Sci Alliance3e20200078620203270381810.26508/lsa.202000786BunyavanichSDoAVicencioANasal gene expression of angiotensin-converting enzyme 2 in children and adultsJAMA3232427242920203243265710.1001/jama.2020.8707LiMYLiLZhangYWangXSExpression of the SARS-CoV-2 cell receptor gene ACE2 in a wide variety of human tissuesInfect Dis Poverty94520203234536210.1186/s40249-020-00662-x
(A-D) Correlation between age and ACE2 expression in nasopharyngeal cells from individuals (A) with SARS-CoV-2 infection and (C) without SARS-CoV-2 infection, and TMPRSS2 expression in individuals (B) with SARS-CoV-2 infection and (D) without the virus. Spearman's correlation test was used to analyze the data. ACE2, angiotensin-converting enzyme 2; SARS-CoV-2, severe acute respiratory syndrome coronavirus 2; TMPRSS2, transmembrane serine protease 2.
Expression of (A) ACE2 and (B) TMPRSS2 in the nasopharyngeal cells of individuals with and without SARS-CoV-2 infection. Expression values were obtained using the formula 2-ΔΔCq.ACE2, angiotensin-converting enzyme 2; TMPRSS2, transmembrane serine protease 2; SARS-CoV-2, severe acute respiratory syndrome coronavirus 2.
Comparison of the TMPRSS2/ACE2 ratio between individuals with and without SARS-CoV-2 infection. While ACE2 expression alone was not associated with disease severity, the TMPRSS2/ACE2 ratio clearly differentiated infected from non-infected individuals (with SARS-CoV-2, 3.094±10.920 vs. without SARS-CoV-2, 0.024±0.047; P<0.0001), suggesting a potential synergistic role of these receptors in viral pathogenesis.
TMPRSS2/ACE2 ratio across COVID-19-positive individuals stratified by disease severity (1, mild; 2, moderate; 3, severe). No significant correlation was observed between the ratio and disease severity (r=-0.033; P=0.67), indicating that this ratio is independent of disease severity.
ACE2 gene expression in the nasopharyngeal cells of individuals (A) without SARS-CoV-2 and (B) with the virus, according to their disease status. The Kruskal-Wallis test was used to analyze the data. ACE2, angiotensin-converting enzyme 2; SARS-CoV-2, severe acute respiratory syndrome coronavirus 2.
TMPRSS2 gene expression in the nasopharyngeal cells of individuals (A) without SARS-CoV-2 and (B) with the virus, according to their disease status. The Kruskal-Wallis test was used to analyze the data. TMPRSS2, transmembrane serine protease 2; SARS-CoV-2, severe acute respiratory syndrome coronavirus 2.
Characteristics of specific primers and their amplicons.
Gene
Sequence (5'-3')
Amplicon
ACE2
F: AGGGCGACTTCAGGATCCTT
R: TGTGGCTGCAGAAAGTGACA
185 bp
TMPRSS2
F: GAACACAAGTGCCGGCAATG
R: CTGGACGTGCAGGCTGAC
193 bp
RPL13a
F: TTGAGGACCTCTGTGTATTTGTCAA
R: CCTGGAGGAGAAGAGGAAAGAGA
126 bp
Specific primer sequences and expected amplicon sizes for target genes used in the present study are presented. Forward and reverse primer sequences are listed in the 5' to 3' direction. Amplicon size is given in base pairs (bp). ACE2, angiotensin-converting enzyme 2; TMPRSS2, transmembrane serine protease 2; RPL13a, ribosomal protein L13a; F, forward; R, reverse.
Clinical characteristics of the patients.
Characteristics
n (%)
Sex
Female
250 (50.9)
Male
241 (49.1)
Age (years)
18 to 40
227 (46.2)
41 to 60
154 (31.4)
61 to 80
110 (22.4)
SARS-CoV-2-negative (n=158)
No ICU admission
155 (98.1)
With ICU admission
3 (1.9)
SARS-CoV-2-positive (n=333)
No ICU admission
208 (62.5)
With ICU admission
125 (37.5)
Sex distribution (SARS CoV-2-positive) (n=333)
Male
176 (52.9)
Female
157 (47.1)
Sex distribution (SARS CoV-2-negative) (n=158)
Male
65 (41.1)
Female
93 (58.9)
Mean age (±SD) (n=491)
SARS CoV-2-positive
47.4±19
SARS CoV-2-negative
41.8±18
Clinical characteristics of the study population. Data are presented as absolute numbers and percentages. Age groups are categorized in years. ICU admission status is shown separately for SARS-CoV-2-negative and -positive patients. ICU, intensive care unit; SARS-CoV-2, severe acute respiratory syndrome coronavirus 2.
Contingency by severity compared with SARS-CoV-2 diagnosis.
Severity
Without SARS-CoV-2 infection, n (%)
With SARS-CoV-2 infection, n (%)
Mild
88 (55.7)
Mild
160 (48.0)
Moderate
67 (42.4)
Moderate
48 (14.4)
Severe
3 (1.9)
Severe
125 (37.5)
SARS-CoV-2, severe acute respiratory syndrome coronavirus 2.
Comparison of ACE2 and TMPRSS2 levels and age between men and women.
Variable
Group
P-value
Statistical significance
ACE2 expression
Men (n=125)
0.3021±0.5056
0.24
NS
Women (n=104)
0.3686±0.6313
TMPRSS2 expression
Men (n=102)
0.0463±0.0896
0.07
Trend towards significance
Women (n=89)
0.0745±0.1192
Age (years)
Men
48±19
0.42
Women
46±18
NS
ACE2 and TMPRSS2 expression levels and age distribution of patients by sex. Data are presented as the mean ± standard deviation. ACE2 expression was slightly higher in women than in men, but the difference was not statistically significant (P=0.24). TMPRSS2 expression showed a trend toward significance (P=0.07). No significant difference in age was observed between sexes (men, 48±19 years; women, 46±18 years; P=0.42). These values refer only to the subset of samples in which the respective gene expression was detected. ACE2, angiotensin-converting enzyme 2; TMPRSS2, transmembrane serine protease 2; NS, not significant.
Correlation between gene expression and COVID-19 severity.
Gene
No. of patients
rs
P-value
TMPRSS2
191
-0.103
0.154
ACE2
229
-0.030
0.649
Spearman's correlation coefficients (rs) between the expression of TMPRSS2 and ACE genes and COVID-19 severity. None of the correlations were statistically significant (P>0.05).