RD and RH30 (ATCC) are fusion-negative and fusion-positive human RMS cells, respectively (29). 76-9 is a murine-derived RMS cell line isolated from a methylcholanthrene-induced mouse RMS tumor in a female C57BL/6 mouse and was provided by Dr Tim Cripe (Nationwide Children's Hospital, Columbus, OH, USA) (30,31). Human RMS cells were authenticated using STR profiling (Arizona Genetic Core). Cells were cultured in DMEM (76-9 and RD) or RPMI (RH30) complete media (Gibco; Thermo Fisher Scientific, Inc.) and kept at 37°C and a 5% CO₂ incubator. The small molecule compound RCM1 (2-[2-oxo-2-(thiophen-2-yl) ethyl]sulfanyl-4,6-di(thiophen-2-yl) pyridine-3-carbonitrile) was synthesized by Vitas-M Laboratory (95% purity) and dissolved in DMSO for in vitro studies. Venetoclax (ABT-199) purchased from APeXBIO Technology LLC (cat. no. A8194) was dissolved in DMSO for in vitro studies and reconstituted in the solution that contained 10% ethanol, 30% polyethylene glycol 400 (PEG 400) and 60% lecithin dissolved in propylene glycol for in vivo studies.

76-9 (10×10⁴) and RD cells (8×10⁴) per well were seeded in 6-well plates and allowed to grow for 24 h. RCM-1 was added at 24 h and venetoclax was added at 48 h in the sequential treatment regimen. Trypan blue staining was performed by incubating the cell suspension with 0.4% trypan blue at room temperature for 1 min. to exclude dead cells and viable cells were counted using a hemocytometer. To measure cell viability, cells were incubated with the cell counting kit-8 (CCK8) solution (GLPBIO Technology LLC) at 37°C for 1 h, followed by detecting the absorbance at 450 nm using a microplate reader. Experiments were performed in triplicate.

Apoptosis in RMS cells following treatment with RCM-1 and venetoclax was assessed using the Caspase-Glo^® 3/7 Assay (Promega Corporation) according to the manufacturer's protocol. After 72 h of drug incubation, as aforementioned, the Caspase-Glo 3/7 reagent was added to each sample at a 1:1 ratio with the culture volume. The plate was then incubated at 37°C for 30 min and luminescence was subsequently measured using a microplate reader.

All chemicals for nanoparticle synthesis were used as received without any further purification and were obtained from MilliporeSigma.

The Poly(β-Amino Ester) (PBAE) polymer backbone was synthesized via a modified Michael Addition, as described in our previous studies (20,32). Briefly, Bisphenol A glycerolate diacrylate was initially mixed with 6-amino-1-hexanol in DMSO at 90°C for 24 h. Following this, 4,4'-Trimethylenedipiperidine in DMSO was added to the mixture as the temperature was reduced to 50°C and maintained for another 24 h. The PBAE backbone was then capped with methoxypolyethylene glycol amine and folic acid-modified polyethylenimine in DMSO at 40°C. The folic acid modification was performed via EDC/NHS coupling, as previously described (33). To encapsulate RCM-1, the PBAE polymers were mixed with RCM-1 in DMSO at a mass ratio of 10:1, followed by transitioning the mixture to an aqueous environment to facilitate DMSO diffusion and nanoparticle self-assembly. The resulting nanoparticles were then dialyzed for 48 h to remove DMSO, excess drug and extra polymers. The concentration of RCM-1 encapsulated in the nanoparticles was determined by UV/Vis spectroscopy as described (34).

A total of 55 C57Bl/6J mice (8-12 weeks old, 1:1 male and female) were purchased from the Jackson Laboratory. The mean male mouse weight was 25 g and the average female mouse weight was 20 g. All mice were kept under SPF (specific-pathogen-free) conditions in 12-h light/dark cycle, 18-23°C and 40-60% humidity. To generate the subcutaneous syngeneic murine model, 1×10⁶ 76-9 rhabdomyosarcoma cells were re-suspended in equal volumes of PBS: Matrigel (Corning, Inc.) and were injected subcutaneously into the flanks of mice (35). On day 7 after tumor cell inoculation, tumor-bearing mice were randomly assigned into control (n=19), single-agent RCM-1 (n=12), venetocalx (n=12), or combination therapy (n=12) groups. RCM-1 encapsulated into nanoparticles was prepared as previously described (RCM-1 NP^FA) (20) and administered via tail vein injection every other day for a total of seven injections, using the half-maximal inhibitory concentrations (IC₅₀) dose of 8 μg. Venetoclax (100 mg/kg/dose) was administered via oral gavage 5 days a week for 2 weeks. Control mice were injected and orally given a vehicle control. Tumors were harvested on day 21. Mice were monitored for signs of distress and weighed every other day until day 21. Mice were euthanized using IP pentobarbital (100 mg/kg/dose) followed by cervical dislocation to ensure irreversible death (36,37). Tumors were measured using calipers and volumes were calculated in cubic millimeters using V= 0.5xLxW², where L was the tumor length and W was the tumor width.

To knockdown ATP2B4 in vitro, RMS cells were transfected with SMARTpool siRNA (Horizon Discovery; cat. no. L-066791-00-0010) and non-targeting siRNA pool as a control (Horizon Discovery; cat. no. D-001810-10) by using Dharmafect transfection reagent (Dharmacon, Inc.; Revvity, Inc.) as previously described (38). For stable knockdown of ATPase Plasma Membrane Ca²⁺ Transporting 4 (Atp2b4) in 76-9 cells, pre-packaged lentiviral particles containing ATP2B4 short hairpin (sh)RNA were purchased directly from Origene (cat. no. TL508592V; titer 4.8×10⁷ TU/ml). Wild-type (WT) 76-9 cells were transduced with two mouse lentiviral particles (C, D) at a multiplicity of infection (MOI=50) in the presence of 8 μg/ml polybrene, and incubated at 37°C overnight. Medium was replaced the following day, and cells were cultured for 48-72 h. GFP⁺ transfected cells were isolated by FACS. Briefly, cells were dissociated into a single-cell suspension, washed with PBS, resuspended in culture medium and filtered through a 40-μm cell strainer prior to sorting. GFP⁺ cells were gated based on unstained control cells and collected using a Sony SH800 cell sorter. FACS analysis was performed as previously prescribed (18). To knockdown FOXM1, 76-9 and RH-30 were transfected with pLKO-shFOXM1 plasmid DNA (clone ID: TRCN0000015546; MilliporeSigma) against FOXM1using TransIT-X2 (Mirus Bio, LLC; cat. no. MIR 6004). To overexpress ATP2B4a and ATP2B4b, 76-9 cells were transfected with CMV-ATP2B4a (Origene; cat. no. MC223809) and CMV-ATP2B4b (Origene; cat. no. MR215322) or an empty overexpression (OE) plasmid as a control. For both FOXM1 knockdown and ATP2B4 overexpression transfections performed using TransIT-X2, cells were plated at 8×10⁴ cells per well in a 24-well plate and transfected with 0.5 μg plasmid DNA premixed with 1.5 μl TransIT-X2, followed by incubation at 37°C for 24 h before subsequent selection or analysis. Sequences are listed in Table SI.

Control, siATP2B4 and pATP2B4 76-9 cells were seeded at a density of 1×10⁵ cells per 24 mm square coverslip in 6-well plates and allowed to grow for 48 h. Cells were then fixed in 4% paraformaldehyde at room temperature for 15 min, washed three times with PBS, and stained as previously described (20). Blocking was performed using 4% Normal Goat Serum (Jackson ImmunoResearch Labs; cat. no. 005-000-121) at room temperature for 3 h. Primary antibodies were incubated overnight at 4°C, followed by secondary antibody incubation at room temperature for 1 h, during which Hoechst 33342 (Invitrogen; Thermo Fisher Scientific, Inc.; cat. no. H3570) was included as a nuclear counterstain. For quantification, five random fields per sample were acquired at 20× magnification using the EVOS FL Auto 2 Cell Imaging System and EVOS imaging software (Thermo Fisher Scientific, Inc.). To perform immunostaining of tumor tissue, paraffin-embedded 76-9 subcutaneous tumor sections were stained as described previously (39). Briefly, tissues were fixed in 4% paraformaldehyde at 4°C overnight, dehydrated through graded ethanol and xylene, and embedded in paraffin at 60°C. Sections (5 μm) were deparaffinized, rehydrated, and subjected to antigen retrieval in citrate buffer (pH 6.0) at 95°C for 20 min. Slides were blocked with 4% Normal Goat Serum at room temperature for 1 h, incubated with primary antibodies overnight at 4°C, and then incubated with secondary antibodies at room temperature for 1 h with Hoechst 33342 included as a nuclear counterstain. Five random fields per sample were acquired and quantified using ImageJ, with imaging performed on the same EVOS FL Auto 2 platform. Antibodies used for immunostaining were anti-Ki-67 (1:250; Invitrogen, MA5-14520), anti-Cleaved-Caspase 3 (1:200; R&D, MAB835), anti-BAX (1:150; Santa Cruz, sc-7480), anti-ATP2B4 (1:200; Thermo Fisher Scientific, Inc.; cat. no. PA5-87634).

RNA was isolated using the RNeasy kit (Qiagen; cat. no.74104) and was subsequently reversed to cDNA using the iScript cDNA synthesis kit (Bio-Rad Laboratories, Inc.; cat. no.1708891). qPCR was carried out using TaqMan Gene Expression Assays (Applied Biosystems) according to the manufacturer's instructions. The thermal cycling conditions were: An initial hold at 50°C for 2 min, followed by 95°C for 10 min, and 45 cycles of 95°C for 15 sec and 60°C for 1 min (annealing/extension with data acquisition). Experiments were performed in triplicates, and relative gene expression was analyzed using the 2^−ΔΔCq method (40). Assay catalog numbers are provided in Table SII.

Control and small interfering (si)ATP2B4 knockdown 76-9 cells were seeded at 2,000 cells per well in 6-well culture plates and cultured in a 37°C, 5% CO₂ incubator. The culture medium was replaced every 2 days. After 6 and 9 days in culture, the cells were washed with Dulbecco's phosphate-buffered saline (DPBS), fixed with 4% paraformaldehyde (PFA) for 10 min at room temperature and then treated with 100% ice-cold methanol for 5 min to permeabilize the cells. Subsequently, the cells were stained with 0.5% crystal violet (dissolved in 25% methanol) for 10 min at room temperature. After staining, the crystal violet solution was removed and the cells were washed with DPBS at least twice to achieve a clear background. Representative images were captured and the crystal violet staining was quantified using ImageJ software (version 1.53e; National Institutes of Health).

Ibidi two-well culture inserts (Ibidi GmbH; cat. no.80209) were used for the experiment. A total of 4×10⁴ control or siATP2B4 knockdown 76-9 cells were seeded into the culture inserts and allowed to adhere overnight. Cells were maintained in complete growth medium. Afterward, the culture inserts were removed, creating open areas with clear edges. Images of these open areas were captured using the EVOS FL Auto 2 Cell Imaging System (Thermo Fisher Scientific, Inc.) at 0, 6 and 24 h using a light (phase-contrast) microscope, the EVOS FL Auto 2 Cell Imaging System (Thermo Fisher Scientific, Inc.). The images were analyzed using TScratch software (CSElab; ETH Zurich; version 1.0).

76-9 cells were transfected with siAtp2b4 or a non-targeting control (siNC) for 24 h, then stained with 5 μM Fura-2 AM (AAT Bioquest; cat. no. 21020) in a 37°C, 5% CO₂ incubator. After 30 min of incubation, the cells were rinsed with DPBS and images were captured using the EVOS FL Auto 2 Cell Imaging System (Thermo Fisher Scientific, Inc.).

Control, siATP2B4 and ATP2B4 overexpressed 76-9 cells were seeded in a 24-well plate at a density of 8×10⁴ cells/ml overnight and treated with venetoclax (5 and 8 μM) for 24 h. Then, apoptotic cells were assessed via Annexin V-iFluor 488 staining and Caspase 3 activity was measured using TF3-DEVD-FMK staining with the Cell Meter Live Cell Caspase 3/7 and Phosphatidylserine Detection Kit (AAT Bioquest; cat. no. 22850). Cells were incubated with Annexin V–iFluor 488 and TF3-DEVD-FMK at 37°C in a 5% CO₂ incubator for 1 h, followed by Hoechst staining at room temperature for 10 min. Fluorescence images were captured and analyzed using the EVOS FL Auto 2 Cell Imaging System (Thermo Fisher Scientific, Inc.). The apoptotic rate was calculated as the percentage of Annexin V-positive cells, including both early and late apoptotic populations, relative to the total number of Hoechst-positive cells.

RNA extracted from control and treated 76-9 cell line were sent to the CCHMC Genomics Sequencing Facility, Cincinnati, Ohio (USA) for sequencing. The quality of RNA was determined using a Fragment Analyzer with an average RNA Quality Number for all samples of 9.87. RNA libraries were prepared for all samples using Illumina Stranded total RNA Prep, Ligation with Ribo-Zero (Illumina, Inc.) to generate non-stranded RNA libraries. Sequencing was performed using NoveSeq6000 (Illumina, Inc.) with an estimated 30 million read per sample. Reads were aligned to the GRCm38 mouse genome and quantified using an index transcriptome version of GRCm38 using Kallisto and standard settings. This was performed by the CCHMC Genomics Sequencing Facility, Cincinnati, Ohio (USA). Raw counts were normalized using DESeq2 (41). Differential gene expression between conditions was performed using DEseq2, which uses a negative binomial model for each gene. The Wald test was used for hypothesis testing when comparing the two groups. All P-values attained were corrected for multiple testing using the Benjamini and Hochberg method, which is the default method in DESeq2. In the standard DESeq2 algorithm, the α for the false-discovery rate is set to 0.1 by default. Heatmap was generated using the pheatmap R package (version 1.0.12; https://cran.r-project.org/package=pheatmap) and the volcano plot was generated using the EnhancedVolcano R package (https://github.com/kevinblighe/EnhancedVolcano). Venn diagrams for differentially expressed genes were created using AltAnalyze (42). Gene list functional enrichment was created using TopGene Suite and graphed using sRplot (43,44).

The datasets GSE143704 (45) and GSE195709 (46) were obtained from the GEO database (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE143704 and https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE195709). The GSE143704 dataset contains muscle tissue cell populations from 10 healthy human donors, while the GSE195709 dataset includes rhabdomyosarcoma samples from 4 primary rhabdomyosarcoma patients. The datasets were both generated using the NextSeq 500 platform (Illumina, Inc.). Data analysis was performed using the Seurat R package (version 4.3.1; https://satijalab.org/seurat/). Cells with >100 genes detected or with a mitochondrial gene percentage >20% were excluded. The present study used the FindClusters and FindAllMarkers functions in Seurat to identify clusters for Smooth Muscle Cells (ACTA2), Skeletal Muscle (ACTA1) and Myoblasts (PAX7). These three clusters were then integrated with the scRNA-seq dataset of the 4 rhabdomyosarcoma samples using the SCTintegration function of the Seurat package. The cells were clustered using the FindClusters function and cluster visualization was performed using Uniform Manifold Approximation and Projection (UMAP). ATP2B4 expression levels were analyzed to generate a violin plot.

The human ATP2B4 promoter region spanning-373 to 0 bp was obtained from 293 genomic DNA through PCR amplification using the following primers (5'-3'): Forward: TGAGCAAGAGTCTGGCCCGGGGTACCCC; reverse: GGGGTACCCCGGGCCAGACTCTTGCTCA. This promoter region was then cloned into the KpnI site of the pGL4.23[luc2/minP] luciferase reporter plasmid (Promega Corporation). A Dual-Glo luciferase reporter assay was performed on 76-9 cells, which were co-transfected with the luciferase reporter, Renilla and either a CMV-empty or CMV-FOXM1 overexpression plasmid.

Data were expressed as mean ± SD. Statistical significance was determined using an unpaired Student's t-test, or one-way or two-way analysis of variance (ANOVA) followed by Tukey's multiple comparisons post hoc test, where appropriate. The in vivo experiment was a pilot study with no formal power calculation required and was analyzed in a blinded manner. All statistical analyses were obtained using GraphPad Prism (version 9.5.1; Dotmatics). P<0.05 was considered to indicate a statistically significant difference.

To establish the IC₅₀ of RCM-1 and venetoclax, mouse 76-9 and human RD rhabdomyosarcoma cell lines were treated with increasing doses of RCM-1 and venetoclax to generate a dose-response curve. The IC₅₀ of RCM-1 was 2.5 μM in RD cells and 1.37 μM in 76-9 cells, whereas venetoclax had higher IC₅₀ values of 9.4 μM in RD cells and 6.3 μM in 76-9 cells (Fig. S1A). Next, RMS cells were treated with either RCM-1 alone, venetoclax alone, or a combination of both agents sequentially. The combination therapy of RCM-1 and venetocalx reduced the number of viable tumor cells by 70% compared with 40-50% with single agents (Fig. 1A and B). Also, the CCK8 assay showed a significant reduction in RD, 76-9 and RH30 cell viability after RCM-1 and venetocalx treatment compared with a single agent or vehicle (Figs. S1B and C). Next, caspase 3/7 activity was assessed using Caspase-Glo^® 3/7 Assay kit. The combination therapy significantly increased apoptosis in RD, 76-9 and RH30 cells compared with single agents (Figs. 1C and S1C). Thus, the combination of RCM-1 and venetoclax inhibits RMS tumor cell growth and induces apoptosis more efficiently than either drug alone.

To verify that the efficacy of combination therapy is not limited to in vitro conditions, a mouse model of RMS was used. 76-9 RMS tumor cells were inoculated subcutaneously into the flanks of C57Bl/6J mice. The tumor-bearing mice were randomly assigned to 4 groups and were treated with either vehicle (control), venetoclax alone, IC₅₀ dose of nanoparticle-encapsulated RCM-1 alone, or a combination of both drugs (20) (Fig. 2A). Monotherapy with venetoclax did not have anti-tumor efficacy in the RMS mouse model (Fig. 2B), which is consistent with previously published studies (26,47) (Fig. 2B). Monotherapy with the IC₅₀ dose of RCM-1-NP^FA had only limited anti-tumor efficacy (Fig. 2B). However, the combination therapy efficiently reduced RMS tumor growth in a mouse model (Fig. 2B). The combination therapy effectively suppressed cell proliferation, as indicated by the decreased number of Ki-67 positive cells, and significantly promoted apoptosis, evidenced by the increased percentage of BAX and cleaved caspase-3 positive cells compared with single agents (Fig. 2C-E). The combination therapy was well tolerated in mice, with no observed weight loss throughout the experiment (Fig. S2A). Venetoclax-treated mice exhibited reduced white blood cell counts compared with controls (Fig. S2B), consistent with known myelosuppressive effects of venetoclax in humans. Importantly, the combination therapy did not induce liver dysfunction (Fig. SC). Thus, the combination of RCM-1-NP^FA and venetoclax efficiently inhibits tumor growth and is not toxic in the animal model of RMS.

To determine the molecular mechanism of increased apoptosis in the combination therapy, bulk RNA sequencing was performed to compare the transcriptome of untreated control and treated 76-9 RMS cells (Fig. 3A). The gene enrichment analysis of RMS cells treated with the combination therapy compared with venetoclax revealed an upregulation in multiple biologic pathways that are activated in cells under stress, such as ferroptosis, unfolded protein response and oxidative stress response. The cytosolic Ca²⁺ level pathway was significantly elevated in the combination therapy compared with venetoclax as well. The downregulated pathways included WNT signaling, mitotic cell cycle, hypoxia-inducible factor-1α signaling, Hippo signaling, TGF-β signaling, AKT-mTOR and FOXM1 network pathways, reflecting the role of RCM-1 in FOXM1 inhibition (Fig. 3B). A volcano plot was generated to visualize the most differentially expressed genes in combination therapy compared with venetoclax treatment (Fig. 3C). Atp2b4 was one of the most downregulated genes in the combination treatment. The decreased expression of Atp2b4 mRNA was confirmed using RT-qPCR, demonstrating that both RCM-1 treatment and combination therapy were sufficient to decrease the Atp2b4 mRNA level (Fig. 3D). Furthermore, using immunofluorescence staining, the present study showed that the protein level of ATP2B4 was also decreased in RMS tumors after RCM-1 or combination treatment (Fig. 3E).

Since it has been shown that ATP2B4, a calcium channel located on the plasma membrane, plays an important role in different cancers (48,49), the present study analyzed the publicly available sc-RNA genomic databases of human normal muscle tissue and RMS tumors (45,46) (Figs. S3A and 4A). Consistent with previously published data, Bcl2 was overexpressed in RMS (22,23) and CDKN1A (a cell cycle inhibitor) was overexpressed in normal muscle cells (Fig. S3B). Based on the sc-RNA seq analysis, the mRNA level of ATP2B4 was markedly higher in fusion-negative (RMS 1 and 3), fusion-positive (RMS 2) and spindle (RMS 4) rhabdomyosarcoma compared with normal human muscle cells, including skeletal muscle, smooth muscle cells and myoblasts (Fig. 4A). Also, ATP2B4 mRNA level was 3-4 fold higher in human RMS cell lines (RD and RH30) compared with normal skeletal muscle cells (HSkMC) (Fig. 4B). To determine the role of ATP2B4, 76-9 RMS cells were transfected with siRNA against Atp2b4, resulting in ~45% knockdown of Atp2b4 mRNA after 24 h and ~87% after 48 h (Fig. S4A; left panel). Immunostaining also demonstrated that the protein level of ATP2B4 was decreased 24 h after siATP2B4 transfection (Fig. S4A; right panel). Depletion of ATP2B4 increased the basal cytosolic Ca²⁺ level in RMS tumor cells (Fig. 4C), which is consistent with the upregulated signaling pathway related to cytosolic Ca²⁺ levels shown in RNA seq pathway analysis (Fig. 3B). Furthermore, depletion of ATP2B4 in rhabdomyosarcoma cells led to a time-dependent decrease in tumor cell proliferation, with a 40% reduction observed at 72 h as well as reduced colony formation and cell migration (Fig. 4D-F). Thus, ATP2B4 is differentially expressed in rhabdomyosarcoma cells and is essential for RMS cell proliferation and migration.

To determine whether ATP2B4 is important for venetoclax-induced apoptosis in rhabdomyosarcoma, the present study treated control and ATP2B4-depleted tumor cells with increasing doses of venetoclax. Using immunostaining with antibodies against caspase 3/7 (DEVD) and annexin V, it was shown that venetoclax induced a dose-dependent increase in apoptosis of control tumor cells (Fig. 5A and B). Moreover, the depletion of ATP2B4 in the siATP2B4-KD cells increased the efficacy of the same doses of venetoclax, which was demonstrated by a higher percentage of Annexin V-positive cells (10-35% in siATP2B4-KD vs. 1-18% in controls, P£0.0001) and DEVD-positive cells (10-40% vs. 1-20%, P<0.0001; Fig. 5A and B). Thus, depletion of ATP2B4 increases venetoclax-mediated apoptosis in 76-9 RMS cells.

As the depletion of ATP2B4 sensitized RMS cells to venetoclax-mediated apoptosis, the present study next determined whether overexpression of Atp2b4 would inhibit venetoclax-mediated apoptosis. ATP2B4 has 2 main isoforms, 4a and 4b, with isoform 4b being more predominant and active in different cancers (50). Therefore, the present study overexpressed Atp2b4a and Atp2b4b in 76-9 cells. The transfection efficiency was examined using RT-qPCR and immunofluorescence (Fig. S4B). The WT and pATP2B4 cells were treated with increasing doses of venetoclax. Overexpression of Atp2b4 markedly decreased cellular apoptosis after venetoclax treatment, measured by decreased caspase 3/7 (DEVD) positive cells (3-8% in pATP2B4 vs. 4-18% in controls, P≤0.0001) and decreased cellular death, measured by decreased annexin positive cells (3-8% in pATP2B4 vs. 2-18% in controls, P≤0.0001; Fig. 6A and B). Thus, increasing ATP2B4 levels induces RMS resistance to apoptosis and decreases the therapeutic effect of venetoclax in RMS cells.

As it is known that RCM-1 specifically inhibits FOXM1 and we have shown that RCM-1 decreases ATP2B4 in RMS (Fig. 3D-E), the present study next examined whether FOXM1 directly regulated ATP2B4 in RMS. Mouse RMS cells were transfected with control and shFoxm1. The shRNA-mediated knockdown of Foxm1 in 76-9 decreased expression of Atp2b4 mRNA (Fig. 7A). Similarly, shRNA-mediated knockdown of FOXM1 in human RH30 rhabdomyosarcoma cells also decreased the expression of ATP2B4 (Fig. 7B). Next, a publicly available ChIP-seq dataset from the ENCODE portal (51,52) was used and it was demonstrated that FOXM1 directly binds to the ATP2B4 promoter region in cancer cells (Fig. 7C). The FOXM1-binding region in the ATP2B4 promoter had H3K4me3 but not H3K27me3 marks, suggesting that FOXM1 activates the ATP2B4 gene promoter (Fig. 7C). To verify that FOXM1 activates ATP2B4 gene expression, the-373/+0 bp ATP2B4 promoter region, containing the FOXM1-binding site identified by ChIP-seq (Fig. 7C), was cloned into the pGL4.23 luciferase reporter plasmid (Fig. 7D). In co-transfection experiments using mouse RMS cells, the CMV-Foxm1 expression vector increased transcriptional activity of the-373/+0 bp ATP2B4 promoter region compared with CMV-empty vector (Fig. 7D). CMV-Foxm1 overexpression efficiency is shown in Fig. S5A. Thus, ATP2B4 is a direct transcriptional target of FOXM1 in rhabdomyosarcoma cells.

As the depletion of ATP2B4 sensitized RMS cells to venetoclax-mediated apoptosis in vitro, the present study next determined the role of ATP2B4 knockdown in rhabdomyosarcoma growth in an animal model. 76-9 cells with stable deletion of Atp2b4 were generated using shAtp2b4. GFP-positive cells were isolated by FACS, followed by clonal expansion. Knockout efficiency was evaluated by RT-qPCR, revealing that shAtp2b4 C and shAtp2b4 D achieved the most substantial reduction in ATP2B4 expression, with knockdown levels of approximately 70-80%. (Fig. S6A). shAtp2b4 and control cells were then both subcutaneously injected into C57BL/6J mice. Deletion of Atp2b4 decreased tumor growth and reduced final tumor volume compared with controls (Figs. 8A-C and S5B). RT-qPCR analysis of tumor-derived mRNA confirmed a knockdown efficiency of approximately 50% in the shAtp2b4 group (Fig. 8D). Immunostaining demonstrated that the protein level of ATP2B4 decreased in shAtp2b4 harboring tumors (Fig. S6B). Thus, efficient deletion of ATP2B4 inhibits RMS tumor growth in an animal model of RMS.