In the present study, Gene Expression Profiling Interactive Analysis (GEPIA; (http://gepia.cancer-pku.cn/)) was used to assess the differential expression of SNRPB between ESCC and matched healthy tissues (20). Transcriptome data and clinical information of 161 patients with esophageal cancer and 12 healthy esophageal tissue samples were downloaded from The Cancer Genome Atlas (TCGA; http://www.cancer.gov/ccg/research/genome-sequencing/tcga). Data were obtained from The Cancer Genome Atlas esophageal carcinoma (ESCA) cohort, which includes both esophageal squamous cell carcinoma (ESCC) and esophageal adenocarcinoma (EAC). The SNRPB mRNA expression matrix was extracted from the dataset for subsequent analysis. The association between the expression levels of SNRPB and the survival outcomes of patients with ESCC was assessed using Kaplan-Meier survival analysis. Univariate and multivariate Cox regression analyses were performed via the ‘survival’ R software package (version 3.8–3) (21) to explore the independent prognostic factors of patients with ESCC (21).

Samples of both neoplastic and pair-matched adjacent non-cancerous tissues, preserved in paraffin blocks, were collected from a cohort of 50 patients diagnosed with ESCC at the Affiliated Hospital of North Sichuan Medical College, Sichuan, China. The adjacent tissues were obtained from sites at least 5 cm away from the tumor margin and were histologically confirmed to be free of cancer cells by a certified pathologist. These patients received surgical interventions at the Affiliated Hospital of North Sichuan Medical College (Sichuan, China) from January 2019 to December 2021. The present study was approved by the Medical Ethics Committee of the Affiliated Hospital of North Sichuan Medical College, Sichuan, China (approval no. 2023ER344-1) and followed the guidelines outlined in the Declaration of Helsinki. As the present study was retrospective and patient data was anonymized, the Medical Ethics Committee of the Affiliated Hospital of North Sichuan Medical College waived the requirement for informed consent. In total, 50 patients with ESCC (median age, 60 years; range, 45–77; 38 men and 12 women) were included, with tumor stages I (n=15), II (n=9), III (n=22) and IV (n=4). Characteristics of the 50 patients are summarized in Table SI.

Inclusion criteria were as follows: i) Histologically confirmed primary ESCC; ii) a history of curative resection between January 2019 and December 2021; and iii) no history of neoadjuvant radiotherapy or chemotherapy prior to surgery. Patients were excluded from the present study according to the following criteria: i) Incomplete clinical or follow-up data; and ii) a history of other synchronous or metachronous malignant tumors.

Immunohistochemistry was performed to assess the expression of SNRPB in tissues. Tissue samples were formalin-fixed and paraffin-embedded, with 4-µm-thick serial sections prepared for staining. Permeabilization was not required for the staining procedure. Prior to antibody incubation, sections were blocked with 5% bovine serum albumin in phosphate-buffered saline (PBS) at room temperature for 1 h. The primary antibody against SNRPB (cat. no. 10278-1-AP; Proteintech Group, Inc.) was diluted at 1:100 and incubated with the sections at 4°C overnight (12 h). The secondary antibody used was HRP-conjugated goat anti-rabbit IgG (cat. no. SA00001-2; Proteintech Group, Inc.), diluted at 1:500 and incubated at room temperature for 1 h. All stained sections were observed and imaged using a Leica DM4 B upright light microscope (Leica Microsystems). To ensure the specificity and reliability of the staining, positive and negative controls were included in each staining batch. Colon cancer tissue sections, known to have high expression of SNRPB, were used as a positive control. For the negative control, the primary antibody was replaced with PBS. The immunoreactive score (IRS) scoring system was used to evaluate the expression of SNRPB (22).

ESCC cell lines, KYSE150, KYSE510, KYSE30 and KYSE410, were purchased from Saiku Biotechnology. All cell lines were cultivated in RPMI-1640 medium enriched with 10% fetal bovine serum, and maintained in an incubator at 37°C with 5% CO₂. After confirming the high expression of SNRPB in ESCC tissues (Fig. 1), western blot analysis was performed to detect its expression in ESCC cell lines, which showed markedly higher endogenous SNRPB levels in KYSE30 and KYSE510 cells compared to the other tested lines (Fig. 2A). These two cell lines were thus selected for subsequent functional knockdown experiments. ShRNA constructs were integrated into the hU6-MCS-CBh-gcGFP-IRES-puromycin vector, and lentiviral particles with a titer of 1×10⁸ TU/ml were used for transduction; 2 µl of lentiviral particles were added per well in a 6-well plate, combined with HiTransG A Lentiviral Transduction Reagent (GeneChem, Inc.). The transfection was performed at 37°C with 5% CO₂ for 8 h, and all subsequent functional assays were conducted at a 48 h time interval post-transfection. The lentiviral infection was performed at a multiplicity of infection of 10, which was determined as optimal in preliminary experiments to achieve high transduction efficiency with minimal cytotoxicity. Design and production of lentiviral constructs were carried out by Shanghai GeneChem Co., Ltd. All procedures involving lentiviral particles were performed in a Biosafety Level 2 (BSL-2) containment facility. The specific shRNA sequences used for SNRPB knockdown were as follows: shSNRPB#1, CCACAAGGAAGAGGTACTGTT; shSNRPB#2, CCTCCCAAAGATACTGGTATT; and shSNRPB#3, GCAGCATATTGATTACAGGAT. The sequence for the negative control (NC) was as follows: shNC, TTCTCCGAACGTGTCACGT.

Following transfection with shSNRPB#1, KYSE 30 and KYSE 510 cells were maintained in RPMI-1640 medium with 10% fetal bovine serum at 37°C with 5% CO₂ for 12 days post-transfection, with the medium replaced every three days and no additional drug treatment applied in this experiment. Subsequently, cells were digested to prepare single-cell suspensions, and 1,000 cells per well were inoculated in 6-well plates, with control cells treated with a blank vector. After ~10 days, colonies were fixed with 4% paraformaldehyde at room temperature for 15 min, then stained with 0.1% crystal violet solution at room temperature for 20 min. Colonies containing >50 cells were counted to calculate the clonogenic survival rate. Colony counting was performed manually by two independent investigators who were blinded to the experimental group assignments.

SNRPB-knockdown KYSE30 and KYSE510 cells (transfected with shSNRPB#1) and negative control cells (transfected with shNC) were used for this assay, and analysis was performed 48 h after lentiviral transfection (consistent with the time interval for other subsequent functional experiments). For sample preparation, the cells were harvested by trypsinization with 0.25% trypsin-EDTA (Gibco; Thermo Fisher Scientific, Inc.), washed twice with pre-chilled PBS, and fixed with 70% cold ethanol at 4°C for 24 h for cell cycle arrest. A Cell Cycle Detection kit (Nanjing KeyGen Biotech Co., Ltd.) was then used to assess cell cycle distribution according to the manufacturer's protocol. Analysis was conducted via a NovoCyte flow cytometer (NovoCyte 3130; ACEA Biosciences, Inc.), which allowed precise cell cycle phase determination.

SNRPB-knockdown KYSE30 and KYSE510 cells (transfected with shSNRPB#1) and negative control cells (transfected with shNC) were used for this assay. For apoptosis analysis, the Annexin V-APC/PI Apoptosis Detection kit (cat. no. KGA1030-100; Nanjing KeyGen Biotech Co., Ltd.) was utilized according to the manufacturer's protocol. A NovoCyte flow cytometer (ACEA Biosciences, Inc.) was used to quantify the proportion of apoptotic cells.

Intracellular proteins were obtained by lysing SNRPB-knockdown and negative control KYSE30 and KYSE510 cells using RIPA buffer (Beijing Applygen Technologies Inc.), with the addition of phosphatase inhibitors. Total proteins were quantified using a BCA Protein Assay Kit (Beyotime Biotechnology) to determine the concentration, and 30 µg of total protein was loaded into each lane for separation by SDS-PAGE on a 12% gel and transferred onto a PVDF membrane (Sigma-Aldrich; Merck KGaA). Membranes were subsequently blocked with a solution containing 5% skimmed milk powder (Beyotime Biotechnology) for 2 h at room temperature. Following blocking, membranes were incubated with the following primary antibodies overnight at 4°C: Anti-SNRPB (cat. no. FNab08070; 1:1,000; FineTest), anti-GAPDH (cat. no. EM1101; 1:50,000; HUABIO), anti-CDK1 (cat. no. ET1607-54; 1:1,000; HUABIO), anti-CCNA2 (cat. no. : ET1612-26; 1:1,000; HUABIO), anti-BAX (cat. no. ET1603-34; 1:5,000; HUABIO) and anti-Bcl-2 (cat. no. : HA721235; 1:2,000; HUABIO). Following primary incubation, membranes were incubated with a secondary antibody (cat. no. FNSA-0004; 1:5,000; FineTest, goat anti-rabbit IgG HRP-conjugated) for 1 h at room temperature. Protein bands were visualized using a ChemiDoc™ XRS+ system (Universal Hood II; Bio-Rad Laboratories, Inc.). Protein expression was quantified using ImageJ software (version 1.54f; National Institutes of Health) with GAPDH serving as the loading control.

R software (version, 4.2.2; Foundation for Statistical Computing) and GraphPad Prism 8 (Dotmatics) were used for data analysis and visualization. Differences between two groups were evaluated using paired or unpaired Student's t tests for pairwise comparisons of independent or matched samples (specified in corresponding figure legends). One-way ANOVA followed by Dunnett's post hoc test was used for multiple group comparisons. The associations between SNRPB expression and clinicopathological characteristics were assessed using the chi-square (χ²) test for variables meeting the expected count assumption; Fisher's exact test (or the Freeman-Halton extension for >2×2 contingency tables) was used for Histological grade, Location and M stage (23). Cox regression analysis identified independent prognostic factors for esophageal cancer. P<0.05 was considered to indicate a statistically significant difference. All in vitro experiments were performed in triplicate, as independent biological replicates.

Online analysis using the GEPIA database confirmed the overexpression of SNRPB in esophageal cancer tissues compared with normal tissues (Fig. 1A). Survival analysis revealed a significant correlation between high SNRPB expression and reduced overall survival [hazard ratio (HR), 1.98; 95% confidence interval (CI), 1.17–3.34; P=0.009], as shown in Fig. 1B. Both univariate and multivariate analyses further demonstrated the prognostic value of SNRPB expression levels, along with tumor stage, in predicting patient outcomes (P<0.05 for both; Fig. 1C and D).

Immunohistochemical analysis further corroborated these findings, revealing elevated SNRPB protein expression levels in ESCC tissues (Fig. 1E). The IRS for SNRPB was significantly greater in tumor tissues when compared with that in adjacent non-cancerous tissues (P=0.012; Fig. 1F; paired Student's t test). Thus, results of the present study suggested that SNRPB expression may be associated with the clinicopathological features of patients with ESCC. A retrospective analysis of clinical data obtained from a cohort of 50 patients diagnosed with ESCC was conducted. The cohort comprised 38 male (76%) and 12 female (24%) patients, with a median age of 60 years (range, 45–77 years). Participants were divided into two groups, ‘low’ and ‘high’ expression, according to the median IRS for SNRPB obtained through immunohistochemical analysis. The full clinicopathological characteristics are detailed in Table I.

Specifically, individuals with an IRS ≤3.33 were placed in the low-expression category, and those individuals with an IRS >3.33 were placed in the high-expression category. The associations between SNRPB expression levels and a range of clinical characteristics were evaluated using a χ² test. This analysis revealed a statistically significant correlation between high SNRPB protein expression and advanced T stage in patients with ESCC (P=0.025; Table I).

To further investigate the impact of SNRPB on the biological behaviors of ESCC, previous research (13–15) has established SNRPB as a significant prognostic gene in multiple human malignancies. The expression levels of SNRPB were assessed in four ESCC cell lines, KYSE150, KYSE510, KYSE30 and KYSE410. Results of the western blot analysis revealed notably high SNRPB expression levels in KYSE30 and KYSE510 cell lines compared with KYSE150 and KYSE410 cells (Fig. 2A). Consequently, these two cell lines were selected for SNRPB knockdown. In total, three distinct shRNAs targeting SNRPB, shSNRPB#1, shSNRPB#2 and shSNRPB#3, were transfected into KYSE30 and KYSE510 cells. Moreover, western blot analysis was performed to determine knockdown efficiency, and the results demonstrated that shSNRPB#1 exhibited the highest level of knockdown efficiency compared with shSNRPB#2, shSNRPB#3 and shNC (Fig. 2B). Thus, shSNRPB1#1 shRNA was selected for use in subsequent experiments. As previous findings revealed that SNRPB expression was associated with tumor T stage (13,15,24,25), a colony formation assay was performed to assess the impact of SNRPB knockdown on the proliferation of cells. Based on three independent experiments, the results indicated that SNRPB knockdown markedly reduced colony formation capacity. Specifically, the number of colonies was significantly lower in the knockdown group compared with the shNC control group (Fig. 2C and D).

To further elucidate the impact of SNRPB on the growth of ESCC cells, cell cycle analysis was conducted using KYSE30 and KYSE510 cell lines. Analysis suggested cell cycle arrest as flow cytometry analysis demonstrated that SNRPB knockdown increased the percentage of cells arrested in the G2/M phase from 12.3 to 28.7% in KYSE30 cells and from 10.5 to 25.2% in KYSE510 cells (Fig. 3A). To investigate the molecular mechanism underlying this arrest, western blot analysis was performed, which revealed that SNRPB knockdown led to significant reductions in the expression levels of Cyclin A2 and CDK1 in both KYSE30 and KYSE510 cell lines compared with the shNC group (KYSE30-CDK1, P<0.01; KYSE30-CCNA2, P<0.01; KYSE510-CDK1, P<0.01; KYSE510-CCNA2, P<0.01; one-way ANOVA followed by Dunnett's post hoc test; Fig. 3B and C).

The potential effects of SNRPB knockdown on apoptosis were determined in KYSE30 and KYSE510 cell lines. Results of the present study revealed a significant increase in the percentage of apoptotic cells in the SNRPB knockdown cells compared with shNC in both cell lines (Fig. 4A). As shown in Fig. 4A, flow cytometry analysis revealed that SNRPB knockdown led to a significant increase in the percentage of apoptotic cells in both KYSE30 and KYSE510 cell lines (KYSE30, P<0.001; KYSE510, P<0.001; determined by one-way ANOVA followed by Dunnett's post hoc test). To explore the molecular basis for this pro-apoptotic effect, the expression levels of key apoptosis-regulating proteins, Bax and Bcl-2, were determined by western blot analysis. Results of the present study revealed that shSNRPB1#1 shRNA-mediated SNRPB knockdown led to significant upregulation of Bax and significant downregulation of Bcl-2 protein expression levels, compared with those in the shNC group (KYSE30-Bax, P<0.001; KYSE30-Bcl-2, P<0.001; KYSE510-Bax, P<0.001; KYSE510-Bcl-2, P<0.001; one-way ANOVA followed by Dunnett's post hoc test; Fig. 4B and C).