The present study employed a case-control design and included 100 patients with RA, of whom 50% were smokers, diagnosed according to the criteria of the American College of Rheumatology (14). The patient cohort comprised 25 males and 75 females, with an age range of 20-70 years. Cases were recruited from the Rheumatology Consultation Clinic at Baghdad Teaching Hospital/Medical City, Baghdad, Iraq.

The control group consisted of 50 healthy individuals confirmed by a clinical examination and laboratory investigations, with smokers representing 50% of the group. Patients with comorbidities, other connective tissue diseases, spondylitis, malignancies or pregnancy were excluded from the study.

A total of 75 patients were receiving therapy with methotrexate and enbrel. The study protocol was approved by the Scientific Ethics Committee of the College of Science, University of Baghdad, as part of a PhD research plan. Informed consent was obtained from all participants, both verbally and in writing, prior to enrollment in the study.

Blood sample collection was conducted from early November, 2023 to the end of March, 2024. Laboratory diagnostic investigations were performed using enzyme-linked immunosorbent assay (ELISA) to measure serum RF levels (Rheumatoid Factor Screen, quant. 96; cat. no. R97422, Dialab GmbH; positive result >25 U/ml) and ACCP antibodies (cat. no. 0323/VER-03, Qualisa; positive result, >25 U/ml). Disease Activity Score-28 (DAS-28) values were assessed by a specialist physician (Rheumatology and medical rehabilitation) and were used to evaluate the clinical severity of the disease (15).

Total RNA was extracted from the peripheral blood samples obtained from the patients with RA and the healthy controls using the TRIzol^™ reagent extraction kit (cat. no. ER501-01-01, TransGen Biotech) following the manufacturer's protocol. Complementary DNA (cDNA) was synthesized from total mRNA using the EasyScript One-Step gDNA Removal and cDNA Synthesis SuperMix kit (cat. no. AE311-04, TransGen Biotech). The reverse transcription reaction was performed in a final volume of 20 µl under the following thermocycler conditions: One cycle of primer annealing at 25˚C for 10 min, reverse transcription at 42˚C for 15 min, and reverse transcriptase inactivation at 85˚C for 5 sec. Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) was performed using gene-specific primers for HLA-DRB1 gene (forward, ACAACTACGGGGTTGTGGAG; and reverse, CGTTCAGGAACCACCTGACT). GAPDH was used as the housekeeping gene (forward, GAAATCCCATCACCATCTTCCAGG; reverse, GAGCCCCAGCCTTCTCCATG). Each reaction was carried out in a final volume of 20 µl containing a cDNA template, primer, SYBR-Green Master Mix and nuclease-free water. Thermal cycling conditions included one cycle of initial denaturation at 94˚C for 10 min, followed by 45 cycles of denaturation at 94˚C for 20 sec and annealing at 60˚C for 30 sec. A final melting-curve stage was conducted at 55˚C for 20 min. Melting-curve analysis was performed to confirm amplification specificity. Relative gene expression levels were calculated using the folding method (2^-∆∆Cq) with normalization to the housekeeping gene (16).

For HLA-DRB1*04 typing, a specific PCR technique was performed using allele-specific primers for HLA-DRB1*04, following the protocol described in the study by Parasannanavar et al (17), including a reverse primer (TCTCGGTAAGTCTGTGCCTT) and two forward primers (forward 1, GCTACGTGGACGACACGCT; forward 2, CTCGGTCAGTCTGTGCCTT); HGH was used as the control primer (forward, TGCCTTCCCAACCATTCCCTTA; reverse, CCACTCACGGATTTCTGTTGTGTTTC). This method was selected due to its high sensitivity and specificity (100%) in identifying theHLA-DRB1*04 allele, as validated against commercial PCR-SSOP kits in the source (14). To ensure this high level of accuracy and specificity in the clinical samples, the present study strictly adhered to the optimized concentrations and thermal cycling parameters, particularly the annealing temperature of 65˚C, as described in the original protocol. The specificity of the results was further confirmed by electrophoresis, demonstrating distinct target bands without non-specific amplification, as presented in Fig. 1. Genomic DNA was extracted from peripheral blood leukocytes (EDTA-anticoagulated samples) using the AddPrep Genomic DNA Extraction kit (cat. no. 100-002, Biotech Ltd.). PCR amplification was performed in a total reaction volume of 25 µl containing extracted DNA, primers and PCR premix. Amplification was carried out u sing a G-Storm thermal cycler (Gene Technologies Ltd.) under the following conditions: An initial denaturation at 94˚C for 5 min; 30 cycles of denaturation at 94˚C for 1 min, annealing at 65˚C for 2 min, and extension at 72˚C for 1 min; followed by a final extension at 72˚C for 10 min. The amplified PCR products (5 µl) and a 100 bp DNA ladder (molecular weight marker) were separated by electrophoresis on a 2% agarose gel (Promega Corporation) stained with ethidium bromide (MilliporeSigma) for 20 min at room temperature.

Statistical analysis was performed using SPSS software (version 20; IBM Corp.). Continuous variables with normal distribution are expressed as the mean ± standard deviation (SD). A one-way analysis of variance (ANOVA) and Tukey's post hoc test were performed to compare the mean levels of gene expression, autoantibodies and disease activity score across multiple patient groups and controls. A P-value <0.05 was considered to indicate a statistically significant difference, while a P-value <0.01 was considered to indicate a highly significant difference (18).

The general and clinical findings of 100 patients with RA estimated according to the American College of Rheumatology (ACR) criteria are presented in Table I. The mean age of the patients with RA was 53.34±12.23 years, and the mean age of the healthy controls was 43.06±10.78 years; the mean disease duration was 4.3±0.42 years and the mean disease activity (DAS-28) was 4.1±0.8.

Gene expression analyses revealed different levels of the HLA-DRB1 gene, ranging from 0.72-18.26 in patients and 0.21-1.98 in the controls. Accordingly, the results revealed the positivity percentage of the HLA-DRB1 gene as 64% in the patients and 16% in the controls (Table II).

Positive HLA-DRB1*04allele was recorded in 19 patients who were smokers, and 13 patients who were non-smokers (total, 32% of 100 patients with RA), while the healthy controls recorded 3 patients positive for the HLA-DRB1*04 allele in smokers only (total, 6%) (Tables III and IV).

The results demonstrated a significant association between the presence of the HLA-DRB1*04 allele, and increased levels of HLA-DRB1gene expression, and ACCP and RF levels in patients with RA compared with the controls. Among the smokers, the HLA-DRB1*04-positive patients exhibited significantly higher gene expression levels (4.46±4.2 vs. 1.2±0.0 fold), ACCP levels (77.54±24.6 vs. 24.4±0.86 U/ml) and RF levels (138.48±140.1 vs. 24.83±0.15 U/ml) compared with theHLA-DRB1*04-positive controls (P=0.001), as shown in Table III and Fig. 2.

Similarly, the HLA-DRB1*04-negative patients who were smokers exhibited significantly higher gene expression levels (1.95±1.35 vs. 0.75±0.5 fold), ACCP levels (63.04±22.9 vs. 7.6±1.7 U/ml) and RF levels (76.12±86.6 vs. 17.2±4.3 U/ml) compared with the controls (P=0.001), as demonstrated in Table III and Fig. 2.

HLA-DRB1*04-positive patients who were non-smokers exhibited significantly higher Gene expression levels (1.75±0.82 vs. 0.4±0.0 fold), anti-CCP levels (65.71±36.22 vs. 8.28±3.98 U/ml), and RF levels (85.43±124.1 vs. 10.18±5.86 U/ml) compared with controls, (P=0.001), as shown in Table IV and Fig. 3.

Likewise, in the HLA-DRB1*04-negative non-smoker patients exhibited significantly higher gene expression levels (1.43±1.11 vs. 0.4±0.0 fold), ACCP levels (58.32±20.2 vs. 8.2±3.9 U/ml) and RF levels (44.39±24.4 vs. 10.1±5.8 U/ml) compared with the controls (P=0.001), as demonstrated in Table IV and Fig. 3.

As presented in Table V and Fig. 4, patients with RA carrying the HLA-DRB1*04 allele who were smokers exhibited significantly higher HLA-DRB1 gene expression levels (4.46±4.2 vs. 1.75±0.82-fold, P=0.02), ACCP levels (77.54±24.6 vs. 65.71±36.22 U/ml, P=0.04) and RF levels (138.48±140.1 vs. 85.43±124.1 U/ml, P=0.01) compared with non-smokers.

The effects of cigarette smoke on the levels of HLA-DRB1 gene expression, and ACCP and RF levels in HLA-DRB1*04 allele-negative patients are demonstrated in Table VI and Fig. 5. The levels of the three parameters were significantly higher in the smokers than in the non-smokers (HLA-DRB1 gene: 1.95±1.2 vs. 1.43±1.1 fold, P=0.05; ACCP: 63.04±22.9 vs. 58.32±20.2 U/ml, P=0.05; and RF, 76.12±86.6 vs. 44.39±24.4 U/ml, P=0.04, respectively).

Regardless of disease severity, the highest DAS-28 values were observed in the HLA-DRB1*04-positive patients who were smokers (4.52±0.9); these values were significantly higher compared to those in the HLA-DRB1*04-negative patients who were non-smokers (3.8±1.02; P=0.04). Conversely, no statistically significant difference was found when comparing HLA-DRB1*04-negative patients who were smokers (4.18±0.8) with the HLA-DRB1*04-positive patients who were non-smokers (4.02±0.85; P>0.05) (Table VII and Fig. 6).

In the present study, SE-positive patients who were smokers had higher ACCP levels than SE-positive patients who were non-smokers; SE-negative patients who were smokers had higher levels ACCP than those who were non-smokers (P≤0.05) (Tables V and VI, and Figs. 4 and 5). A large US study indicated that the degree of smoking exposure is crucial in supporting the function of SE-smoking interaction (34). It has been mentioned that tobacco exposure increases the risk factor for ACCP antibodies only in SE-positive patients with RA and is not observed in undifferentiated arthritis (35).

In present study, the larger percentage of patients developed RA with no genetic or familial susceptibility. Although RA susceptibility is genetically defined, it has been proposed that non-genetic (i.e., environmental), epigenetic, or post-translational processes may be responsible for the onset of the illness (36). Cigarette smoking and HLA-DRB1SE alleles have been shown to interact strongly, which aids in the development of ACCP positive RA (4). High levels of both ACCP and RF may be linked to smoking. Notably, herein, RF levels were increased in all patients, although the effect of smoking on ACCP levels was only observed in those with SE alleles. Quitting smoking prior to the onset of RA reduces the chance of future ACCP-positive disease (37).

In the present study, HLA-DRB1*04 positive patients who were smokers had higher RF levels than HLA-DRB1*04-positive non-smokers; HLA-DRB1*04-negative patients who were smokers had higher RF levels than non-smokers (P≤0.05). It has been shown that smokers have increased levels of RF and are more prone to developing RA (13). Both current and former smokers have an increased prevalence of developing elevated RF levels compared to non-smokers, and the proportion of smokers increases with increasing RF titers (35).

The risk of developing RA increases with cigarette smoking, which may also have a dose-dependent negative effect on the severity of RA. Tobacco smoke exposure is associated with RF positivity among subjects without RA, by increasing RF levels and altering immune function both in the lungs and systemically; smoking may have a biological link on the course of RA illness; thus, cigarette smoke has a marked effect on the development and severity of RA (38).

The present study demonstrated (Table VII and Fig. 6) the DAS-28 values in relation to both risk factors cigarette smoke and genetic susceptibility. The analysis of the results revealed that the DAS-28 value of HLA-DRB1*04-positive smokers differed significantly with that of HLA-DRB1*04-negative non-smokers (P≤0.05); no significant difference was observed between the DAS-28 values of HLA-DRB1*04-negative smokers and HLA-DRB1*04-positive non-smokers. The results of the present study demonstrated that the effect of cigarette smoke as a single risk factor is equipotent to the presence of the SE allele alone, which reflects the importance of the smoking-HLA-DRB1*04 interaction in the adverse progression of RA (35). The highest DAS-28 value (4.52±0.9) was associated with the highest ACCP level (77.54±24.6 U/ml), a strong association of HLA-DRB1*04 with anti-CCP positivity, and disease activity was recorded in patients with RA (30).

The present study had certain limitations which should be mentioned. The sample size was relatively modest, particularly in the HLA-DRB104-positive control group, which may have limited the statistical power and generalizability. In addition, the cross-sectional study design precluded the assessment of causal associations between smoking, HLA-DRB1*04 allele status and RA severity.

Furthermore, the majority of patients were receiving antirheumatic treatment at the time of sampling, which may have influenced autoantibody levels, gene expression and DAS-28 scores. Environmental and lifestyle factors other than smoking were not fully controlled. Finally, the genetic analysis was limited to the HLA-DRB1*04 allele and did not include other SE alleles or gene-gene interactions. Further longitudinal studies with larger cohorts and expanded genetic analyses are warranted.

In conclusion, cigarette smoking, as an independent risk factor, exerts an effect comparable to that of the SE-positive allele. However, the interaction between cigarette smoking and SE positivity produces the greatest severity of RA. The highest levels of ACCP antibodies were observed in patients who were smokers carrying SE-positive alleles. These findings highlight the critical importance of integrating genetic screening strategies with robust smoking cessation programs for individuals at elevated risk. Further studies are required to explore the molecular pathways via which smoking interacts with particular common epitope alleles in the Iraqi population.