Tumor and adjacent normal tissues (>3 cm away from the edge of the tumor lesion) were collected from patients with lung cancer at the Department of Thoracic Surgery, Nanjing Chest Hospital (Jiangsu, China) between January 1, 2023, and May 31, 2023. Of the 68 patients, 32 were male and 36 were female; patient ages ranged from 46–84 years, with a median age of 65.5 years. The histological types, staging, treatment status and other information for the 68 paired patient samples are shown in Table SI. Informed consent was obtained from all participants. The study received approval from the Institutional Review Board of Nanjing Chest Hospital (approval no. 2023-KL034-01) and complied with all relevant ethical guidelines.

Inclusion criteria for the 68 patients were: i) Age range 18–84 years; ii) initial diagnosis of lung cancer (no particular pathogenic type indicated); iii) no prior antineoplastic therapy prior to surgical intervention; iv) good surgical tolerance with no contraindications; v) capable of regular follow-up. Patient samples that did not meet the aforementioned criteria were not be included in any experiments described in this manuscript.

Tissue specimens were embedded in a preheated embedding station with the desired sectioning orientation, subsequently demolded and excess paraffin trimmed off. Paraffin-embedded specimens were sectioned to a thickness of 3 µm. Sections were dewaxed in xylene and sequentially rehydrated through graded ethanol (100, 95 and 75%; 1 min each), followed by rinsing in distilled water for 5 min. Endogenous peroxidase activity was subsequently quenched by incubation with 3% H₂O₂ at room temperature for 10 min. Subsequently, antigen retrieval was performed using citrate buffer in a microwave. The sections were blocked with Immunol Staining Blocking Buffer (Beyotime Biotechnology; cat. no. P0102) at room temperature for 60 min. Samples were incubated overnight at 4°C with diluted anti-CD68 primary antibody (Abmart Pharmaceutical Technology Co., Ltd.; cat. no. MN50019S; 1:100-1:200). The following day, The sections were incubated with HRP-labeled Goat Anti-Rabbit IgG(H+L) (Beyotime Biotechnology; cat. no. A0208, 1:250) at 37°C for 60 min. The sections were subsequently incubated with DAB working solution (Dako; Agilent Technologies, Inc.) and monitored microscopically until optimal color development was achieved, followed by immediate rinsing in deionized water. Nuclear counterstaining was performed with Mayer's hematoxylin at 37°C for 1 min. The slides were then dehydrated in absolute ethanol for 10 sec, air-dried at 55–60°C and mounted with neutral balsam. The stained sections were finally examined under a light microscope (Carl Zeiss AG).

Tissue samples were processed in liquid nitrogen, minced, and ground into a fine powder. Total RNA extraction from tissues was performed using the FastPure Cell/Tissue Total RNA Isolation Kit V2, while RNA from cultured cells was extracted using the RNA Extraction Kit. cDNA synthesis utilized the HIScript III RT SuperMix qPCR Kit (+gDNA Wiper), and quantitative PCR (RT-qPCR) was conducted with ChamQ Universal SYBR qPCR Master Mix. Primers were designed and synthesized by Nanjing Punoen Biological Co., Ltd. The primer sequences are listed in Table SII.

Human lung cancer cell lines A549 and H460 were obtained from Nanjing Punoen Biological Co., Ltd. Cells were cultured in DMEM supplemented with 10% fetal bovine serum (FBS; Gibco; Thermo Fisher Scientific, Inc.) and 1% penicillin/streptomycin. Cells were passaged when reaching ~80% confluence.

THP-1 cells (Nanjing Punoen Biological Co., Ltd.) were seeded in 6-well plates and cultured with 100 nM PMA for 48 h at 37°C with 5% CO₂. Cells were then incubated with fresh medium (without PMA) for 24 h to establish M0 macrophages. M0 macrophages were subsequently cultured in fresh medium containing polarizing factors (25 ng/ml each of IL-4 and IL-13) for 48 h to obtain M2-like macrophages.

The harvested M0 and M2 macrophages were washed twice with PBS and centrifuged (200 × g) at 37°C for 5 min. Cells were incubated in Fixation/Permeabilization solution (Becton, Dickinson and Company; cat. no. 554722) at room temperature for 20 min, followed by centrifugation (200 × g) at 37°C for 5 min. Cells underwent two washes with 1X Perm/Wash Buffer (Beyotime Biotechnology), followed by centrifugation (200 × g) at 37°C for 5 min. Subsequently, 1×10⁶ cells per tube were incubated with PE anti-CD206 antibody (Fine Test; cat. no. PE-30095) at room temperature in the dark for 30 min. Cells were again washed twice with 1X Perm/Wash Buffer, resuspended in PBS, and analyzed by flow cytometry (CytoFLEX S; Beckman Coulter, Inc.). Flow cytometry data were analyzed using FlowJo software (version 10.8.1; BD Biosciences).

Lung cancer cells were seeded at 1,500 cells per well in 96-well plates with 100 µl complete medium. After cell adhesion, five replicates per group were set up. At days 1, 2, 3 and 4, 10 µl CCK-8 solution was added per well, followed by incubation at 37°C with 5% CO₂ for 2 h. Absorbance (OD) was measured at 450 nm using a microplate reader, and proliferation curves were plotted.

Cells were diluted to 1,000 cells/ml in complete medium and seeded evenly in 6-well plates. After 4–6 h incubation at 37°C and 5% CO₂ for cell adherence, experimental groups were treated according to the study design and control groups received an equivalent solvent volume. Cells were cultured for 14 days or until the majority of single-cell-derived clones contained >50 cells, with 1 ml medium replaced every 3 days. Following medium removal, plates were washed with PBS, and cells were fixed with 1 ml methanol for 15 min. After fixation, cells were stained with 0.5% crystal violet solution (1 ml per well) for 10 min at room temperature. Excess dye was rinsed with running water, plates were air-dried, and colony numbers were quantified microscopically using image analysis.

Lung cancer cells (5×10⁴ cells per well) suspended in serum-free medium were seeded in the upper chamber (Corning, Inc.). Medium containing 10% FBS was added to the lower chamber. After 24–72 h incubation, non-migrating cells in the upper chamber were removed. At room temperature, cells adhering to the lower chamber were fixed with 4% paraformaldehyde for 30 min, stained with Crystal Violet staining solution for 6 min and quantified through inverted fluorescence microscope (IX83; Olympus Corporation) and image analysis (GraphPad Prism 9.0; Dotmatics).

Matrigel was diluted 1:15 in serum-free medium. A total of 100 µl was added to the upper chamber (Corning, Inc.) and incubated at 37°C in a cell culture hood overnight. Excess medium was aspirated before use. Lung cancer cells (8×10⁴ cells per well) suspended in serum-free medium were seeded in the upper chamber. Medium containing 10% FBS was added to the lower chamber. After 24–72 h incubation, non-migrating cells in the upper chamber were removed. At room temperature, cells adhering to the lower chamber were fixed with 4% paraformaldehyde for 30 min, stained with Crystal Violet staining solution for 6 min and quantified through inverted fluorescence microscopy (OLYMPUS IX83) and image analysis (GraphPad Prism 9.0).

Animal experiments were approved by the Animal Ethics Committee of Jiangnan University [approval no. JN.No20241230b0200211(715)]. Male C57BL/6 and BALB/c nude mice (6–8 weeks old; n=25) were purchased from Shanghai Nanfang Model Biotechnology Co., Ltd., and housed under pathogen-free conditions at 21–26°C and 50–60% relative humidity, with a 12-h light/dark cycle (15–20 lux). After a one-week acclimation, mice were randomly assigned to experimental groups.

Lung cancer cells in logarithmic growth were harvested, centrifuged (200 × g) at 37°C for 5 min, and resuspended in a 1:1 mixture of culture medium and Matrigel at a concentration of 1×10⁶ cells/100 µl. Cell suspensions were injected subcutaneously into the axillary region of mice. Tumor volumes were measured at 7, 14, 21 and 28 days post-inoculation. At study termination, mice were sacrificed, tumors excised, images captured and the tumors fixed in 4% paraformaldehyde for 24 h. Maximum tumor diameter was 0.99 cm, and maximum tumor volume was 395 mm³.

The specific sacrifice procedure for mice was as follows: Mice were administered an intraperitoneal injection of pentobarbital sodium (150 mg/kg). Following injection, respiratory movements were continuously monitored. At two min after the cessation of respiration, the cornea was gently touched to assess the absence of the blink reflex. Mortality was subsequently confirmed by cervical dislocation as a secondary verification measure.

After successful polarization of M0 and M2-like macrophages, cells were incubated in serum-free RPMI-1640 medium for 24 h at 37°C. Culture supernatants were collected, and exosomes were isolated by ultracentrifugation at 4°C as follows: 1,000 × g for 10 min, 3,000 × g for 30 min, and 10,000 × g for 60 min. Supernatants were then filtered through a 0.22 µm membrane and ultracentrifuged at 100,000 × g for 2 h. Pelleted exosomes were resuspended in PBS and stored at −80°C.

Specimens were applied to copper grids (Beijing Zhongjixinke Scientific Instrument Co., Ltd.; cat. no. AZH200), allowed to adsorb onto the grids at room temperature. Copper grids were stained with uranyl acetate (Electron Microscopy Sciences; cat. no. 22400) at room temperature for 5 min, and subsequently examined by TEM (JEOL Ltd.; JEM-1400), Representative TEM images revealed the characteristic morphology typical of exosomes.

NTA with Zetaview-PMX120-Z (Particle Metrix GmbH) and corresponding software ZetaView (version 8.05.14 SP7). Isolated exosome samples were appropriately diluted using 1X PBS buffer (Beyotime Biotechnology) to measure the particle size and concentration. NTA measurement was recorded and analyzed at 11 positions. The ZetaView system was calibrated using 100 nm polystyrene particles. Temperature was maintained at 23°C and 30°C.

The BCA working reagent was prepared by mixing Reagent A and Reagent B from the BCA Protein Assay Kit (Biosharp Life Sciences; cat. no. BL521S;) at a 50:1 volume ratio. BSA standards were prepared according to the manufacturer's instructions, and varying volumes of standards and test samples were dispensed into a 96-well microplate. Subsequently, 200 µl of the working reagent was added to each well, mixed thoroughly, and the plate was incubated at 37°C for 30 min. Absorbance at 562 nm was then measured using a microplate reader (Thermo Fisher Scientific, Inc.) and the optical density values were recorded.

Particle size was assessed by nanoparticle tracking analysis (NTA) and protein concentration was measured using a BCA assay. The particle concentration was 6.4×10¹⁰ particles/ml, as indicated by these results. Additionally, BCA protein assays indicated a protein content of 60 µg/ml. The Particle-to-Protein Ratio for the extracted exosomes is 1.07×10⁹ particles/µg, thereby affirming that the purity of the experimental materials adheres to the requisite requirements. Finally, Following exosome isolation, the expression of exosomal marker proteins was assessed by western blotting. The extracts were positive for the exosomal markers CD81, CD63 and TSG101, and negative for GM130, a negative control. The aforementioned identification methods and results satisfy criteria a, b, and c outlined (Steps of EV Characterization) of the MISEV2018 guidelines (18). It was hypothesized that it was appropriate to characterize this extract as exosomes.

The fluorescent dye Dil (MCE; cat. no. HY-D0083) was dissolved in DMSO to create a 1 mg/ml stock solution, diluted 1:100 with PBS to prepare a working solution. PBS and isolated exosomes were each mixed 1:1 with the Dil working solution, incubated at 37°C for 30 min, and then washed with PBS. The mixtures were processed following the same procedure used for exosome extraction to collect labelled exosomes. Finally, Dil-labelled exosomes were resuspended in PBS and stored at −80°C for subsequent experiments.

A549 and H460 cells were cultured overnight at 37°C in 24-well plates. Dil dye and Dil-labelled exosomes were diluted in RPMI-1640 medium, evenly distributed into the wells, and incubated under light-protected conditions for 12 h. At room temperature, cells were then fixed in 4% paraformaldehyde for 30 min, stained with DAPI for 10 min, mounted on slides, and imaged using confocal microscopy.

The 3^rd generation A549 and H460 cells were seeded in 6-well plates and incubated overnight at 37°C with 5% CO₂. On the following day, 200 µl OMEM, 6 µl REVG007 transfection reagent, and 2 µg plasmid were added per well according to the manufacturer's instructions. Cells were incubated for an additional 48 h, then harvested and divided for subsequent western blotting and qPCR. The UBE2D3 knockdown plasmid, REVG007 transfection reagent, and OMEM were purchased from Shanghai Genechem Co., Ltd.. Relevant short hairpin (sh)RNA sequences were: sh-UBE2D3: CCCATATCAAGGCGGTGTATT; sh-negative control (NC): TTCTCCGAACGTGTCACGT.

Total proteins were extracted from tissues or cells using RIPA lysis buffer (Beyotime Biotechnology; cat. no. P0013B) and quantified. Samples (10 µg protein per lane) were separated by electrophoresis on a 10% SDS-polyacrylamide gel, transferred onto a PVDF membrane, and blocked with 5% skimmed milk at room temperature for 1 h. Membranes were incubated overnight at 4°C with primary antibodies (Abmart Pharmaceutical Technology Co., Ltd.; CD81, cat. no. T55742S; CD63, cat. no. TR19741S; TSG101, cat. no. T55985S; UBE2D3, cat. no. TB6189S and β-actin, cat. no. P30002S; all diluted 1:2,000). After washing, membranes were incubated with HRP-labeled Goat Anti-Rabbit IgG(H+L) (Beyotime Biotechnology; cat. no. A0208; 1:1,000) at room temperature for 1 h. Bands were visualized using a BeyoECL Plus (Beyotime Biotechnology; cat. no. P0018S). Chemiluminescent signals were detected using a ChemiDoc Touch Imaging System (Bio-Rad Laboratories, Inc.).

Lung cancer cells were harvested by digestion with 0.25% trypsin the day before transfection. Cells were seeded (3×10⁵ cells/well) in 6-well plates with 2 ml complete medium and incubated overnight at 37°C. For each well, 20 pmol antagomiR-NC and antagomiR-491-3p (Sangon Biotech) was diluted in 50 µl serum-free RPMI-1640 medium. Additionally, 1 µl Lipofectamine^® 2000 reagent (Invitrogen; Thermo Fisher Scientific, Inc.) was diluted in 50 µl serum-free RPMI-1640 medium, then incubated for 5 min at room temperature. The diluted solutions were combined, mixed gently, and incubated for 20 min at room temperature to form complexes. After washing twice with PBS, each well received 2 ml serum-free medium, and complexes were added dropwise. Plates were gently shaken and incubated for 24–72 h, with fresh complete medium replaced every 4–6 h, depending on cell viability. Subsequent related experiments were performed after incubation for 72 h. Relevant antagomiRNA sequences were: antagomiR-NC: ACAGUAACUUGCGUGAUUAUUG; antagomiR-491-3p: GUAGAAGGGAAUCUUGCAUAAG.

All biological experiments included three independent repeats (n=3), each comprising three technical replicates. Statistical analyses were performed using GraphPad Prism 9.0 (Dotmatics) and SPSS 22.0 software (IBM Corp.), with data presented as mean ± standard deviation. Differences between two groups were compared using unpaired Student's t-test and comparisons among three or more groups were performed with one-way or two-way ANOVA followed by Tukey's post hoc test for multiple comparisons. P<0.05 was considered to indicate a statistically significant difference.

To investigate the role of macrophages in lung carcinogenesis and progression, immunostaining for CD68 was performed on 68 pairs of human lung cancer and adjacent normal lung tissues (Fig. 1A and B). The CD68-positive area fraction was markedly greater in tumor tissues compared with adjacent normal tissues (Fig. 1C). Furthermore, analysis of metastatic and non-metastatic lung cancer tissues revealed a higher CD68-positive area fraction in metastatic lesions, indicating increased macrophage infiltration (Fig. 1D). A receiver operating characteristic (ROC) curve analysis demonstrated that the area under the curve (AUC) for CD68 expression in lung cancer was 0.8415, confirming its diagnostic value for lung cancer patients (Fig. 1E). qPCR showed significant upregulation of the M2 macrophage markers ARG1 and IRF4 in tumor tissues (Fig. 1G), while the M1 markers IRF5 and TNF-α did not exhibit significant differences (Fig. 1F). Additionally, ARG1 and IRF4 expression levels were further elevated in metastatic tissues (Fig. 1H). Collectively, these results indicated that M2-polarized macrophages promoted malignant progression and metastasis in lung cancer.

THP-1 cells were induced into M0 macrophages and subsequently polarized into M2-like macrophages using cytokines IL-4 and IL-13. Polarization was confirmed by flow cytometry analysis of CD206 expression (Fig. 2A). Concurrently, expression levels of the hallmark M2 markers ARG1 and IRF4 were examined. Results showed markedly increased expression of these markers in M2-like macrophages compared with control cells (Fig. 2B). Conditioned medium (CM) from M2-like macrophages was added to the culture medium of lung cancer cells (A549 and H460) to evaluate its effect. Compared with control groups, the proliferation capacity of cancer cells was markedly enhanced by M2-CM treatment (Fig. 2C). Colony formation assays demonstrated a marked increase in tumor cell clones in the M2-CM groups compared with controls (Fig. 2D). Transwell assays further indicated that the migration and invasion capabilities of tumor cells were markedly enhanced in the M2-CM-treated groups (Fig. 2E-H). In vivo studies validated these findings. Control and M2-CM-treated A549 cells were injected into the axillary regions of nude mice. Tumor volume and weight in the M2-CM group were markedly increased compared with controls (Fig. 2I-K). These results demonstrate that conditioned media (CM) from M2-like macrophages markedly promote lung cancer cell proliferation both in vitro and in vivo.

Exosomes, as critical mediators of intercellular communication, markedly contribute to lung cancer progression. To investigate exosome-mediated communication between M2-like macrophages and lung cancer cells, exosomes were isolated from the culture medium of M2-like macrophages by ultracentrifugation and visualized using TEM (Fig. 3A). NTA indicated that exosome diameters ranged mainly from 100–200 nm (Fig. 3B). Western blot analyses confirmed the presence of CD81, CD63 and TSG101 proteins in exosomes but not in whole-cell lysates. By contrast, GM130 protein was absent in exosomes and present in whole-cell lysates (Fig. 3C).

To further explore the role of exosomes, M2-like macrophages were treated with the exosome secretion inhibitor GW4869. Lung cancer cells treated with CM from GW4869-treated macrophages showed markedly reduced proliferation compared with untreated controls (Fig. 3D). Colony formation assays indicated that GW4869 markedly reduced lung cancer cell clonogenicity (Fig. 3E). Transwell assays showed that GW4869 markedly suppressed lung cancer cell migration and invasion (Fig. 3F and G). In vivo studies further demonstrated that tumors derived from GW4869-treated cells had markedly lower weights and volumes compared with the untreated M2-CM group (Fig. 3H-J). These results confirmed that M2-like macrophages promote lung cancer malignancy via exosome secretion, and inhibition of exosome release effectively impedes tumor progression.

Differentially expressed miRNAs associated with lung cancer progression were identified using the GEO database, revealing miR-20a, miR-21, miR-454, miR-491-3p, miR-140-3p and miR-221 as potential targets (Fig. 4A). qPCR analysis showed that miR-491-3p exhibited the greatest differential expression between control (medium-only) and M2-like macrophage exosome groups (Fig. 4B). miR-491-3p was barely detectable in control (medium-only) groups but was markedly enriched in M2-like macrophage exosomes isolated by the same ultracentrifugation protocol, indicating that miR-491-3p originated from M2-like macrophage exosomes rather than the cell culture medium. Cellular expression analysis further confirmed markedly elevated miR-491-3p levels in both A549 and H460 cells compared with controls (Fig. 4C). Moreover, treatment with M2-like macrophage-derived exosomes markedly increased both precursor and mature miR-491-3p expression in lung cancer cells, indicating direct delivery and induction of miR-491-3p synthesis following exosome internalization (Fig. 4D).

To verify exosome uptake by lung cancer cells, cells were incubated separately with Dil dye alone or with Dil-labeled exosomes. Results indicated that Dil dye alone was not internalized by A549 or H460 cells, whereas Dil-labeled exosomes were efficiently internalized by both cell lines (Fig. 4E). Collectively, these findings demonstrated that M2-like macrophages release exosomes enriched in miR-491-3p, which upon uptake by lung cancer cells, trigger signaling changes that promote lung cancer progression.

To verify the critical regulatory role of miR-491-3p in lung cancer progression, antagomiR-491-3p was transfected into A549 and H460 cells to reduce miR-491-3p expression (Fig. 5A). Compared with the control group, cell proliferation markedly decreased in the antagomiR-491-3p group (Fig. 5B). Likewise, reduced miR-491-3p expression markedly diminished the colony-forming capability of A549 and H460 cells (Fig. 5C). Transwell assays showed markedly reduced migration and invasion abilities in lung cancer cells following antagomiR-491-3p treatment (Fig. 5D-F). Subsequent in vivo studies demonstrated that tumor masses were markedly smaller in both weight and volume in the antagomiR-491-3p-treated group compared with the control group (Fig. 5G). Collectively, these findings indicate that miR-491-3p is critical for lung cancer growth, and its inhibition effectively suppresses malignant behaviors.

To clarify the molecular mechanism by which miR-491-3p facilitates lung cancer progression, downstream targets of miR-491-3p were identified (Table I). UBE2D3, AZI2 and PTPRM emerged as candidate genes for further evaluation. Their expression levels were assessed in HBE135-E6E7, A549 and H460 cells. The results showed that UBE2D3 expression was decreased in tumor cells, while AZI2 and PTPRM were increased (Fig. 6A). Given that miR-491-3p reduces the expression of its target gene upon entering lung cancer cells, UBE2D3 was selected for further analysis. Western blotting confirmed lower UBE2D3 protein expression in A549 and H460 cells (Fig. 6B). qPCR analysis of 68 paired clinical lung cancer samples demonstrated markedly reduced UBE2D3 expression in tumor tissues compared with adjacent normal tissues (Fig. 6C). Following antagomiR-491-3p treatment, UBE2D3 expression markedly increased in tumor cells, suggesting a negative regulatory relationship between miR-491-3p and UBE2D3 (Fig. 6D). A ROC curve analysis produced an AUC of 0.8842, indicating markedly reduced UBE2D3 expression in tumor tissues (Fig. 6E). Suppressing miR-491-3p expression led to decreased colony formation, migration, and invasion in lung cancer cells. To further investigate this mechanism, UBE2D3 knockdown using shRNA partially reversed the inhibitory effects of miR-491-3p suppression, restoring colony formation, migration, and invasion capabilities in lung cancer cells (Fig. 6F-H). These findings collectively demonstrated that miR-491-3p promotes lung cancer progression by inhibiting UBE2D3 expression.