Fetal calf serum (FCS) and Dulbecco’s modified Eagle’s medium (DMEM)/F12 were obtained from Invitrogen Life Technologies (Carlsbad, CA, USA). NotI, XhoI (Takara Bio Inc., Shiga, Japan), T4 DNA Ligase (Takara Bio Inc.), RNasin inhibitor (Promega Corporation, Madison, WI, USA), Hoechst 33258, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), Annexin V-fluorescein isothiocyanate (FITC) and propidium iodide (PI; Sigma, St. Louis, MO, USA) were also used in this study.

The mature miRNA-203 sequences are available from the miRNA Registry (5′-GTGAAATGTTTAGGACCACTAG-3′). In order to prevent the formation of a termination signal, TTGGCCACTGACT was selected as the region in a miRNA expression vector template. TGCT was added to the 5′ positive-sense strand template of the miRNA expression vector and GTCC was added to the 5′ antisense strand template. Further, a non-specific sequence was designed and sent to GenePharma Co., Ltd. (Shanghai, China) for synthesis and finally, a eukaryotic hsa-miR-203 expression vector was successfully constructed. The assay was performed as previously described (8).

The K562 (CML) cell line (Shanghai Institute of Cell Biology, China) was grown in DMEM/F12 containing 10% FCS at 37°C in a humidified atmosphere with 5% CO₂ in a Thermo FORMA 3110 incubator (Thermo Scientific, Marietta, OH, USA). K562 cells in the exponential phase of growth were seeded in 96- or 24-well plates (Costar, Cambridge, MA, USA) and transfected with the plasmid using Lipofectamine 2000 reagent (Invitrogen; 1:1.2 volume/mass ratio of Lipofectamine 2000 to the plasmid) in serum-free DMEM/F12 for 6 h. At the end of transfection, the cells were incubated in medium containing 10% FCS. Transfection of PmiR-203 into the K562 cells with a final concentration of 500 ng/μl was performed according to the manufacturer’s instructions.

The 3′ untranslated regions (3′-UTRs) of the bcr/abl genes were amplified by polymerase chain reaction (PCR) using genomic DNA of the K562 cell line and cloned downstream of the Renilla luciferase open reading frame in the psiCHECK-2 vector (Promega) using XhoI and NotI restriction sites. The bcr/abl primers (CCGCTCGAGCAGCAGTCAGGGGTCAGG and ATAAGAATGCGGCCGCTTCTAATGTAAACACTG ATTTATTTA) were designed to bind to position 1992 of the bcr/abl genomic sequence. Tandem mutations were introduced to the seed region of the miR-203 binding site in the primers; UGUAAAGU was substituted by AUCGAUC and the construct was named bcr/abl-mut-UTR.

For luciferase reporter assays, cells were seeded in 96-well plates and cotransfected with 25 nM miRNA mimics or 100 nM hairpin inhibitors together with 15 ng/well psiCHECK-2 reporter vectors. Forty-eight hours after transfection, luciferase activity was measured using the dual-luciferase reporter assay system kit (Promega) according to the manufacturer’s instructions and a Tecan M200 luminescence reader (Tecan Group Ltd., Männedorf, Switzerland). Values were double normalized to firefly luciferase activity and to cells transfected with empty psiCHECK-2 control vectors. The sequenc inclued Bcr/abl 3′UTR, 5′-UCUGAGUUCUUGAAGCAUUUCAA-3′, hsa-miR-203, 3′-GAUCACCAGGAUUUGUAAAGUG-5′ and Bcr/abl-mut 3′UTR, 5′-UCUGAGUUCUUGAAGAUCGAUCA-3′.

The viability of K562 cells was determined by the MTT assay. Briefly, cells at a density of 5×10⁴ cells/ ml were transfected with PmiR-203 or a negative control (NC; plasmid containing a scrambled sequence, 0.8 μg/ml) in the presence of Lipofectamine 2000 and serum-free DMEM/F12 media for 6 h. The cells were plated in 96-well plates in medium containing 10% FCS for another 48 h, with the presence of varying concentrations of ATO (1.25, 2.5, 5.0, 10.0 and 20.0 μg/ml). Then, 20 μl MTT stock solution (5 mg/ml) was added to each well to a final MTT concentration of 0.45 mg/ml and the plate was incubated for 4 h at 37°C. The medium was then removed and dimethyl sulfoxide (DMSO; 150 μl) was added to dissolve the blue formazan crystals at room temperature for 30 min. The viability of the cells was assessed by absorbance at 570 nm on a Bio-Rad microtiter plate reader (Hercules, CA, USA). The IC₅₀ values were determined using IC₅₀ software (Northwest A & F University, Beijing, China).

K562 cells transfected with PmiR-203 (0.8 μg/ml) were incubated for 48 h. Additionally, K562 cells treated with ATO (10 μg/ml) were also grown for 48 h. Then, the cells were collected by centrifuging at 4°C for 6 min at 111.8 × g and washed in phosphate-buffered saline (PBS). The cells were sprayed onto glass slides, air-dried and fixed with methanol for 10 min. Then, the cells were washed with buffer twice, stained with Hoechst 33258 for 10 min, washed with distilled water and finally air-dried again. The morphology of the K562 cells was observed under a fluorescent microscope.

K562 human CML cells were incubated in 12-well flat-bottomed plates at a concentration of 1.0×10⁶ cells/ml. Experimental groups: 1, control group with blank cells (control); 2, negative control (NC, containing plasmid, Scramble sequence 0.8 μg/ml); 3, PmiR-203; 4, ATO. K562 cells transfected with PmiR-203 (0.8 μg/ml) were incubated for 48 h. Meanwhile, K562 cells treated with ATO (10 μg/ml) were also grown for 48 h. The cells were collected by centrifugation at 4°C for 6 min at 111.8 × g and washed in PBS. The cells were sprayed on glass slides, air-dried and fixed with methanol for 10 min, and then washed with buffer twice, stained with Hoechst 33258 stain for 10 min, washed with distilled water, and finally air dried. The morphology of the K562 cells was observed under a fluorescent microscope. After cultivation for 48 h, the cells were collected and washed with PBS. They were then suspended in 500 μl JC-1 culture fluid, incubated in a 5% CO₂ atmosphere at 37°C for 20 min and washed twice with incubation buffer. The cells were then suspended in 500 μl incubation buffer. A drop of the cell suspension was placed on a microscope slide, covered with a cover glass and then observed under a fluorescence microscope.

K562 cells were seeded at a density of 1.0×10⁵ cells/ml (500 μl/well) in 24-well plates (Costar) and transfected with miR-203 (0.8 μg/ml) using Lipofectamine 2000 reagent in serum-free DMEM/F12 for 6 h. Following transfection, 500 μl appropriate growth medium containing 20% FCS was added to each well with a total volume of 1,000 μl. Cells were continuously incubated for another 48 h in the presence of 10.0 mg/ml ATO, then harvested, washed twice with PBS and fixed with 70% ethanol. They were also treated with RNase A (1 mg/ml) following the elimination of ethanol. Finally, the cells were stained with PI solution (50 μg/ml). The cell cycles were analyzed by flow cytometry according to the content of DNA (Beckman Coulter Elite, Fullerton, CA, USA). Pretreatment of the K562 cells was performed as described above. Viable cells were collected and double-stained with FITC-conjugated Annexin V and PI. For each sample, data from ∼10,000 cells were recorded in list mode on logarithmic scales. Apoptosis and necrosis were analyzed by quadrant statistics on PI-negative, Annexin V positive and PI and Annexin V-positive cells.

Pretreatment of K562 cells was performed as follows: 1, control group with blank cells (control); 2, negative control (NC,containing plasmid, Scramble sequence 0.8 μg/ml); 3, PmiR-203 (0.8 μg/ml); 4, ATO (10 μg/ml); 5, PmiR-203+ATO. The total RNA from treated cells was extracted in Trizol (Invitrogen) and was quantified by an ultraviolet spectrophotometer (UVP, Upland, CA, USA) at a wavelength of 260 nm. The Bcr/abl expression level was determined by real-time PCR. Reverse transcribed with an M-MLV reverse transcriptase. A 20 μl reverse transcription (RT) reaction was incubated at 37°C for 30 min. Real-time PCR was performed using a PCR amplifier (Bio-Rad). The PCR cycles were as follows. There was an initial denaturation at 94°C for 3 min. The reaction was repeated for 40 cycles; each cycle consisted of denaturing at 94°C for 20 sec, annealing at 50°C for 25 sec and synthesis at 72°C for 20 sec, according to the manufacturer’s instructions. The GAPDH group was used as the internal control. The expression level was calculated using CT and 2^−ΔΔCt. Then, the cells were lysed with RIPA buffer in the presence of a proteinase inhibitor (Shenergy Biocolor BioScience and Technology Co., Ltd., Shanghai, China). The protein concentration was determined using bicinchoninic acid (BCA; Bioss, Beijing, China) and adjusted to 2.0 μg/μl. Then, 50 μl cell suspension containing 100 μg proteins was extracted from each well. Lysis buffer (50 μl) was used as the control. Next, 0.5 μl dithiothreitol (DTT) was added for each 50 μl 2X reaction buffer and 50 μl prepared 2X reaction buffer was added to each well. Additionally, 5 μl caspase-3 substrate or caspase-9 substrate was added to the wells. The plates were incubated in the dark at 37°C for 4 h and the A405 value was detected using an enzyme-labeled instrument (Bio-Tek, Winooski, VT, USA).

Pretreatment of K562 cells was performed as described above. The total RNA from the treated cells was extracted using TRIzol (Invitrogen) and was quantified using an ultraviolet spectrophotometer (UVP, Upland, CA, USA) at a wavelength of 260 nm. The bcr/abl expression level was determined by real-time PCR using M-MLV reverse transcriptase. A 20 μl reverse transcription reaction was incubated at 37°C for 30 min. Real-time PCR was performed using a PCR amplifier (Bio-Rad). The PCR cycles were as follows: initial denaturation at 94°C for 3 min, then 40 cycles of denaturing at 94°C for 20 sec, annealing at 50°C for 25 sec and synthesis at 72°C for 20 sec, as per the manufacturer’s instructions. The GAPDH gene was used as the internal control. The expression level was calculated using cycle threshold (Ct) values and the 2^−ΔΔCt method.

The cells were analyzed in RIPA buffer in the presence of a proteinase inhibitor. The protein concentration was determined using BCA. Proteins (30 μg) were separated using 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to a nitrocellulose membrane. Membranes were probed with primary antibodies against cytochrome c (rabbit polyclonal; Cell Biotech, Tianjin, China) at room temperature for 2 h, washed extensively with 0.1% Tween-20 in PBS and incubated with secondary antibodies conjugated with horseradish peroxidase at a dilution of 1:10,000 (Pharmingen, Becton Dickinson, San Diego, California, USA), at room temperature for 3 h. Development was performed using an enhanced chemiluminescence (ECL) system (Amersham Pharmacia Biotech, Amersham, UK).

All results and data were confirmed in at least three separate experiments. Data are expressed as mean ± standard deviation (SD). Statistical comparisons were made by one-way analysis of variance (ANOVA). P<0.05 was considered to indicate a statistically significant difference.

To confirm bcr/abl as a direct target of miR-203 in K562 leukemia cells, we constructed the dual-luciferase reporter (psi-CHECK) containing either the miR-203 recognition sequence or a mutated sequence from the 3′UTR of bcr/abl mRNA immediately downstream of the luciferase gene. As shown in Fig. 1, transfection with miR-203 reduced the activity of the bcr/abl-UTR reporter in the K562 cells but did not affect the activity of the bcr/abl-mut-UTR reporter. These results suggest that bcr/abl is a target of miR-203 in K562 cells.

In this study, we determined the effect of PmiR-203 on cell viability (alone or in combination with ATO). As shown in Fig. 2, PmiR-203 alone effectively inhibited cell viability. The data indicate that PmiR-203 is also able to increase the ATO-induced inhibitory effects on K562 cells. Thus, PmiR-203 significantly decreases the IC₅₀ values of ATO. When used alone, the IC₅₀ of ATO was 6.49 μg/ml and when used in combination with the NC, the IC₅₀ of ATO was 5.8 μg/ml. However, when used in combination with PmiR-203, the IC₅₀ of ATO was 2.45 μg/ml. The susceptibility of the cells increased 2.64-fold (Fig. 2).

Hoechst 33258 staining (Fig. 3) also revealed that K562 cells in the PmiR-203 and ATO groups acquired typical features of apoptosis, including cell shrinkage, nuclear pyknosis and apoptotic bodies at 48 h post-transfection. The results confirmed that PmiR-203 and ATO are able to induce cell apoptosis.

Under a bicolor filter, while normal cells show high-intensity green and red fluorescence, apoptotic cells show high-intensity green fluorescence and low-intensity red fluorescence. The results of the negative control group were similar to those of the cell control group. All the cells in the former group demonstrated high-intensity green and red fluorescence, while the cells in the PmiR-203+ATO group demonstrated high-intensity green fluorescence and low-intensity red fluorescence (Fig. 4).

To explore the effects of PmiR-203 on the cell cycle, PmiR-203 treatment alone or in combination with 10.0 μg/ml ATO was investigated in K562 cells. Cells were stained with PI solution. Cell cycles were analyzed by flow cytometry according to the DNA content. As shown in Fig. 5, PmiR-203 and ATO were able to independently induce G1 phase arrest. The increased sub-G1-phase cell population indicates that PmiR-203 and ATO induce apoptosis in K562 cells (Fig. 5).

PmiR-203 was used alone or in combination with ATO in K562 cells. Apoptosis of the K562 cells was detected by flow cytometry using double-staining with Annexin V and PI. The results demonstrated that PmiR-203 alone induces cell apoptosis and promotes the ATO-induced apoptosis of cells as compared with controls (Fig. 6).

The caspase family plays an important role in the mediation of apoptotic progress and caspase-3 and caspase-9 are considered key performing elements in the process of apoptosis. The activities of these proteins are associated with DNA fragmentation, chromatin condensation and apoptotic body formation. Under normal conditions, caspase-3 and caspase-9 exist in the cytoplasm in the inactive pro-enzyme form; however, during apoptosis, they are activated and split the corresponding substrate in the cytoplasm and nucleus, finally leading to apoptosis. The activities of caspase-3 and caspase-9 were significantly increased in the PmiR-203, ATO and PmiR-203+ATO groups, indicating that PmiR-203 and ATO activate caspase-3 and caspase-9 (Table I).

To evaluate the effects of PmiR-203 on the bcr/abl mRNA level of the cells, K562 cells transfected with PmiR-203 were processed and analyzed for mRNAs. The bcr/abl expression was determined by quantitative real-time PCR. GAPDH was used as the internal control. The fold-change of the expression level was calculated using 2^−ΔΔCt, as described in Materials and methods. The 2^−ΔΔCt value of K562 cells treated with PmiR-203 was only 0.189 (18.9%). The results indicate that PmiR-203 effectively downregulates the bcr/abl level (Fig. 7).

To evaluate the levels of cytochrome c protein, K562 cells transfected with PmiR-203 were processed and analyzed for cytochrome c protein by western blotting as described in Materials and methods. The results indicate that the release of cytochrome c protein increased in the PmiR-203 and the ATO groups (Fig. 8).