Paroxysmal kinesigenic dyskinesia (PKD) is an autosomal dominant disorder and PRRT2 is the causative gene of PKD. The aim of this study was to investigate PRRT2 mutations in patients who were clinically diagnosed with PKD. Nine PKD cases, including four familial cases and five sporadic cases, were selected. Peripheral blood was drawn after obtaining informed consent, and genomic DNA was extracted by a standard protocol. Sanger sequencing was performed for the screening of PRRT2 mutations. A total of five cases were detected to harbor PRRT2 mutations. Four familial cases carried a c.649dupC (p.Arg217Profs*8) mutation, while one sporadic case and his asymptomatic father carried a c.133-136delCCAG (p.Pro45Argfs*44) mutation. PRRT2 mutations were not identified in the remaining cases. The study further confirmed that PRRT2 was a causative gene of PKD and implied that PRRT2 mutation has incomplete penetrance.
Paroxysmal kinesigenic dyskinesia (PKD), also known as paroxysmal exercise-induced dyskinesia syndrome, is an autosomal dominant genetic disease, the incidence rate of which is ~1/150,000 (
Since it was first reported in 1967 (
The study included nine patients with PKD (cases PKD 1–9) from seven different pedigrees (families 1–7). These included six male cases (PKD 2, 3, 5 and 7–9) and three female cases (PKD 1, 4 and 6). Four patients had a family history (PKD 1–4) and the other five were sporadic cases. Family 1 had eight members, three of whom had a history of PKD, but the patient 1 refused a blood sample and thus it was not possible to determine whether that patient carried PRRT2 mutations. The family 2 proband exhibited involuntary twisting of the body and his father mainly complained of sudden movement. The remaining five probands and their parents were asymptomatic and classified as sporadic cases. The present study was approved by the Ethics Committee of Zhengzhou Children’s Hospital (Zhengzhou, China). All patients provided informed consent.
Venous blood samples (3 ml) were obtained for anticoagulation by sodium citrate. They were stored in a refrigerator at 4°C for short periods, and frozen at −20°C for long-term preservation.
The QIAamp blood DNA extraction kit (Qiagen, Hilden, Germany) was used to extract DNA from the blood samples. The DNA was dissolved with 1X AE solution (Qiagen), and stored at −20°C for the long-term.
Five PRRT2 primers were used according to the literature (
To 5 μl PCR product was added 0.3 μl shrimp alkaline/heat-sensitive alkaline phosphatase [Promega (Beijing) Biotech Co., Ltd., Beijing, China], 0.2 μl exonuclease [New England Biotechnology (Beijing) Co., Ltd., Beijing, China] and 2.5 μl ddH2O for purification. The mixture was placed in a 37°C water bath for 1 h, then in a 80°C water bath for 15 min. The 3 μl purified PCR product that was obtained was added to 1 μl 3.2 pmol/l unidirectional primer and 1 μl BigDye working fluid (Beijing Yue Wei Gene Technology Co., Ltd., Beijing, China) for forward sequencing reaction. The reaction conditions were: 96°C denaturation for 1 min; 94°C denaturation for 10 sec, 50°C annealing for 5 sec and 60°C extension for 4 min, for 25 cycles; followed by 60°C extension for 10 min. Following the sequencing reaction, 50 μl 75% ethanol mixture was added and the resultant mixture was stored at −20°C in a refrigerator for 60 min. After centrifuging at 10,800 × g for 30 min, the supernatant was discarded, 50 μl 75% ethanol was added and further centrifugation at 10,800 × g for 30 min was conducted. The supernatant was discarded. After drying, 7 μl Hi-Di (Shanghai Top Zhuo Biotechnology Co., Ltd., Shanghai, China) was added to the residue, which was the loaded onto an ABI 3730 genetic Analyzer (Haimai Pu Biotechnology Co., Ltd.) for sequencing.
The clinical manifestations of the nine patients with PKD are shown in
A gel map following PCR amplification is shown in
Sanger sequencing results showed that PKD 1–4 carried the PRRT2 gene c.649dupC (p.Arg217Profs*8) mutation (
PKD is the most common form of paroxysmal dyskinesia with onset triggered by sudden movements. Since PKD was first reported in 1967, a number of academics and clinicians have been committed to identifying the genes that cause PKD. In 2011, Chen
However, few studies have reported on PKD. Song and Hu described in detail the clinical manifestations of five PKD cases (
Currently, >30 PRRT2 mutations have been identified in patients with PKD (
Although PRRT2 genes of PKD have been cloned, the function of PRRT2 remains unclear. Co-immunoprecipitation results suggest that PRRT2 interacts with SNAP25 (
The present study confirmed that PRRT2 is a pathogenic gene of PKD, and that c.649dupC is a high frequency mutation site. In addition, the presence of incomplete penetrance of PRRT2 was revealed.
Pedigree chart for the patients with paroxysmal kinesigenic dyskinesia (PKD). − indicates male, ○ represents female, □ or ● denotes affected individuals, arrow indicates proband, *indicates positive for PRRT2 mutation.
PCR gel results of four PRRT2 gene exons. M, DNA marker; lanes 1–5: exon 1, exon 2a, exon 2b, exon 2c and exons 3–4, respectively.
Normal PRRT2 and (A) c.649dupC and (B) c.133-136delCCAG mutated gene sequences.
PRRT2 gene forward and reverse primers.
Exons | Forward primers (5′→3′) | Reverse primers (5′→3′) |
---|---|---|
Exons 1 | TTGCCTGGGTAACGCGTGGCT | ACACCCGCATTCCCGTGCAGT |
Exons 2a | CAATT GGGCCTGCAGTGCTGAG | GGTTTGGACACTGTTTCTTGGCAT |
Exons 2b | GGAGGGGAATCAAAGGCCAACTG | TCAACCAGCTGCTGCAGCACTC |
Exons 2c | GAAAAGCAAGAGAATGGGGCAGTG | GATTACTCCAGAGGCTCTATTGCAG |
Exons 3–4 | TTCTGGATGACTTTTCCACCTGAT | CAACAGGAAGAAAAGTCTTGGGAT |
Clinical data of PRRT2 gene test results for nine patients with paroxysmal kinesigenic dyskinesia (PKD).
Number | Gender | Family history | Onset age (years old) | Main symptoms | Seizure frequency | Drug treatment | PRRT2 mutation |
---|---|---|---|---|---|---|---|
PKD 1 | Female | Familial | 10 | Upper limb dance-like movements | No symptoms currently | Untreated | c.649dupC |
PKD 2 | Male | Familial | 9 | Involuntary limb swinging | 3–10 times per day | Carbamazepine | c.649dupC |
PKD 3 | Male | Familial | 10 | Involuntary twisting of the body | No symptoms currently | Phenytoin sodium | c.649dupC |
PKD 4 | Female | Familial | 8 | Involuntary twisting of the body | 1–5 times per day | Carbamazepine | c.649dupC |
PKD 5 | Male | Sporadic | 11 | Lower limb spasms | 1 time per 2–3 days | Carbamazepine | None |
PKD 6 | Female | Sporadic | 12 | Lower limb stiffness | 1–3 times per day | Sodium valproate | None |
PKD 7 | Male | Sporadic | 5 | Involuntary limb swinging | 3–5 times per day | Carbamazepine | c.133-136delCCAG |
PKD 8 | Male | Sporadic | 10 | Left upper limb spasm | 5–20 times per day | Carbamazepine | None |
PKD 9 | Male | Sporadic | 12 | Lower limb stiffness and falling down | 1–5 times per day | Oxcarbazepine | None |