Nr4a3, a possibile oncogenic factor for neuroblastoma associated with CpGi methylation within the third exon

  • Authors:
    • Shota Uekusa
    • Hiroyuki Kawashima
    • Kiminobu Sugito
    • Shinsuke Yoshizawa
    • Yui Shinojima
    • Jun Igarashi
    • Srimoyee Ghosh
    • Xaofei Wang
    • Kyoko Fujiwara
    • Taro Ikeda
    • Tsugumichi Koshinaga
    • Masayoshi Soma
    • Hiroki Nagase
  • View Affiliations

  • Published online on: March 13, 2014     https://doi.org/10.3892/ijo.2014.2340
  • Pages: 1669-1677
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Aberrant methylation of Nr4a3 exon 3 CpG island (CpGi) was initially identified during multistep mouse skin carcinogenesis. Nr4a3 is also known as a critical gene for neuronal development. Thus, we examined the Nr4a3 exon 3 CpGi methylation in mouse brain tissues from 15-day embryos, newborns and 12-week-old adults and found significant increase of its methylation and Nr4a3 expression during mouse brain development after birth. In addition, homologous region in human genome was frequently and aberrantly methylated in neuroblastoma specimens. A quantitative analysis of DNA methylation revealed that hypomethylation of CpG islands on Nr4a3 exon 3, but not on exon 1 was identified in three neuroblastomas compared with matched adrenal glands. Additional analysis for 20 neuroblastoma patients was performed and 8 of 20 showed hypomethylation of the CpGi on Nr4a3 exon 3. The survival rate of those 8 patients was significantly lower compared with those in patients with hypermethylation. Immunohistochemical Nr4a3 expression was generally faint in neuroblastoma tissues compared with normal tissues. Moreover, the MYCN amplified NB9 cell line showed hypomethylation and low expression of Nr4a3, while the non-MYCN amplified NB69 cell line showed hypermethylation and high expression. These results indicate that DNA hypomethylation of the CpGi at Nr4a3 exon 3 is associated with low Nr4a3 expression, and correlates with poor prognosis of neuroblastoma. Since Nr4a3 upregulation associated with the hypermethylation and neuronal differentiation in mice, poor prognosis of neuroblastoma associated with Nr4a3 low expression may be partly explained by dysregulation of its differentiation.

Introduction

Neuroblastoma is an embryonic tumor of neuroectodermal cells derived from the neural crest. It is the most common extracranial solid tumor in children, and it accounts for approximately 15% of all pediatric oncology death. Survival rate of the patient with high-risk neuroblastoma is still <40%, despite combined modality therapy (1,2).

Recent advances have disclosed the significance of epigenetic events in the development and progression of human tumorigenesis. Generally, global DNA methylation levels are low in cancer and has been linked to genomic instability, which can lead to DNA damage. On the other hand, promoter-specific hypermethylation of specific genes, such as tumor suppressor genes, is the most common event in tumorigenesis (3). It is also reported that predetermined epigenetic program provides required direction for the number of changes during embryonic and postnatal development that are necessary for proceeding from an oocyte to a fully developed adult animal (4). DNA methylation is the one of the best-characterized epigenetic modifications and plays an important role in the diverse genomic processes, such as gene regulation, chromosomal stability, parental imprinting and X-inactivation (5). Recent genome-wide DNA methylation searches indicate that 4 to 17% of CpG sites are different in methylation among tissues and developmental processes (68). The methylation status at the tissue-specific differentially methylated regions (T-DMRs) and developmental-specific differentially methylated regions (DS-DMRs) are suggested to play important roles in development and differentiation.

Nuclear receptor subfamily 4, group A, member 3 (Nr4a3), also known as neuron-derived orphan receptor 1 (NOR1), is a member of NR4A subgroup of orphan nuclear receptor. In mammals, the NR4A subgroup consists of NR4A1 (Nur77), NR4A2 (Nurr1) and NR4A3 (9). The monomer form of those receptors binds to the nerve growth factor-induced clone B response element (NBRE), and homodimer or heterodimer forms bind to the Nur1 response element in the promoter of their target genes which may be essential for the development of dopaminergic neurons in the midbrain (10). We identified the CpG sites in Nr4a3 exon 3 as a mouse skin cancer T-DMR and a mouse brain DS-DMR by using analyses of restriction landmark genomic scanning (RLGS) and methyl-DNA immunoprecipitation (MeDIP), respectively (Fujiwara et al, unpublished data). Here, we analyzed involvement of DNA methylation at Nr4a3 exon 3 CpGi in Nr4a3 expression, mouse brain development, neuroblastomagenesis and association with its poor prognosis.

Materials and methods

Tissue samples

C57 BL/6J mice were purchased from Jackson Laboratory (Bar Harbor, ME) and maintained in Oriental Yeast Co. Ltd (Tokyo, Japan). Brain specimens from mice at three different developmental stages: E15, 15-day-old embryo; NB, new born; and AD, 12-week adult; were disected and stored as described previously (11).

Twenty primary neuroblastoma tumors were obtained in Nihon University Hospital (Tokyo, Japan) at the time of diagnosis, from 1999 to 2007. All the analyses of those specimens were performed under the approval of Nihon University Institutional Review Boards (IRB no. 51). Neither neoadjuvant chemotherapy nor irradiation therapy was given preoperatively to any patient. Four adrenal samples were collected from a nephroblastoma patient undergoing nephrectomy and from 3 neuroblastoma patients (cases 3, 8 and 20) undergoing tumor resection. All of the samples were immediately snap-frozen in liquid nitrogen and stored at −80°C until use. Summary of these patients is shown in Table I.

Table I.

The tissue samples analyzed.

Table I.

The tissue samples analyzed.

PatientAge at diagnosis (month)INSSINPCShimada classificationCopy nos. of MYCNPrognosis (month)Methylation level of NR4A3 exon 3 (%)a
Case 161NBL, DFH148S43.1±5.9
Case 2102NBL, PDFH126S67.1±2.5
Case 362NBL, PDFH148S20.1±0.9
Case 464SNBL, UDFH148S43.1±5.9
Case 562NBL, PDFH148S7.6±0.1
Case 672NBL, PDFH148S18.4±1.6
Case 782NBL, PDFH148S83.2±0.4
Case 8264NBL, PDUH106R36.1±1.5
Case 9364NBL, UDUH2048S−0.4±8.9
Case 10304NBL, PDUH148S34.3±2.4
Case 11474NBL, UDUH204R8.5±1.5
Case 12213NBL, UDUH1507R2.1±7.3
Case 13983NBL, UDUH148S−1.2±7.3
Case 14774NBL, PDUH34S14.7±5.9
Case 15794NBL, PDUH335R39.1±2.2
Case 16534NBL, UDUH424R79.4±0.6
Case 17204NBL, UDUH815R9.1±3.8
Case 18684NBL, PDUH110R5.2±2.5
Case 19184NBL, PDUH11937S5.4±4.1
Case 20334NBL, UDUH136S25.6±10.1

{ label (or @symbol) needed for fn[@id='tfn1-ijo-44-05-1669'] } INSS, International Neuroblastoma Staging System; INPC, International Neuroblastoma Pathology Committee; NBL, neuroblastoma; PD, poorly differentiated; UD, undifferentiated; FH, favorable histology; UH, unfavorable histology; S, recurrent free survival; R, recurrent.

a Data are shown as mean ± SD.

Cell lines and culture condition

Human neuroblastoma cell lines NB9 and NB69 were obtained from Riken Cell Bank (Tsukuba, Japan). Both human neuroblastoma cell lines were maintained in RPMI-1640 (Nalarai Tesque, Kyoto, Japan) supplemented with 15% fetal bovine serum (Nichirei Biosciences, Tokyo, Japan), 100 IU/ml penicillin (Gibco™, Carlsbad, CA) and 100 μl/ml streptomycin (Gibco). The cells were cultured in a 37°C humidified atmosphere containing 5% CO2 maintained in appropriate conditions recommended by the manufacturers.

DNA preparation and bisulfite treatment

Total genomic DNA was extracted from mouse brains, primary tumors, neuroblastoma cell lines and normal adrenal medullas with DNeasy Tissue Kit (Qiagen, Valencia, CA) and modified by sodium bisulfite using the EZ DNA Methylation Kit (Zymo Research, Orange, CA), by following the manufacturer’s instructions.

Quantitative analysis of DNA methylation using base-specific cleavage and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS)

Sequenom MassARRAY quantitative methylation analysis (12) using the MassARRAY Compact System (www.sequenom.com) was employed for the quantitative DNA methylation analysis at CpG dinucleotides. This system utilizes mass spectrometry (MS) for the detection and quantitative analysis of DNA methylation using homogeneous MassCLEAVE (hMC) base-specific cleavage and matrix-assisted laser desor ption/ionization time-of-f light (MALDI-TOF) MS (13). The MethPrimer program (http://www.urogene.org/methprimer/index1.html) (12) was used to design bisulfite PCR primers (Table II). Each reverse primer has a T7-promotor tag for in vitro transcription (5′-cagtaatacgactcactatagggagaaggct-3′), and the forward primer is tagged with a 10 mer to balance melting temperature (TM) (5′-aggaagagag-3′). All primers were purchased from Operon (Tokyo, Japan). Polymerase chain reaction (PCR) amplification was performed using HotStarTaq Polymerase (Qiagen) in a 5 μl reaction volume using PCR primers at a 200 nM final concentration, and bisulfate treated DNA (∼20 ng/ml). After the treatment of shrimp alkaline phosphatase, 2 μl of the PCR products was used as a template for in vitro transcription and RNase A Cleavage for the T-reverse reaction (3′ to either rUTP or rCTP), as described in the manufacturer’s instructions (Sequenom hMC, Sequenom, San Diego, CA). The samples were desalted and spotted on a 384-pad SpectroCHIP (Sequenom) using a MassARRAY nanodispenser (Samsung Seoul, Korea), followed by spectral acquisition on a MassARRAY Analyzer Compact MALDITOF MS (Sequenom). The resultant methylation calls were analyzed by EpiTYPER software v1.0 (Sequenom) to generate quantitative measurements for each CpG site or an aggregate of multiple CpG sites. Since maldi-TOF mass methylated peaks do not denote a particular CpG site, but rather corresponds to the number of CpG sites methylated within the cleavage fragment, we decided to present average percent methylation of all CpG sites in the bisulfite PCR fragment with the standard curve.

Table II.

The primers for quantitative DNA methylation analysis.

Table II.

The primers for quantitative DNA methylation analysis.

Primer nameSequence
NR3A3-aForward GGAAATTGTTAAGTGTTTTTTTATAT
Reverse 1 CAACCACCACTTCCTAAAT
Reverse 2 CGACCACCACTTCCTAAAT
NR3A3-bForward AGTTTTAGAATTTATGTAAGAGGAAAG
Reverse 1 CACCCAACTATCAAACTC
Reverse 2 CGCCCAACTATCAAACTC
NR3A3-cForward GAGGTGTTGTTTAGTATTTTTATGTATTTTAAGTAG
Reverse CTCACCTTAAAAAAACCCTTACAACC

[i] Each reverse primer has a T7-promotor tag (5′-cagtaatacgactcactatagggagaaggct-3′) for in vitro transcription and the forward primer is tagged with a 10 mer tag (5′-aggaagagag-3’) to balance Tm.

Standard curve of DNA methylation level was made by using 0, 25, 50, 75 and 100% methylated samples. BAC DNA (RPMI-11 341L6) obtained from Roswell Park Cancer Institute (Buffalo, NY) was used as 0% methylation and M.Sss-1 double treated BAC DNA was used as 100% methylation. The PCR was carried out with a final volume of 50 μl, containing 1.0 μl of each 10.0 μM primer (final concentration 0.2 μM), 8.0 μl of 2.5 mM dNTP, 25 μl of 2 times GC Buffer (Takara Bio, Shiga, Japan), 0.5 U of LA taq (Takara Bio) and 1 μl of genomic DNA as a template. Amplification was carried out with an initial denaturing at 94°C for 1 min followed by 45 cycles of denaturing at 94°C for 30 sec, annealing for 1 min at the annealing temperature of each primer (60°C), extension for 3 min at 72°C, and then a final extension for 5 min at 72°C. The methylation reactions were carried out in 1X M.SssI buffer with 160 μM SAM (New England Biolabs, Ipswich, MA). In total reaction volume of 50 μl, 500 ng PCR product was treated with 4U M.SssI for 1 h at 37°C. Reactions were stopped for 20 min at 65°C and PCR product was purified Qiagen PCR purification kit (Qiagen). This CpG methyltransferase reaction was performed twice. Then M.SssI treated PCR product was produced (14). Curve was fitted and methylation levels were modified.

Western blot analysis

All of samples were collected and total cell lysates were prepared in M-PER mammalian protein extraction reagent (Thermo, Rockford, IL) containing a protease-inhibitor cocktail (Nalarai Tesque). Proteins (20 μg) were loaded on NuPAGE + 10% Bis-Tris gels (Invitrogen Life Technologies, Carlsbad, CA) for electrophoresis. The proteins were separated at 100 mA for 1 h, then transferred to polyvinylidene difluoride membranes by using iblot transfer for 7 min (Invitrogen). The membranes were incubated with Tris-buffered saline (TBS), containing 5% non-fat milk, 0.2% Tween-20 and a rabbit anti-NR4A3 polyclonal antibody (1:100) overnight (SC-30154, Santa Cruz Biotechnology, Santa Cruz, CA). The membranes were washed three times with a TBS containing 0.2% Tween-20. The immunocomplexed proteins were identified by reaction with a peroxidase-linked goat antibody to rabbit IgG (GE Healthcare, Little Chalfont, UK). Then these immunocomplexed proteins were detected by enhanced chemiluminescent reaction (Amersham Bioscience Inc., Piscataway, NJ). Immunoblotting with antibody to actin (Abcam, Cambridge, MA) provided an internal control for equal protein loading. Chemiluminescent detection was performed by LAS4000 (Fujifilm, Tokyo, Japan).

Immunohistochemical staining

Formalin-fixed, paraffin-embedded serial sections (4 μm) were deparaffinized in xylene, rehydrated through graded alcohols, and immersed for 15 min in phosphate-buffered saline (PBS). The sections were soaked in 10 mmol/l of sodium citrate buffer (pH 6.9) and treated in a microwave for 15 min for antigen retrieval. After antigen retrieval the endogenous peroxidase activity was blocked with 3% hydrogen peroxidase in methanol for 30 min, and non-specific staining was then blocked by 1-h incubation with normal goat serum (Nichirei Biosciences). The sections were then incubated overnight at 4°C with 2 μg/ml of a rabbit anti-NR4A3 polyclonal antibody (SC-30154: Santa Cruz Biotechnology). The sections were treated for 30 min at room temperature with goat secondary antibody against rabbit immunoglobulins (Nichirei Biosciences). The sections were stained at room temperature for 25 min with AEC substrate kit (Vector Laboratories, Burlingame, CA). After staining with AEC substrate kit the sections were counterstained with hematoxylin.

Chromatin immunoprecipitation assays

Chromatin immunoprecipitation assays were performed essentially as previously described (1517) with the following minor modifications. Neuroblastoma cell lines (NB9 and NB69) were fixed in 0.33 M (1%) formaldehyde for 10 min, before adding 4 volumes of ice-cold PBS containing 0.125 M glycine, to give an approximately 2-fold molar excess of glycine over formaldehyde. Then cells were washed with cold PBS containing Protease K (Nalarai Tesque). Crude cell lysates were sonicated to generate 200–1,000 bp DNA fragments. Chromatin was immunoprecipitated with 10 μl of rabbit antiserum raised against human CTCF (07–729; Millipore, Billerica, MA) per 1×107 cells or with 2 μg normal rabbit immunoglobulin G (IgG; Millipore) used as a control, according to manufacturer’s protocols (Millipore). PCR amplification was performed using AccuPrime (Invitrogen) in a 25 μl reaction volume using PCR primers at 200 nM final concentration and 5 μl immunoprecipitated DNA as a template. Amplification was carried out with an initial denaturing at 94°C for 1 min followed by 38 cycles of denaturing at 94°C for 30 sec, annealing for 30 sec at the annealing temperature of each primer, extension for 1 min at 68°C, and then a final extension for 5 min at 72°C, using specific primers as follows: for NR4A3 exon 3, 5′-CTTCCCGCTCTTCCACTTC-3′; and 5′-TCACCTTGAAAAAGCCCTTG-3′, Tm 58°C; for cMYC, 5′-GTTTTAAGGAACCGCCTGTCCTTC-3′ and 5′-GGA TTGCAAATTACTCCTGCCTCC-3′, Tm 62°C (18). All primers were purchased from Operon.

Statistical analysis

The Mann-Whitney U test was used to evaluate the statistical significance of the difference in the methylation level of NR4A3 among the samples. The methylation levels were categorized by Youden index using 17 patients passed the observation period (19). The cutoff point between high and low levels of DNA methylation at each DMR was calculated by ROC curve analysis. Survival curves were calculated according to Kaplan-Meier analysis and compared with a log-rank test. Event-free survival was calculated as the time from diagnosis to event or last examination if the patient had no event. Recurrence, progression of disease and death from disease were counted as events. Death resulting from therapy complications or from second malignancy was not counted as an event but censored for event-free survival. The data were analyzed by the SPSS (Chicago, IL) for Windows. Differences were considered significant at p<0.05.

Results

Methylation levels at CpG sites of Nr4a3 exon 3 CpGi and its expression in mouse brain specimens

Methylation levels of each CpG site at the Nr4a3 exon 3 CpG island in mouse brains were analyzed at three different developmental stages. This CpGi (mouse chr4:48072571-48072905 in the USCS database, February, 2006 assembly) showed higher methylation level in the brain specimens of 12-weeks-old mice (AD brain), compared with brain specimens from 15-days-old embryos (E15) or new-born mice (NB) in the analysis using Mass ARRAY EpiTYPER (Fig. 1A). The average methylation level of all CpG sites in this region was significantly higher in AD brain than in E15 and NB brain specimens (Fig. 1B). Western blot analysis revealed higher expression level of NR4A3 protein in AD brain specimens, compared with the other developmental stages (Fig. 1C).

Search for the most different somatic change within homologous Nr4a3 exon 3 CpGi in human neuroblastoma

We analyzed methylation level of human homologous region (chr4:48072371-48072905, in USCS genome database, March, 2006, NCBI36/hg18) in the surgical resected NB specimens and found that all 3 NB specimens showed significantly lower methylation level at NR4A3 exon 3 CpGi compare to those from the matched adrenal tissues (Fig. 2). The CpGi located between NR4A3 promoter and intron 1 was not methylated at all in either neuroblastoma or adrenal samples.

Aberrant methylation at NR4A3 exon 3 CpGi confirmed by using Mass ARRAY EpiTYPER method in additional 17 neuroblastoma specimens

Additional 17 neuroblastoma samples and 1 adrenal sample were used to confirm aberrant methylation at NR4A3 exon 3 CpGi. Adding a new adrenal sample, all the 4 adrenal samples were hypermethylated at NR4A3 exon 3 CpGi. The average methylation level in 4 adrenal samples was 64.6±2.1%. The methylation level of neuroblastoma specimens varied from *83.3±.. to *−0.5±0.9%, and the average value of the all samples was 27.0±25.8%, which was significantly lower than the average methylation level of 4 normal samples (p=0.005, Mann-Whitney U test) (Table I, Fig. 3A). In 17 out of 20 neuroblastoma specimens, methylation levels at NR4A3 exon 3 CpGi were low, compared with the average methylation level in 4 adrenal samples. Methylation level in 9 MYCN amplified neuroblastoma specimens was significantly lower, compared with that in 11 specimens without MYCN amplification (Fig. 3B) (p=0.005, Mann-Whitney U test).

For Kaplan-Meier analysis, cut off value of the methylation level was calculated as 11.93% by using youden index and the methylation levels of 20 patients passed the observation period. Twenty neuroblastoma patients were divided into two groups depending on their methylation levels at the NR4A3 exon 3 regions. The hypermethylation group has methylation level higher than the cut off value, and the hypomethylation group showed lower than that. Eight out of 20 neuroblastoma specimens were classified to hypomethylation group. There was significant association between the methylation level at NR4A3 exon 3 CpGi and patient outcome (p=0.034, log-rank test) (Fig. 3C).

Immunohistochemical staining (IHC)

Immunohistochemical analysis using NR4A3 antibody showed a strong signal in adrenal tissue sections and pronounced cytoplasmic staining. On the other hand, faint staining was seen in neuroblastoma specimens (Fig. 4).

Correlation between NR4A3 exon 3 CpGi methylation and NR4A3 protein expression in neuroblastoma cells

The average methylation level at NR4A3 exon 3 CpGi in NB9 cells was 44±23.2%, on the other hand, it was 97.1±5.8% in NB69 cell (Fig. 5A and B). Western blot analysis revealed higher expression level of NR4A3 protein in NB69 compared with NB9 (Fig. 5C). This result also indicates that NR4A3 protein expression was correlated with NR4A3 exon 3 CpGi methylation in human neuroblastoma cell lines.

Chromatin immunoprecipitation assays

We examined chromatin immunoprecipitation assays to elucidate the mechanism in which methylation level of NR4A3 exon 3 CpGi regulates the expression level. DNA purified from the immunoprecipitated chromatin using anti-CTCF antibody was amplified by PCR for a candidate CTCF binding site of NR4A3 exon 3. In this analysis, the amplified PCR fragment was detected clearly in NB9 cells, but not in NB69 (Fig. 5D).

Discussion

Many studies have shown that epigenetic alterations, especially aberrant DNA methylation, were involved in the development of various adult tumors (20,21). In neuroblastomas, aberrantly methylated genes, 64% for THBS1; 30% for TIMP-3; 27% for MGMT; 25% for p73; 18% for RB1; 14% for DAPK, p14ARF, p16INK4a and CASP8, respectively, and 0% for TP53 and GSTP1 have been reported and the striking differences in methylation status within neuroblastomas has suggested the existence of methylator phenotype, which might be associated with more aggressive forms of neuroblastoma (22,23). Neuroblastoma development is associated with aberration of neural differentiation, and we have reported that aberrant methylation in neuroblastoma at T-/DS-DMR, which plays an important role in differentiation and development (24).

Development of neuroblastoma is related with aberration of the function of neural development factors, such as NGF-dependent tyrosine kinase receptor TrkA activation, relating to differentiation in normal and neoplastic neuronal cells. NR4A are reported to play an important role in the development of neurons (25) and in the regulation of neural function (26). NR4A belongs to a group of early responsive genes, mediating fast response to pleiotropic extracellular stimuli. They bind to NGFI-B response element (NBRE), induce the downstream genes and affect many type of biological function such as oxidative metabolism, cell proliferation, differentiation, apoptosis and dopamine functions in the brain (9,27). In view of their role in brain function, it was reported that NR4A genes, including NR4A3, were induced by psychoactive drugs such as cocaine, morphine, haloperidol and clozapine (28). In cultured cerebellar granule neurons, NR4A transcripts translocated from nucleus to mitochondria during excitotoxicity, contributing to the induction of apoptosis (29).

Our present data about mouse brains also indicate the involvement of NR4A3 and its exon 3 CpGi methylation in the neural development. In the analysis of neuroblastoma specimens, NR4A3 exon 3 CpGi showed low methylation level in neuroblastoma compared with adrenal samples. In addition, hypermethylation of the NR4A3 exon 3 CpGi was significantly associated with favorable outcome. Since there was a correlation between methylation level at NR4A3 exon 3 CpGi and NOR1 expression, our present data suggest that NOR1 expression level and its genome methylation could be prognostic biomarkers in neuroblastoma.

Methylation of CpG sites at exonic region may be linked to epigenetic remodeling of genomic DNA structure. One of the factors is CCCTC binding factor (CTCF), which is highly conserved in higher eukaryotes. CTCF binds to CTCF-binding sites, and this binding is often regulated by DNA methylation. Of the CTCF-binding sites 45% are located on intergenic, 7% 5′-untranslated region (UTR), 3% exonic, 29% intronic and 20% within 2.5 kb of promoters. H19 DMR is one of CTCF-binding sites and its methylation level is related to epigenetic remodeling, which is co-localized with cohesion. Aberrant regulation of CTCF expression is associated with occurrence of cancers, such as colorectal carcinoma (18,30,31). Our present study showed that CTCF can coimmunoprecipitate with a CTCF binding site within NR4A3 exon 3 CpGi in NB9 cells but not in NB69 cells. This suggests hypermethylation of NR4A3 exon 3 CpGi in NB69 cells may inhibit its binding to the CTCF and therefore initiate expression of NOR1. This expression regulation via CTCF binding may be a mechanism of NOR1 down-regulation and involved in advanced neuroblastomas and/or neuronal de-differentiation.

This is the first report indicating that DNA methylation level of NR4A3 exon 3 CpGi is associated with NOR1 expression and aberrantly methylated in neuroblastomas. In addition, our present data suggest that hypermethylation of this region might be one of the prognostic factors in this tumor. Although further analyses are necessary to elucidate the regulation mechanism of NOR1 expression and its function, our present data strongly suggest that this gene could be involved in neural differentiation and human neuroblastomagenesis.

Abbreviations:

T-DMRs

tissue-specific differentially methylated regions;

DS-DMRs

developmental stage differentially methylated regions;

CpGi

CpG island;

E15

15-day-old embryo;

NB

new born;

AD

12-week adult;

TrkA

tropomyosin receptor kinase A;

NGF

nerve growth factor;

hMC

homogeneous MassCLEAVE;

MALDI-TOF MS

matrix-assisted laser desorption/ionization time-of-flight mass spectrometry;

Tm

melting temperature;

PCR

polymerase chain reaction;

TBS

Tris-buffered saline;

PBS

phosphate-buffered saline;

CTCF

CCCTC binding factor;

UTR

untranslated region;

AUF1

AU-rich element binding factor 1;

HUR

Hu antigen R

Acknowledgements

This study was supported by Nihon University Multidisciplinary Research Grant for 2006 (to H.N.), the Academic Frontier Project for 2006 Project for Private Universities, a matching fund subsidy from MEXT (to H.N.), National Cancer Institute Grant CA102423 (to W.A.H and H.N.), National Cancer Institute Center Support Grant CA16056 (to Roswell Park Cancer Institute) and Grant-in-Aid from the Ministry of Education, Science, Sports and Culture of Japan (grant nos. 20592092 and 23300344).

References

1. 

De Bernardi B, Nicolas B, Boni L, Indolfi P, Carli M, Cordero Di, Montezemolo L, Donfrancesco A, Pession A, Provenzi M, di Cataldo A, Rizzo A, Tonini GP, Dallorso S, Conte M, Gambini C, Garaventa A, Bonetti F, Zanazzo A, D’Angelo P and Bruzzi P: Disseminated neuroblastoma in children older than one year at diagnosis: comparable results with three consecutive high-dose protocols adapted by the Italian Co-Operative Group for Neurobalstoma. J Clin Oncol. 21:1592–1601. 2003.

2. 

Matthay KK, Villablanca JG, Seeger RC, Stram DO, Harris RE, Ramsay NK, Swift P, Shimada H, Black CT, Brodeur GM, Gerbing RB and Reynolds CP: Treatment of high-risk neuroblsatoma with intensive chemotherapy, radiotherapy, autologous bone marrow transplantation, and 13-cis-retinoic acid. Children’s Cancer Group N Engl J Med. 341:1165–1173. 1999.PubMed/NCBI

3. 

Wang H, Lee S, Nigro CL, Lattanzio L, Merlano M, Monteverde M, Matin R, Purdie K, Mladkova N, Bergamaschi D, Harwood C, Syed N, Szlosarek P, Briasoulis E, McHugh A, Thompson A, Evans A, Leigh I, Fleming C, Inman GJ, Hatzimichael E, Proby C and Crook T: NT5E (CD73) is epigenetically regulated in malignant melanoma and associated with metastatic site specificity. Br J Cancer. 106:1446–1452. 2012. View Article : Google Scholar : PubMed/NCBI

4. 

Geiman TM and Muegge K: DNA methylation in early development. Mol Reprod Dev. 77:105–113. 2010.

5. 

Bird A: DNA methylation patterns and epigenetic memory. Genes Dev. 16:6–21. 2002. View Article : Google Scholar

6. 

Weber M, Hellmann I, Stadler MB, Ramos L, Pääbo S, Rebhan M and Schübeler D: Distribution, silencing potential and evolutionary impact of promoter DNA methylation in the human genome. Nat Genet. 39:457–466. 2007. View Article : Google Scholar : PubMed/NCBI

7. 

Song F, Smith JF, Kimura MT, Morrow AD, Matsuyama T, Nagase H and Held WA: Association of tissue-specific differentially methylated regions (TDMs) with differential gene expression. Proc Natl Acad Sci USA. 102:3336–3341. 2005. View Article : Google Scholar : PubMed/NCBI

8. 

Eckhardt F, Lewin J, Cortese R, Rakyan VK, Attwood J, Burger M, Burton J, Cox TV, Davies R, Down TA, Haefliger C, Horton R, Howe K, Jackson DK, Kunde J, Koenig C, Liddle J, Niblett D, Otto T, Pettett R, Seemann S, Thompson C, West T, Rogers J, Olek A, Berlin K and Beck S: DNA methylation profiling of human chromosomes 6, 20 and 22. Nat Genet. 38:1378–1385. 2006. View Article : Google Scholar : PubMed/NCBI

9. 

Zhao Y and Bruemmer D: NR4A orphan nuclear receptors: transcriptional regulators of gene expression in metabolism and vascular biology. Arterioscler Thromb Vasc Biol. 30:1535–1541. 2010. View Article : Google Scholar : PubMed/NCBI

10. 

Maxwell MA and Muscat GE: The NR4A subgroup: immediate early response genes with pleiotropic physiological roles. Nucl Recept Signal. 4:e0022006. View Article : Google Scholar : PubMed/NCBI

11. 

Song F, Mahmood S, Ghosh S, Liang P, Smiraglia DJ, Nagase H and Held WA: Tissue specific differentially methylated regions (TDMR): Changes in DNA methylation during development. Genomics. 93:130–139. 2009. View Article : Google Scholar : PubMed/NCBI

12. 

Li LC and Dahiya R: MethPrimer: designing primers for methylation PCRs. Bioinformatics. 18:1427–1431. 2002. View Article : Google Scholar : PubMed/NCBI

13. 

Ehrich M, Nelson MR, Stanssens P, Zabeau M, Liloglou T, Xinarianos G, Cantor CR, Field JK and van den Boom D: Quantitative high-throughput analysis of DNA methylation patterns by base-specific cleavage and mass spectrometry. Proc Natl Acad Sci USA. 102:15785–15790. 2005. View Article : Google Scholar : PubMed/NCBI

14. 

Fatemi M, Pao MM, Jeong S, Gal-Yam EN, Egger G, Weisenberger DJ and Jones PA: Footprinting of mammalian promoters: use of a CpG DNA mehtyltransferase revealing nucreosome positions at a single molecule level. Nucleic Acids Res. 33:e1762005. View Article : Google Scholar : PubMed/NCBI

15. 

Baxter EW, Cummings WJ and Fournier REK: Formation of a large, complex domain of histone hyperacetylation at human 14q32.1 requires the serpin locus control region. Nucleic Acids Res. 33:3313–3322. 2005. View Article : Google Scholar : PubMed/NCBI

16. 

Orlando V, Strutt H and Paro R: Analysis of chromatin structure by in vivo formaldehyde cross-linking. Methods. 11:205–214. 1997. View Article : Google Scholar : PubMed/NCBI

17. 

Bowers SR, Mirabella F, Calero-Nieto FJ, Valeaux S, Hadjur S, Baxter EW, Merkenschlager M and Cockerill PN: A conserved insulator that recruits CTCF and cohesin exists between the closely related but divergently regulated interleukin-3 and granulocyte-macrophage colony-stimulating factor genes. Mol Cell Biol. 29:1682–1693. 2009. View Article : Google Scholar

18. 

Ishihara K, Oshimura M and Nakao M: CTCF-dependent chromatin insulator is linked to epigenetic remodeling. Mol Cell. 23:733–742. 2006. View Article : Google Scholar : PubMed/NCBI

19. 

Akoben AK: Understanding diagnostic tests 3: Receiver operating characteristic curves. Acta Paediatr. 96:644–647. 2007. View Article : Google Scholar : PubMed/NCBI

20. 

Egger G, Liang G, Aparicio A and Jones PA: Epigenetics in human disease and prospects for epigenetic therapy. Nature. 27:457–463. 2004. View Article : Google Scholar

21. 

Laird PW: Cancer epigenetics. Hum Mol Genet. 15:65–76. 2005. View Article : Google Scholar

22. 

Gonzalez-Gomez P, Bello MJ, Lomas J, Arjona D, Alonso ME, Amiñoso C, Lopez-Marin I, Anselmo NP, Sarasa JL, Gutierrez M, Casartelli C and Rey JA: Aberrant methylation of multiple genes in neuroblastic tumours. relationship with MYCN amplification and allelic status at 1p. Eur J Cancer. 39:1478–1485. 2003. View Article : Google Scholar : PubMed/NCBI

23. 

Banelli B, Vinci AD, Gelvi I, Casciano I, Allemanni G, Bonassi S and Romani M: DNA methylation in neuroblastic tumors. Cancer Lett. 228:37–41. 2005. View Article : Google Scholar : PubMed/NCBI

24. 

Kawashima H, Sugito K, Yoshizawa S, Uekusa S, Furuya T, Ikeda T, Koshinaga T, Shinojima Y, Hasegawa R, Mishra R, Igarashi J, Kimura M, Wang X, Fujiwara K, Gosh S and Nagase H: DNA hypomethylation at the ZNF206-exon 5 CpG island associated with neuronal differentiation in mice and development of neuroblastoma in humans. Int J Oncol. 40:31–39. 2012.PubMed/NCBI

25. 

Zetterström RH, Williams R, Perlmann T and Olson L: Cellular expression of the immediate early transcription factors Nurr1 and NGFI-B suggests a gene regulatory role in several brain regions including the nigrostriatal dopamine system. Brain Res Mol Brain Res. 5:111–120. 1996.

26. 

Ohkura N, Ito M, Tsukada T, Sasaki K, Yamaguchi K and Miki K: Structure, mapping and expression of a human NOR-1 gene, the third member of the Nur77/NGFI-B family. Biochim Biophys Acta. 1308:205–214. 1996. View Article : Google Scholar : PubMed/NCBI

27. 

Eells JB, Wilcots J, Sisk S and Guo-Ross SX: NR4A gene expression is dynamically regulated in the ventral tegmental area dopamine neurons and is related to expression of dopamine neurotransmission genes. J Mol Neurosci. 46:545–553. 2012. View Article : Google Scholar

28. 

Werme M, Ringholm A, Olson L and Brené S: Differential patterns of induction of NGFI-B, Nor1 and c-fos mRNAs in striatal subregions by haloperidol and clozapine. Brain Res. 863:112–119. 2000. View Article : Google Scholar : PubMed/NCBI

29. 

Boldingh Debernard KA, Mathisen GH and Paulsen RE: Differences in NGFI-B, Nurr1, and NOR-1 expression and nucleocytoplasmic translocation in glutamate-treated neurons. Neurochem Int. 61:79–88. 2012.PubMed/NCBI

30. 

Wendt KS, Yoshida K, Itoh T, Bando M, Koch B, Schirghuber E, Tsutsumi S, Nagae G, Ishihara K, Mishiro T, Yahata K, Imamoto F, Aburatani H, Nakao M, Imamoto N, Maeshima K, Shirahige K and Peters JM: Cohesin mediates transcriptional insulation by CCCTC-binding factor. Nature. 451:796–801. 2008. View Article : Google Scholar : PubMed/NCBI

31. 

Phillips JE and Corces VG: CTCF: master weaver of the genome. Cell. 137:1194–1211. 2009. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

May-2014
Volume 44 Issue 5

Print ISSN: 1019-6439
Online ISSN:1791-2423

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Uekusa S, Kawashima H, Sugito K, Yoshizawa S, Shinojima Y, Igarashi J, Ghosh S, Wang X, Fujiwara K, Ikeda T, Ikeda T, et al: Nr4a3, a possibile oncogenic factor for neuroblastoma associated with CpGi methylation within the third exon. Int J Oncol 44: 1669-1677, 2014
APA
Uekusa, S., Kawashima, H., Sugito, K., Yoshizawa, S., Shinojima, Y., Igarashi, J. ... Nagase, H. (2014). Nr4a3, a possibile oncogenic factor for neuroblastoma associated with CpGi methylation within the third exon. International Journal of Oncology, 44, 1669-1677. https://doi.org/10.3892/ijo.2014.2340
MLA
Uekusa, S., Kawashima, H., Sugito, K., Yoshizawa, S., Shinojima, Y., Igarashi, J., Ghosh, S., Wang, X., Fujiwara, K., Ikeda, T., Koshinaga, T., Soma, M., Nagase, H."Nr4a3, a possibile oncogenic factor for neuroblastoma associated with CpGi methylation within the third exon". International Journal of Oncology 44.5 (2014): 1669-1677.
Chicago
Uekusa, S., Kawashima, H., Sugito, K., Yoshizawa, S., Shinojima, Y., Igarashi, J., Ghosh, S., Wang, X., Fujiwara, K., Ikeda, T., Koshinaga, T., Soma, M., Nagase, H."Nr4a3, a possibile oncogenic factor for neuroblastoma associated with CpGi methylation within the third exon". International Journal of Oncology 44, no. 5 (2014): 1669-1677. https://doi.org/10.3892/ijo.2014.2340