Overexpression of microRNA-5100 decreases the aggressive phenotype of pancreatic cancer cells by targeting PODXL

  • Authors:
    • Yoshiro Chijiiwa
    • Taiki Moriyama
    • Kenoki Ohuchida
    • Toshinaga Nabae
    • Takao Ohtsuka
    • Yoshihiro Miyasaka
    • Hayato Fujita
    • Ryo Maeyama
    • Tatsuya Manabe
    • Atsushi Abe
    • Yusuke Mizuuchi
    • Yoshinao Oda
    • Kazuhiro Mizumoto
    • Masafumi Nakamura
  • View Affiliations

  • Published online on: February 12, 2016     https://doi.org/10.3892/ijo.2016.3389
  • Pages: 1688-1700
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Metastasis is the main cause of cancer-associated death, and metastasis of pancreatic cancer remains difficult to treat because of its aggressiveness. MicroRNAs (miRNAs) play crucial roles in the regulation of various human transcripts, and many miRNAs have been reported to correlate with cancer metastasis. We identified an anti-metastatic miRNA, miR-5100, by investigating differences in miRNA profiling between highly metastatic pancreatic cancer cells and their parental cells. Overexpression of miR-5100 inhibited colony formation (P<0.05), cell migration (P<0.0001) and invasion (P<0.0001) of pancreatic cancer cells. In addition, we identified a possible target of miR-5100, podocalyxin-like 1 (PODXL), and demonstrated miR-5100 directly binds to the 3' untranslated region of PODXL and post-transcriptionally regulates its expression in pancreatic cancer cells. Silencing PODXL resulted in diminished cell migration (P<0.0001) and invasion (P<0.05). We also clarified the close relationship between expression of PODXL in human pancreatic cancer specimens and liver metastasis (P=0.0003), and determined that post-operative survival was longer in the low-PODXL expression group than in the high-PODXL expression group (P<0.05). These results indicate that miR-5100 and PODXL have considerable therapeutic potential for anti-metastatic therapy and could be potential indicators for cancer metastases in patients with pancreatic cancer.

Introduction

Pancreatic cancer is the fourth leading cause of cancer mortality in the United States (1,2). Although efforts to reduce risk factors such as smoking, obesity, and high meat consumption and to improve early detection have been made, pancreatic cancer is still formidable because of its aggressive metastatic ability (36). Pancreatic cancer mainly metastasizes to the lymph nodes, liver, lung, peritoneum and bone. Although the liver is the most common target of pancreatic cancer with the exception of the lymph nodes, effective methods for prediction and treatment of liver metastasis remain unestablished (7,8). Identification of prognostic markers of metastasis would be useful for the management of post-operative patients with pancreatic cancer (911).

MicroRNAs (miRNAs) are small noncoding RNAs of approximately 22 nucleotides that are predicted to regulate as many as 30% of human transcripts (12,13). Several recent investigations have identified some miRNAs as potential critical regulators to inhibit the malignant characteristics of tumors (1418). miRNAs suppress expression of many target genes at the post-transcriptional level by binding to their 3′ untranslated regions (UTR), which leads to inhibition of translation or degradation of messenger RNAs (mRNAs) (12,19). The miR-200 family and miR-205 were reported to regulate epithelial to mesenchymal transition of breast cancer cells by targeting ZEB1 and SIP1 (20), and miR-34a was reported to inhibit prostate cancer stem cells and metastasis by directly repressing CD44 (21). Regarding pancreatic cancer, ZEB1 was reported to promote tumorigenicity of pancreatic cancer by repressing the miR-200 family (22), and miR-10a was reported to promote metastatic behavior of pancreatic tumor cells (23). Several miRNAs that may correlate with liver metastasis of pancreatic cancer were also reported (24), but the mechanism is still unclear. We performed miRNA expression profiling with a microarray using newly-established pancreatic cancer cell lines with high potential for liver metastasis, and identified miR-5100 as a candidate gene related to liver metastasis of pancreatic cancer. In addition, we focused on podocalyxin-like 1 (PODXL), which was predicted as a target of miR-5100 using online target-predicting algorithms of miRNAs based on the global mRNA expression profiling with the microarray.

PODXL was initially identified in podocytes of renal glomeruli that are instrumental in kidney development (25,26). Expression of PODXL was identified in podocytes, hematopoietic progenitors, vascular endothelia and embryonic stem cells (2730) and it was reported to promote anti-adhesive and migratory characteristics of various cancer cells except for pancreatic cancer (3135). Recent studies showed that increased expression of PODXL is correlated with poor prognoses in many types of cancer (3641). Although the expression of PODXL has been reported to promote anti-adhesion and migration, how PODXL correlates with tumor metastases remains unclear, especially in pancreatic cancer (33).

In this study, we identify an anti-metastatic miRNA, miR-5100, that decreases the metastatic ability of pancreatic cancer partially by suppressing expression of PODXL.

Materials and methods

Cell culture

The following eleven pancreatic cancer cell lines and HPDE cells were used in this study: Panc-1 (Riken Cell Bank, Tsukuba, Japan), KP-2, KP-3, SUIT-2 and MIA PaCa-2 (Japanese Cancer Resource Bank, Osaka, Japan), Capan-1, Capan-2, Aspc-1, SW1990, HS766T, CFPAC-1 (American Type Culture Collection, Manassas, VA, USA), and HPDE (Dr M.-S. Tsao, University of Toronto, Toronto, Canada). All cancer cell lines were maintained in Dulbecco's modified Eagle's medium (DMEM; Life Technology, Grand Island, NY, USA) supplemented with 10% fetal bovine serum (FBS; Invitrogen, Carlsbad, CA, USA), streptomycin (100 mg/ml) and penicillin (100 mg/ml) and cultured at 37ºC in a humidified atmosphere containing 10% CO2.

Establishment of metastatic SUIT-2 cells and metastatic PANC-1 cells

We bred BALB/c nu/nu mice (Kyudo Co., Saga, Japan) and used them at the age of 4 weeks in accordance with institutional guidelines. The parental SUIT-2 cells (1×106 cells) were orthotopically transplanted. The mice were sacrificed at 5–7 weeks after implantation of cancer cells. Liver metastases were harvested and minced. We performed primary culture using minced tissue with collagenase. The cell culture was then orthotopically transplanted. This process was repeated five times to establish metastatic SUIT-2 (MS) cells. Metastatic PANC-1 (MP) cells were established by the same process.

Total RNA extraction

Total RNA was extracted from cultured cells using a High Pure RNA Isolation kit (Roche Diagnostics, Mannheim, Germany) and DNase I (Roche Diagnostics) treatment according to the manufacturer's instructions.

Microarray analyses

We carried out microarray analyses using the parental SUIT-2 and MS cells and parental PANC-1 and MP cells. We used the 3D-Gene miRNA microarray platform (Toray, Kamakura, Japan) for these analyses.

Data analysis and filter criteria

Raw signal intensities of two samples were normalized by a quantile algorithm with the ‘lumi’ (42) and ‘preprocess Core’ library package (43) on Bioconductor software (44). We selected probes that called the ‘Detection P-value <0.05’ flag in at least one sample. To identify up- or down-regulated genes, we calculated intensity-based Z-scores (45) and ratios (non-log scaled fold-change) from the normalized signal intensities of each probe for comparison between control and experiment samples. Then we established criteria for regulated genes: (upregulated genes) Z-score ≥2.0 and ratio ≥1.5-fold, (downregulated genes) Z-score ≤−2.0 and ratio ≤0.7.

Cell transfection

miR-5100 mimics and negative control mimics were synthesized by TaqMan (Life Technologies, Tokyo, Japan) and transfected into cells to a final oligonucleotide concentration of 3–30 nmol/l. Transfection was performed using Lipofectamine 2000 Reagent (Invitrogen) following the manufacturer's protocol. Cells were trypsinized, counted and seeded in plates on the day before transfection to ensure suitable cell confluence.

PODXL knockdown by small-interfering RNA (siRNA)

SiRNA targeting PODXL and non-targeting siRNA control were purchased from Sigma-Aldrich Japan (Hokkaido, Japan). Transfection was performed according to the manufacturer's reverse-transfection protocol using Lipofectamine RNAiMAX (Life Technology). In brief, siRNAs and Lipofectamine (5 μl) were diluted in 500 μl Opti-MEM (Life Technology, Tokyo, Japan) without serum, and incubated for 15 min at room temperature. Cancer cells (2×105) were resuspended in 2.5 ml of DMEM supplemented with 10% FBS without antibiotics. The siRNA and Lipofectamine mixture was added to the diluted cells (3 ml final volume, final siRNA concentration 30 nM and seeded in 6-well plates (2×105 cells/well). After 24 h incubation, plates were washed and cells were incubated in complete growth medium (DMEM with 10% FBS and antibiotics) for various time points. Cancer cells were used in subsequent experiments at 48-h post-transfection.

Blocking specific binding site of miR-5100 by protector

Protector (miScript Target Protector) was designed and purchased from Qiagen (Tokyo, Japan) to block the binding site of miR-5100. Transfection was performed according to the manufacturer's protocol using lipofectamine RNAiMAX (Life Technology) as described above.

Quantitative real-time reverse-transcription polymerase chain reaction for analysis of miRNA expression

Cultured cells were analyzed by quantitative (q)RT-PCR using SuperTaq Polymerase (Ambion) and a mirVana RT-PCR miRNA Detection kit (Ambion) according to the manufacturer's instructions. All reactions were performed in triplicate. The miRNA expression levels in each sample were normalized by the expression levels of U6 snRNA.

Quantitative assessment of mRNA levels by one-step qRT-PCR

qRT-PCR was performed using a Quantitect SYBR Green Reverse-Transcription PCR kit (Qiagen) and CFX96 Touch Real-Time PCR Detection System (Bio-Rad Laboratories, Hercules, CA, USA). Primers for PODXL (Forward: GCT GCAAACACAGCATGGAG; Reverse: CAGTTCCTGGGCAAACTGTTGA) and GAPDH (Forward: GCACCGTCAAGGCTGAGAAC; Reverse: TGGTGAAGACGCCAGTGGA) were purchased from Takara Bio Inc. (Tokyo, Japan). We used an endogenous control, GAPDH, to normalize expression of mRNA. All reactions were performed in triplicate.

Western blot analysis

Cultured pancreatic cancer cells were lysed in PRO-PREP protein extraction solution (iNtRON Biotechnology, Seongnam, Korea) according to the manufacturer's instructions. A total of 20 μg protein was separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis and transferred to polyvinylidene difluoride membranes (Bio-Rad Laboratories). The membranes were blocked with 5% dry skimmed milk and incubated with anti-PODXL rabbit monoclonal antibody (EPR9518, 1/1000 dilution; Abcam, Cambridge, UK) and anti-actin antibody (1/5000 dilution; Abcam). Membranes were then incubated with anti-rabbit IgG (1/2000 dilution, Cell Signaling Technology, Danvers, MA, USA). Immunoreactive signals were detected using ECL Prime (GE Healthcare, Buckinghamshire, UK), and images were acquired using a ChemiDoc XRS (Bio-Rad Laboratories).

Patients

Tissue samples were obtained from primary pancreatic tumors at the time of surgery at Kyushu University Hospital (Fukuoka, Japan) from 2010 to 2011. No adjuvant therapy was performed in six patients because of poor performance status, whereas 64 patients received adjuvant therapy based on 5-fluorouracil and/or gemcitabine. Neoadjuvant therapy was performed in one patient. This study was approved by the Ethics Committee of Kyushu University and conducted according to the Ethical Guidelines for Human Genome/Gene Research enacted by the Japanese Government and the Declaration of Helsinki.

Immunohistochemical procedures and evaluation of sections

Primary antibody used for immunohistochemical analysis was as follows: PODXL (rabbit monoclonal, EPR9518, 1/250 dilution; Abcam). Antibody was diluted in 5% dry skimmed milk in phosphate-buffered saline. Sections were cut at 4 μm thickness from paraffin-embedded material, deparaffinized in xylene and dehydrated through a graded ethanol series. Endogenous peroxidase activity was blocked by incubation in methanol containing 3% H2O2 for 30 min. Antigen retrieval was achieved by boiling slides in a microwave in 10 mM citrate buffer (pH 6.0) for 20 min. The slides were then incubated with an anti-PODXL rabbit monoclonal antibody (EPR9518, 1/250 dilution; Abcam) at 4ºC overnight, and the Envision plus system (Dako, Glostrup, Denmark) was used to visualize the immunostaining. Counterstaining was performed with hematoxylin. Appropriate positive and negative controls were performed for all antibodies. Non-specific staining was not observed in any negative-control sections.

The distribution of stained PODXL was evaluated as the percentage of stained cells, which was scored as follows: 1, ≤10%; 2, 11–50%; 3, 51–80%; and 4, >81%. The distribution of stained PODXL was also evaluated as staining intensity, which was scored as follows: 1, no or weak staining; 2, moderate; and 3, strong. When the multiplication product of the 2 scores was ≥4, PODXL was considered highly stained, and vascular endothelial cells were compared as the positive control. All slides were evaluated without any knowledge of the background of each case.

Invasion and migration assays

Cell invasion was evaluated by counting the number of cells that invaded Matrigel-coated Transwell chambers with 8-μm pores (BD Biosciences, Franklin Lakes, NJ, USA). Briefly, Transwell inserts were coated with 20 μg/well Matrigel (BD Biosciences). Each lower well of a 24-well plate was seeded with 750 μl of DMEM supplemented with 10% FBS. Cancer cells (5.0×104/well) in 250 μl of DMEM supplemented with 10% FBS were seeded into each upper well. After 48–72 h of incubation, cells on the lower surface of the Matrigel-coated membrane were fixed with 70% ethanol, stained with hematoxylin and eosin (H&E), and counted in five randomly selected fields at ×100 magnification under a light microscope. The mobility of pancreatic cancer cells was assessed using uncoated Transwell inserts after 16–36 h of incubation. The results are expressed as the mean number of invaded and migrated cells per field. Each experiment was carried out in triplicate wells and repeated at least three times.

Adhesion and colony formation assays

Cell adhesion was evaluated by counting the number of cells that adhered to 96-well tissue culture plates (Becton Dickinson Labware, Franklin Lakes, NJ, USA) after seeding cells (1×103/well) for 15 min. Anchorage-independent growth was evaluated by colony formation in soft agar. Cells (1×103/well) were diluted in DMEM with 10% FBS and 0.35% Bacto-Agar (Difco, Detroit, MI, USA), and seeded in 6-well plates on top of a 0.7% agar bottom layer without cells. Cells were incubated for 14 days, and growth medium (DMEM with 10% FBS) was replaced biweekly. Adhered cells and colonies were stained with crystal violet (0.005%) for 20 min and counted under a light microscope.

In vivo experiments

To analyze the metastatic ability of MS cells in vivo, SUIT-2 cells (1×106) and MS cells (1×106) suspended in 100 ml DMEM were orthotopically transplanted into the 4-week-old female BALB/c nu/nu mice. At 5–7 weeks after implantation, we sacrificed the mice and all orthotopic tumors and livers were investigated. The presence of liver metastasis was evaluated by counting the number of nodules >1 mm in size on the surface of the liver. All mouse experiments were approved by the Ethics Committee of Kyushu University.

Statistical analysis

All calculations were performed with JMP 11 software (SAS Institute, Cary, NC, USA). Differences in expression levels were analyzed with Student's t-test. For qRT-PCR data, each sample was analyzed twice or in triplicate. Any sample showing a deviation in value of >10% was tested a third time. Data were analyzed by the Mann-Whitney U-test when normal distribution was not obtained. A Chi-square test was used to analyze the association between PODXL expression and clinicopathological characteristics observed by immunohistochemistry. Survival analysis was undertaken using Kaplan-Meier analysis, and survival functions were compared using the log-rank test. To evaluate independent prognostic factors associated with survival, a multivariate Cox proportional hazards regression analysis was performed. All differences were considered to be statistically significant if the P-value was <0.05 (P<0.05; P<0.0001).

Results

Establishment and characterization of a highly metastatic pancreatic cancer cell line

After five consecutive rounds of in vivo selection of liver metastasis, metastatic lesions were harvested to establish metastatic SUIT-2 (MS) cells. After we confirmed that MS cells occurred in liver metastases more frequently than the parental SUIT-2 cells (Fig. 1A), we investigated the in vitro characteristics of MS cells. The MS cells had spindle-shaped morphology compared with their parental SUIT-2 cells (Fig. 1B). To evaluate migration, invasion, and adhesion, we performed a migration assay, an invasion assay, and an adhesion assay. In these assays, we found that migration and invasion of MS cells were increased and adhesion of MS cells was decreased compared with that of the parental SUIT-2 cells (Fig. 1C, D and E).

Comparison of miRNA expression between MS cells and parental SUIT-2 cells

We next used MS cells and parental SUIT-2 cells for microarray analyses and investigated their differences by miRNA profiling. Microarray analyses showed that 13 miRNAs were downregulated and 15 miRNAs were upregulated in MS cells compared with parental SUIT-2 cells (Table I). Of these candidates, we focused on miR-5100 because it was also downregulated in metastatic PANC-1 (MP) cells established in the same manner (Table II).

Table I

Microarray analysis of miRNAs in MS cells compared with parental SUIT-2 cells.

Table I

Microarray analysis of miRNAs in MS cells compared with parental SUIT-2 cells.

NameSUIT-2MSRatioNameSUIT-2MSRatio
hsa-miR-192-5p238.363.60.27hsa-miR-470633.9257.47.59
hsa-miR-194-5p430.1126.60.29hsa-miR-432461.2138.52.26
hsa-miR-21-5p982.8309.10.31 hsa-miR-125b-5p378.2825.62.18
hsa-miR-27b-3p168.269.40.41hsa-miR-124669.1138.32.00
hsa-miR-4755-3p156.565.00.42hsa-miR-1260a355.5681.31.92
hsa-miR-224-5p128.760.60.47hsa-miR-1260b1753.53167.31.81
hsa-miR-1247-5p101.548.00.47hsa-miR-3178189.2333.01.76
hsa-miR-16-5p291.2143.90.49 hsa-miR-1273g-3p754.11322.51.75
hsa-miR-5100683.6344.00.50 hsa-miR-1915-3p65.3114.01.75
hsa-miR-26a-5p473.4259.90.55hsa-miR-118170.2121.31.73
hsa-miR-1972126.675.10.59hsa-miR-61464.2106.61.66
hsa-miR-652-5p168.4111.30.66 hsa-miR-1285-3p112.9180.91.60
hsa-miR-445415681.710780.50.69 hsa-miR-3940-5p72.5116.21.60
---- hsa-miR-1233-1-5p320.8506.61.58
----hsa-miR-4530200.9304.71.52

[i] MS, metastatic SUIT-2. Bold text indicates the genes that the present study focuses on.

Table II

Microarray analysis of miRNAs in MP cells compared with parental PANC-1 cells.

Table II

Microarray analysis of miRNAs in MP cells compared with parental PANC-1 cells.

NamePANC-1MPRatioNamePANC-1MPRatio
hsa-miR-377-5p126.317.80.14 hsa-miR-2964a-5p34.2118.03.45
hsa-miR-5100327.9156.50.48hsa-miR-3135b30.0102.93.43
hsa-miR-445410154.75258.00.52 hsa-miR-1247-3p58.6114.31.95
hsa-miR-151a-5p106.164.00.60 hsa-miR-365a/b-3p93.5175.71.88
hsa-let-7i-5p188.4115.30.61hsa-miR-429958.3105.21.80
hsa-miR-93-5p220.6137.30.62hsa-miR-13458.4104.91.80
hsa-miR-1260a1462.2953.10.65hsa-miR-494221.9368.91.66
----hsa-miR-608794.5151.61.60
----hsa-miR-652-5p101.0159.81.58
---- hsa-miR-4667-5p83.8130.71.56
----hsa-miR-37084.4130.81.55
---- hsa-miR-4745-5p110.2167.41.52

[i] MP, metastatic PANC-1. Bold text indicates the genes that the present study focuses on.

To validate the accuracy of microarray analyses, we investigated the expression levels of miR-5100 in cultures of 13 different pancreatic cancer cell lines and Human Pancreatic Duct Epithelial Cell (HPDE) using quantitative real-time reverse-transcription polymerase chain reaction (RT-PCR). HPDE cells showed relatively high expression of miR-5100, and most pancreatic cancer cell lines showed lower miR-5100 expression compared with that of HPDE cells (Fig. 2A). MS cells showed extremely low expression of miR-5100 and KP2 cells showed similar levels. To explore the role of miR-5100 in pancreatic cancer, MS and KP2 cells were transfected with miR-5100 mimics with high levels of transfection efficiency (Fig. 2B, upper panel). The morphology of miR-5100-transfected MS cells was not remarkably changed compared with control miRNA-transfected MS cells (Fig. 2B, lower panel). Colony formation assays revealed that cell population growth was significantly decreased in miR-5100-transfected cells compared with control miRNA-transfected cells (Fig. 2C). miR-5100 also inhibited cell migration and invasion in MS and KP2 cells (Fig. 2D and E). In contrast, adhesion of miR-5100-transfected MS cells was increased compared with control miRNA-transfected cells, while miR-5100-transfected KP2 cells showed no significant change in adhesion compared with control miRNA-transfected cells (Fig. 2F). These results indicate that miR-5100 decreases the aggressiveness of pancreatic cancer in MS and KP2 cells.

Identification of possible target genes of miR-5100

miRNAs exert biological functions through negatively regulating their target genes. We performed microarray analyses for global mRNA expression profiling and used online target-predicting algorithms, Target Miner, Target Scan and Mir Database, to predict the possible target genes sharing a complementary sequence with miR-5100. As shown in Table III, we found several possible candidate genes as targets of miR-5100 in MS cells. Of these genes, we focused on PODXL because it is a prognostic marker in many types of cancers (3641). We investigated the expression levels of PODXL in cultures of 12 different pancreatic cancer cell lines and HPDE cells using quantitative RT-PCR. The majority of pancreatic cancer cell lines expressed PODXL, while HPDE cells showed extremely low expression of PODXL (Fig. 3A).

Table III

Possible target genes of miR-5100 predicted by Target Miner, Target Scan and Mir Database.

Table III

Possible target genes of miR-5100 predicted by Target Miner, Target Scan and Mir Database.

SymbolDefinitionZ scoreRatio
DCLK1Doublecortin-like kinase 16.466.24
CLEC2DC-type lectin domain family 2, member D5.675.44
LOXLysyl oxidase5.154.30
PODXLPodocalyxin-like 1(PODXL), transcript variant 14.393.71
DCBLD2Discoidin, CUB and LCCL domain containing 2 (DCBLD2)3.263.05
ADRB2Adrenergic, β-2-, receptor, surface (ADRB2)3.852.98
TSPAN13Tetraspanin 13 (TSPAN13)3.372.74
CDK6Cyclin-dependent kinase 6 (CDK6)3.182.59
RERGRAS-like, estrogen-regulated, growth inhibitor (RERG)7.572.52
LACTBLactamase, β (LACTB), nuclear gene encoding mitochondrial protein, transcript variant 12.912.38

[i] Bold text indicates the genes that the present study focuses on.

miR-5100 directly regulates expression of PODXL

PODXL has seven specific nucleotides at its 3′UTR that have the ability to bind miR-5100 (Fig. 3B) and transfection of miR-5100 showed a concentration-dependent reduction in PODXL expression in MS and SW1990 cells (Fig. 3C). The effect of miR-5100 on translation of PODXL was assessed by protecting the binding site of PODXL. miR-5100 mimic-transfected MS cells showed approximately 50% decrease in PODXL expression levels and the decrease was partially relieved by blocking the binding site of PODXL 3′UTR (Fig. 3D, left panel). SW1990 cells showed similar results (Fig. 3D, right panel). These results indicate that miR-5100 directly binds to the 3′UTR of PODXL and post-transcriptionally regulates PODXL expression in MS and SW1990 cells.

RNA silencing of PODXL inhibits migration and invasion of pancreatic cancer cells

To explore the roles of PODXL in pancreatic cancer, we suppressed PODXL in MS (Fig. 4A) and CAPAN-2 cells using RNA interference. The morphology of PODXL-knockdown MS cells was not remarkably changed compared with control siRNA-transfected cells. Knockdown of PODXL in MS and CAPAN-2 cells resulted in diminished cell migration and invasion compared with control siRNA-transfected cells (Fig. 4B and C). These results indicate that PODXL promotes the aggressiveness of pancreatic cancer in MS and CAPAN-2 cells.

Associations between PODXL expression and clinicopathological factors in pancreatic cancer

To evaluate the correlation of PODXL expression in human specimens from pancreatic cancer patients with clinicopathological factors, we divided all pancreatic cancer patients into two groups: a high-PODXL expression group (n=16) and a low-PODXL expression group (n=54) (Fig. 5A). We compared the clinicopathological differences between the groups (Table IV). These included patient age (<65 vs. ≥65 years), lymph node metastasis, liver metastasis, distant metastasis (liver, lung, peritoneum and bone), lymphatic invasion, vascular invasion, perineural invasion, Union for International Cancer Control (UICC) stage (I/II vs. III/IV), and pathologic margin. There were no significant differences in age, lymph node metastasis, lymphatic invasion, perineural invasion, UICC stage and pathologic margin between the high-PODXL expression and low-PODXL expression groups. On the contrary, liver metastasis, distant metastasis and vascular invasion were observed more frequently in the high PODXL expression group than in the low PODXL expression group (P<0.05 each). These results indicate that PODXL expression is associated with metastatic rate in post-operative patients with pancreatic cancer.

Table IV

Relationship between PODXL expression and clinicopathological factors.

Table IV

Relationship between PODXL expression and clinicopathological factors.

CharacteristicsPODXL-low (n=54)PODXL-high (n=16)P-value
Age
 <6524 (44%)5 (31%)0.354
 ≥6530 (56%)11 (69%)
Lymph node metastasis
 No7 (13%)3 (19%)0.568
 Yes47 (87%)13 (81%)
Liver metastasis
 No43 (80%)5 (31%)0.0003
 Yes11 (20%)11 (69%)
Distant metastasis
 No28 (52%)2 (13%)0.005
 Yes26 (48%)14 (87%)
Lymphatic invasion
 No14 (26%)3 (19%)0.563
 Yes40 (74%)13 (81%)
Vascular invasion
 No25 (46%)3 (19%)0.049
 Yes29 (54%)13 (81%)
Perineural invasion
 No6 (11%)0 (0%)0.168
 Yes48 (89%)16 (100%)
UICC stage
 I/II53 (98%)15 (94%)0.322
 III/IV1 (2%)1 (7%)
Pathologic margin
 Negative38 (70%)9 (56%)0.298
 Positive16 (30%)7 (44%)

[i] UICC, Union for International Cancer Control.

Association between PODXL expression and survival in pancreatic cancer

We then investigated the association between PODXL expression and overall survival of postoperative patients with pancreatic cancer. Survival analysis showed that post-operative survival was longer in the low-PODXL expression group than in the high-PODXL expression group (Fig. 5B). In addition, the analysis of disease-free survival of post-operative patients showed similar results (Fig. 5C).

Univariate and multivariate analyses for factors correlated with metastasis and survival in post-operative patients with pancreatic cancer

To evaluate the prognostic value of PODXL expression in pancreatic cancer, we used the Cox proportional hazards model to evaluate PODXL expression and clinicopathological factors. Univariate analysis showed significant prognostic values in PODXL expression (P=0.006), liver metastasis (P<0.0001), distant metastasis (P=0.0002), lymphatic invasion (P=0.009), vascular invasion (P=0.027), and pathologic margin (P=0.044) (Table V). We then performed multivariate survival analysis based on the Cox proportional hazards model for all these parameters. Multivariate analysis showed significant prognostic values in liver metastasis (P=0.0046) and lymphatic invasion (P=0.029) (Table VI).

Table V

Univariate survival analysis of conventional prognostic factors and PODXL expression.

Table V

Univariate survival analysis of conventional prognostic factors and PODXL expression.

CharacteristicsNo. of casesThree-year survival rateP-value
PODXL
 Low5424 (44.4%)0.006
 High164 (25.0%)
Age
 <652911 (37.9%)0.389
 ≥654117 (41.5)
Lymph node metastasis
 No108 (80.0%)0.091
 Yes6020 (33.3%)
Liver metastasis
 No4825 (52.1%)<0.0001
 Yes223 (13.6%)
Distant metastasis
 No3017 (56.7%)0.0002
 Yes4011 (27.5%)
Lymphatic invasion
 No1711 (64.7%)0.009
 Yes5317 (32.1%)
Vascular invasion
 No2815 (53.6%)0.027
 Yes4213 (31.0%)
Perineural invasion
 No64 (66.7%)0.631
 Yes6424 (37.5%)
UICC stage
 I/II6828 (41.2%)0.17
 III/IV20 (0%)
Pathologic margin
 Negative4721 (44.7%)0.044
 Positive237 (30.4%)

[i] UICC, Union for International Cancer Control.

Table VI

Multivariate survival analysis of conventional prognostic factors and PODXL expression.

Table VI

Multivariate survival analysis of conventional prognostic factors and PODXL expression.

CharacteristicsRelative risk95% CIP-value
PODXL
 Low0.01−0.38–0.360.9051
 High
Liver metastasis
 No8.050.18–1.000.0046
 Yes
Distant metastasis
 No0.89−0.19–0.530.3445
 Yes
Lymphatic invasion
 No4.770.07–1.510.0290
 Yes
Vascular invasion
 No1.58−0.21–0.990.2083
 Yes
Pathologic margin
 Negative0.46−0.84–0.390.4992
 Positive

Discussion

Recently, miRNAs have been studied in many types of cancer. Several miRNAs are already reported to correlate with pancreatic cancer in various pathways (46,47). In the present study, we performed microarray analyses and found 13 downregulated and 15 upregulated miRNAs in MS cells, and seven downregulated and 12 upregulated miRNAs in MP cells compared with their parental cells. Of these miRNAs, miR-1247, miR-16, miR-26a and let-7i were reported as tumor-suppressing miRNAs, and miR-125b was reported as tumor-promoting. High expression of miR-1247 was reported to correlate with higher overall and recurrence-free survival rates, and neuropilin, a target of miR-1247, was reported to promote extravasation and liver metastasis in pancreatic cancer and clear cell renal cell carcinoma (4850).

miR-16 and miR-26a were reported to suppress tumor growth by regulating B-cell lymphoma 2 (BCL-2) and phosphorylation of P53, respectively, in pancreatic cancer (51,52). Let-7i was reported to suppress tumor growth by regulating RAS GTPase activity in pancreatic cancer (53). miR-125b upregulation in MS cells was reported to promote a chemo-resistant mesenchymal phenotype in pancreatic cancer by suppressing BCL-2 binding component 3 (BBC3) which is antagonist of BCL-2 (54). Furthermore, we also identified several possible candidate cancer-related miRNAs, miR-4755, miR-5100, miR-4454, miR-1972, miR-4706, miR-1260a, miR-1273g, miR-2964a, miR-3135b, miR-4299, miR-6087, miR-4667 and miR-4745 that have not previously been reported to be involved in cancer. Of these miRNAs, miR-5100 and miR-4454 were downregulated in both MS and MP cells compared with their parental cells. Then, we validated the data using real-time RT-PCR and found a consistent result in miR-5100 expression, but not in miR-4454 expression. Therefore, in the following experiments, we focused on miR-5100. Herein, we showed overexpression of miR-5100 suppressed cell proliferation, migration and invasion in MS and KP-2 cells and also identified PODXL as a direct target of miR-5100. The present findings suggest that miR-5100 plays an inhibitory role in tumorigenesis and metastasis of pancreatic cancer. However, miR-5100 was recently reported to promote tumor growth in lung cancer by targeting Rab6 (55), which is inconsistent with our results regarding pancreatic cancer. Therefore, further examinations will be needed to elucidate such differences in the functional roles of miR-5100 depending on cancer type.

PODXL was previously reported to enhance tumor aggressiveness in breast cancer, prostate cancer, oral squamous cell carcinoma and astrocytoma (5659). Hsu et al reported PODXL-EBP50-Ezrin molecular complex enhances the metastatic potential of renal cancer through recruiting RAC1 guanine nucleotide exchange factor, ARHGEF7 (60). Lin et al reported that PODXL promotes invadopodia formation and metastasis through activation of RAC1-Cdc42-cortactin signaling in breast cancer cells (61) and it is thought to regulate cell adhesion through its connections to intracellular proteins and to extracellular ligands (3135). In our study, the adhesion capability of MS cells that showed high PODXL expression was remarkably decreased compared with that of low PODXL-expressing cells, as previously reported (3135). In addition, we showed for the first time that PODXL played an important role in pancreatic tumor aggressiveness by promoting cancer cell migration and invasion. Taken together, these data suggest that PODXL may promote cell migration and invasion by regulating cell adhesion in many types of cancers.

High immunohistochemical expression of PODXL in human specimens was reported to correlate with poor prognosis in high grade serous ovarian cancer, breast cancer and colorectal cancer (3640). Regarding pancreatic cancer, Saukkonen et al reported that PODXL is an independent factor for poor prognosis (41). In the present study, our results did not show independent prognostic values for PODXL expression, possibly because of the limited number of cases, but indicated a close relationship between PODXL expression and liver metastasis of pancreatic cancer in human specimens. Although PODXL expression has previously reported to correlate with distant metastasis of colorectal cancer (39), details of metastatic target organs were not described. Our results also revealed that PODXL expression was correlated with distant metastasis of pancreatic cancer including liver metastasis. However, we did not find any significant relationships between PODXL expression and other distant metastases such as lung metastasis, peritoneal metastasis and bone metastasis, possibly because of the limited number of samples. Further study of additional case samples would hopefully clarify the relationships between PODXL expression and metastases to each organ.

In conclusion, miR-5100 directly regulates PODXL expression and this pathway correlates with the aggressive and metastatic characteristics of pancreatic cancer. Thus, miR-5100 and PODXL could be potential indicators for cancer metastases, particularly for liver metastases, and attractive anti-metastatic therapeutic targets for patients with pancreatic cancer.

Acknowledgements

This study was supported in part by Japan Society for the Promotion of Science (JSPS) Grant-in-Aid for Scientific Research (B) and (C) and Scientific Research on Innovative Areas (grant numbers: 15K10185, 26293305, 26462062, 25293285, 25462117, 26462063 and 15H04933).

References

1 

Singh D, Upadhyay G, Srivastava RK and Shankar S: Recent advances in pancreatic cancer: Biology, treatment, and prevention. Biochim Biophys Acta. 1856:13–27. 2015.PubMed/NCBI

2 

Mirus JE, Zhang Y, Li CI, Lokshin AE, Prentice RL, Hingorani SR and Lampe PD: Cross-species antibody microarray interrogation identifies a 3-protein panel of plasma biomarkers for early diagnosis of pancreas cancer. Clin Cancer Res. 21:1764–1771. 2015. View Article : Google Scholar : PubMed/NCBI

3 

Fukushige S and Horii A: Road to early detection of pancreatic cancer: Attempts to utilize epigenetic biomarkers. Cancer Lett. 342:231–237. 2014. View Article : Google Scholar

4 

Güngör C, Hofmann BT, Wolters-Eisfeld G and Bockhorn M: Pancreatic cancer. Br J Pharmacol. 171:849–858. 2014. View Article : Google Scholar :

5 

Collins A and Bloomston M: Diagnosis and management of pancreatic cancer. Minerva Gastroenterol Dietol. 55:445–454. 2009.PubMed/NCBI

6 

Michl P and Gress TM: Current concepts and novel targets in advanced pancreatic cancer. Gut. 62:317–326. 2013. View Article : Google Scholar

7 

Sweeney AD, Fisher WE, Wu MF, Hilsenbeck SG and Brunicardi FC: Value of pancreatic resection for cancer meta-static to the pancreas. J Surg Res. 160:268–276. 2010. View Article : Google Scholar : PubMed/NCBI

8 

Werner J, Combs SE, Springfeld C, Hartwig W, Hackert T and Büchler MW: Advanced-stage pancreatic cancer: Therapy options. Nat Rev Clin Oncol. 10:323–333. 2013. View Article : Google Scholar : PubMed/NCBI

9 

Khoja L, Backen A, Sloane R, Menasce L, Ryder D, Krebs M, Board R, Clack G, Hughes A, Blackhall F, et al: A pilot study to explore circulating tumour cells in pancreatic cancer as a novel biomarker. Br J Cancer. 106:508–516. 2012. View Article : Google Scholar :

10 

Liu L, Xu H, Wang W, Wu C, Chen Y, Yang J, Cen P, Xu J, Liu C, Long J, et al: A preoperative serum signature of CEA+/CA125+/CA19-9 ≥1000 U/mL indicates poor outcome to pancreatectomy for pancreatic cancer. Int J Cancer. 136:2216–2227. 2015. View Article : Google Scholar

11 

Sergeant G, van Eijsden R, Roskams T, Van Duppen V and Topal B: Pancreatic cancer circulating tumour cells express a cell motility gene signature that predicts survival after surgery. BMC Cancer. 12:5272012. View Article : Google Scholar : PubMed/NCBI

12 

Pasquinelli AE: MicroRNAs and their targets: Recognition, regulation and an emerging reciprocal relationship. Nat Rev Genet. 13:271–282. 2012.PubMed/NCBI

13 

Chen X, Liang H, Zhang J, Zen K and Zhang CY: Secreted microRNAs: A new form of intercellular communication. Trends Cell Biol. 22:125–132. 2012. View Article : Google Scholar : PubMed/NCBI

14 

Amirkhah R, Schmitz U, Linnebacher M, Wolkenhauer O and Farazmand A: MicroRNA-mRNA interactions in colorectal cancer and their role in tumor progression. Genes Chromosomes Cancer. 54:129–141. 2015. View Article : Google Scholar : PubMed/NCBI

15 

Jansson MD and Lund AH: MicroRNA and cancer. Mol Oncol. 6:590–610. 2012. View Article : Google Scholar : PubMed/NCBI

16 

Lin S and Gregory RI: MicroRNA biogenesis pathways in cancer. Nat Rev Cancer. 15:321–333. 2015. View Article : Google Scholar : PubMed/NCBI

17 

Reddy KB: MicroRNA (miRNA) in cancer. Cancer Cell Int. 15:382015. View Article : Google Scholar : PubMed/NCBI

18 

Shen J, Stass SA and Jiang F: MicroRNAs as potential biomarkers in human solid tumors. Cancer Lett. 329:125–136. 2013. View Article : Google Scholar :

19 

Zhang B, Pan X, Cobb GP and Anderson TA: microRNAs as oncogenes and tumor suppressors. Dev Biol. 302:1–12. 2007. View Article : Google Scholar

20 

Gregory PA, Bert AG, Paterson EL, Barry SC, Tsykin A, Farshid G, Vadas MA, Khew-Goodall Y and Goodall GJ: The miR-200 family and miR-205 regulate epithelial to mesenchymal transition by targeting ZEB1 and SIP1. Nat Cell Biol. 10:593–601. 2008. View Article : Google Scholar : PubMed/NCBI

21 

Liu C, Kelnar K, Liu B, Chen X, Calhoun-Davis T, Li H, Patrawala L, Yan H, Jeter C, Honorio S, et al: The microRNA miR-34a inhibits prostate cancer stem cells and metastasis by directly repressing CD44. Nat Med. 17:211–215. 2011. View Article : Google Scholar : PubMed/NCBI

22 

Wellner U, Schubert J, Burk UC, Schmalhofer O, Zhu F, Sonntag A, Waldvogel B, Vannier C, Darling D, zur Hausen A, et al: The EMT-activator ZEB1 promotes tumorigenicity by repressing stemness-inhibiting microRNAs. Nat Cell Biol. 11:1487–1495. 2009. View Article : Google Scholar : PubMed/NCBI

23 

Weiss FU, Marques IJ, Woltering JM, Vlecken DH, Aghdassi A, Partecke LI, Heidecke CD, Lerch MM and Bagowski CP: Retinoic acid receptor antagonists inhibit miR-10a expression and block metastatic behavior of pancreatic cancer. Gastroenterology. 137:2136–2145.e1-7. 2009. View Article : Google Scholar : PubMed/NCBI

24 

Mees ST, Mardin WA, Wendel C, Baeumer N, Willscher E, Senninger N, Schleicher C, Colombo-Benkmann M and Haier J: EP300 - a miRNA-regulated metastasis suppressor gene in ductal adenocarcinomas of the pancreas. Int J Cancer. 126:114–124. 2010. View Article : Google Scholar

25 

Kerjaschki D, Sharkey DJ and Farquhar MG: Identification and characterization of podocalyxin - the major sialoprotein of the renal glomerular epithelial cell. J Cell Biol. 98:1591–1596. 1984. View Article : Google Scholar : PubMed/NCBI

26 

Kershaw DB, Thomas PE, Wharram BL, Goyal M, Wiggins JE, Whiteside CI and Wiggins RC: Molecular cloning, expression, and characterization of podocalyxin-like protein 1 from rabbit as a transmembrane protein of glomerular podocytes and vascular endothelium. J Biol Chem. 270:29439–29446. 1995. View Article : Google Scholar : PubMed/NCBI

27 

Chan JY and Watt SM: Adhesion receptors on haematopoietic progenitor cells. Br J Haematol. 112:541–557. 2001. View Article : Google Scholar : PubMed/NCBI

28 

Horvat R, Hovorka A, Dekan G, Poczewski H and Kerjaschki D: Endothelial cell membranes contain podocalyxin - the major sialoprotein of visceral glomerular epithelial cells. J Cell Biol. 102:484–491. 1986. View Article : Google Scholar : PubMed/NCBI

29 

Doyonnas R, Nielsen JS, Chelliah S, Drew E, Hara T, Miyajima A and McNagny KM: Podocalyxin is a CD34-related marker of murine hematopoietic stem cells and embryonic erythroid cells. Blood. 105:4170–4178. 2005. View Article : Google Scholar : PubMed/NCBI

30 

Miettinen A, Solin ML, Reivinen J, Juvonen E, Väisänen R and Holthöfer H: Podocalyxin in rat platelets and megakaryocytes. Am J Pathol. 154:813–822. 1999. View Article : Google Scholar : PubMed/NCBI

31 

Takeda T, Go WY, Orlando RA and Farquhar MG: Expression of podocalyxin inhibits cell-cell adhesion and modifies junctional properties in Madin-Darby canine kidney cells. Mol Biol Cell. 11:3219–3232. 2000. View Article : Google Scholar : PubMed/NCBI

32 

Nielsen JS and McNagny KM: The role of podocalyxin in health and disease. J Am Soc Nephrol. 20:1669–1676. 2009. View Article : Google Scholar : PubMed/NCBI

33 

Dallas MR, Chen SH, Streppel MM, Sharma S, Maitra A and Konstantopoulos K: Sialofucosylated podocalyxin is a functional E- and L-selectin ligand expressed by metastatic pancreatic cancer cells. Am J Physiol Cell Physiol. 303:C616–C624. 2012. View Article : Google Scholar : PubMed/NCBI

34 

Thomas SN, Schnaar RL and Konstantopoulos K: Podocalyxin-like protein is an E-/L-selectin ligand on colon carcinoma cells: Comparative biochemical properties of selectin ligands in host and tumor cells. Am J Physiol Cell Physiol. 296:C505–C513. 2009. View Article : Google Scholar : PubMed/NCBI

35 

Konstantopoulos K and Thomas SN: Cancer cells in transit: The vascular interactions of tumor cells. Annu Rev Biomed Eng. 11:177–202. 2009. View Article : Google Scholar : PubMed/NCBI

36 

Cipollone JA, Graves ML, Köbel M, Kalloger SE, Poon T, Gilks CB, McNagny KM and Roskelley CD: The anti-adhesive mucin podocalyxin may help initiate the transperitoneal metastasis of high grade serous ovarian carcinoma. Clin Exp Metastasis. 29:239–252. 2012. View Article : Google Scholar : PubMed/NCBI

37 

Somasiri A, Nielsen JS, Makretsov N, McCoy ML, Prentice L, Gilks CB, Chia SK, Gelmon KA, Kershaw DB, Huntsman DG, et al: Overexpression of the anti-adhesin podocalyxin is an independent predictor of breast cancer progression. Cancer Res. 64:5068–5073. 2004. View Article : Google Scholar : PubMed/NCBI

38 

Forse CL, Yilmaz YE, Pinnaduwage D, O'Malley FP, Mulligan AM, Bull SB and Andrulis IL: Elevated expression of podocalyxin is associated with lymphatic invasion, basal-like phenotype, and clinical outcome in axillary lymph node-negative breast cancer. Breast Cancer Res Treat. 137:709–719. 2013. View Article : Google Scholar : PubMed/NCBI

39 

Kaprio T, Fermér C, Hagström J, Mustonen H, Böckelman C, Nilsson O and Haglund C: Podocalyxin is a marker of poor prognosis in colorectal cancer. BMC Cancer. 14:4932014. View Article : Google Scholar : PubMed/NCBI

40 

Larsson A, Johansson ME, Wangefjord S, Gaber A, Nodin B, Kucharzewska P, Welinder C, Belting M, Eberhard J, Johnsson A, et al: Overexpression of podocalyxin-like protein is an independent factor of poor prognosis in colorectal cancer. Br J Cancer. 105:666–672. 2011. View Article : Google Scholar : PubMed/NCBI

41 

Saukkonen K, Hagström J, Mustonen H, Juuti A, Nordling S, Fermér C, Nilsson O, Seppänen H and Haglund C: Podocalyxin is a marker of poor prognosis in pancreatic ductal adenocarcinoma. PLoS One. 10:e01290122015. View Article : Google Scholar : PubMed/NCBI

42 

Du P, Kibbe WA and Lin SM: lumi: A pipeline for processing Illumina microarray. Bioinformatics. 24:1547–1548. 2008. View Article : Google Scholar : PubMed/NCBI

43 

Bolstad BM, Irizarry RA, Astrand M and Speed TP: A comparison of normalization methods for high density oligo-nucleotide array data based on variance and bias. Bioinformatics. 19:185–193. 2003. View Article : Google Scholar : PubMed/NCBI

44 

Gentleman RC, Carey VJ, Bates DM, Bolstad B, Dettling M, Dudoit S, Ellis B, Gautier L, Ge Y, Gentry J, et al: Bioconductor: Open software development for computational biology and bioinformatics. Genome Biol. 5:R802004. View Article : Google Scholar : PubMed/NCBI

45 

Quackenbush J: Microarray data normalization and transformation. Nat Genet. 32(Suppl): 496–501. 2002. View Article : Google Scholar : PubMed/NCBI

46 

Khan S, Ansarullah, Kumar D, Jaggi M and Chauhan SC: Targeting microRNAs in pancreatic cancer: Microplayers in the big game. Cancer Res. 73:6541–6547. 2013. View Article : Google Scholar : PubMed/NCBI

47 

Singh S, Chitkara D, Kumar V, Behrman SW and Mahato RI: miRNA profiling in pancreatic cancer and restoration of chemo-sensitivity. Cancer Lett. 334:211–220. 2013. View Article : Google Scholar

48 

Shi S, Lu Y, Qin Y, Li W, Cheng H, Xu Y, Xu J, Long J, Liu L, Liu C, et al: miR-1247 is correlated with prognosis of pancreatic cancer and inhibits cell proliferation by targeting neuropilins. Curr Mol Med. 14:316–327. 2014. View Article : Google Scholar : PubMed/NCBI

49 

Ben Q, Zheng J, Fei J, An W, Li P, Li Z and Yuan Y: High neuropilin 1 expression was associated with angiogenesis and poor overall survival in resected pancreatic ductal adenocarcinoma. Pancreas. 43:744–749. 2014. View Article : Google Scholar : PubMed/NCBI

50 

Cao Y, Hoeppner LH, Bach S, EG, Guo Y, Wang E, Wu J, Cowley MJ, Chang DK, Waddell N, et al: Neuropilin-2 promotes extravasation and metastasis by interacting with endothelial α5 integrin. Cancer Res. 73:4579–4590. 2013. View Article : Google Scholar : PubMed/NCBI

51 

Shen J, Wan R, Hu G, Yang L, Xiong J, Wang F, Shen J, He S, Guo X, Ni J, et al: miR-15b and miR-16 induce the apoptosis of rat activated pancreatic stellate cells by targeting Bcl-2 in vitro. Pancreatology. 12:91–99. 2012. View Article : Google Scholar : PubMed/NCBI

52 

Batchu RB, Gruzdyn OV, Qazi AM, Kaur J, Mahmud EM, Weaver DW and Gruber SA: Enhanced phosphorylation of p53 by microRNA-26a leading to growth inhibition of pancreatic cancer. Surgery. 158:981–986; discussion 986–987. 2015. View Article : Google Scholar : PubMed/NCBI

53 

Ali S, Ahmad A, Aboukameel A, Bao B, Padhye S, Philip PA and Sarkar FH: Increased Ras GTPase activity is regulated by miRNAs that can be attenuated by CDF treatment in pancreatic cancer cells. Cancer Lett. 319:173–181. 2012. View Article : Google Scholar : PubMed/NCBI

54 

Bera A, Venkata Subba Rao K, Manoharan MS, Hill P and Freeman JW: A miRNA signature of chemoresistant mesenchymal phenotype identifies novel molecular targets associated with advanced pancreatic cancer. PLoS One. 9:e1063432014. View Article : Google Scholar : PubMed/NCBI

55 

Huang H, Jiang Y, Wang Y, Chen T, Yang L, He H, Lin Z, Liu T, Yang T, Kamp DW, et al: miR-5100 promotes tumor growth in lung cancer by targeting Rab6. Cancer Lett. 362:15–24. 2015. View Article : Google Scholar : PubMed/NCBI

56 

Snyder KA, Hughes MR, Hedberg B, Brandon J, Hernaez DC, Bergqvist P, Cruz F, Po K, Graves ML, Turvey ME, et al: Podocalyxin enhances breast tumor growth and metastasis and is a target for monoclonal antibody therapy. Breast Cancer Res. 17:462015. View Article : Google Scholar : PubMed/NCBI

57 

Sizemore S, Cicek M, Sizemore N, Ng KP and Casey G: Podocalyxin increases the aggressive phenotype of breast and prostate cancer cells in vitro through its interaction with ezrin. Cancer Res. 67:6183–6191. 2007. View Article : Google Scholar : PubMed/NCBI

58 

Lin CW, Sun MS and Wu HC: Podocalyxin-like 1 is associated with tumor aggressiveness and metastatic gene expression in human oral squamous cell carcinoma. Int J Oncol. 45:710–718. 2014.PubMed/NCBI

59 

Wu H, Yang L, Liao D, Chen Y, Wang W and Fang J: Podocalyxin regulates astrocytoma cell invasion and survival against temozolomide. Exp Ther Med. 5:1025–1029. 2013.PubMed/NCBI

60 

Hsu YH, Lin WL, Hou YT, Pu YS, Shun CT, Chen CL, Wu YY, Chen JY, Chen TH and Jou TS: Podocalyxin EBP50 ezrin molecular complex enhances the metastatic potential of renal cell carcinoma through recruiting Rac1 guanine nucleotide exchange factor ARHGEF7. Am J Pathol. 176:3050–3061. 2010. View Article : Google Scholar : PubMed/NCBI

61 

Lin CW, Sun MS, Liao MY, Chung CH, Chi YH, Chiou LT, Yu J, Lou KL and Wu HC: Podocalyxin-like 1 promotes invadopodia formation and metastasis through activation of Rac1/Cdc42/cortactin signaling in breast cancer cells. Carcinogenesis. 35:2425–2435. 2014. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

April 2016
Volume 48 Issue 4

Print ISSN: 1019-6439
Online ISSN:1791-2423

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
APA
Chijiiwa, Y., Moriyama, T., Ohuchida, K., Nabae, T., Ohtsuka, T., Miyasaka, Y. ... Nakamura, M. (2016). Overexpression of microRNA-5100 decreases the aggressive phenotype of pancreatic cancer cells by targeting PODXL. International Journal of Oncology, 48, 1688-1700. https://doi.org/10.3892/ijo.2016.3389
MLA
Chijiiwa, Y., Moriyama, T., Ohuchida, K., Nabae, T., Ohtsuka, T., Miyasaka, Y., Fujita, H., Maeyama, R., Manabe, T., Abe, A., Mizuuchi, Y., Oda, Y., Mizumoto, K., Nakamura, M."Overexpression of microRNA-5100 decreases the aggressive phenotype of pancreatic cancer cells by targeting PODXL". International Journal of Oncology 48.4 (2016): 1688-1700.
Chicago
Chijiiwa, Y., Moriyama, T., Ohuchida, K., Nabae, T., Ohtsuka, T., Miyasaka, Y., Fujita, H., Maeyama, R., Manabe, T., Abe, A., Mizuuchi, Y., Oda, Y., Mizumoto, K., Nakamura, M."Overexpression of microRNA-5100 decreases the aggressive phenotype of pancreatic cancer cells by targeting PODXL". International Journal of Oncology 48, no. 4 (2016): 1688-1700. https://doi.org/10.3892/ijo.2016.3389