Open Access

Jinfukang induces cellular apoptosis through activation of Fas and DR4 in A549 cells

  • Authors:
    • Jun Lu
    • Jian Chen
    • Yani Kang
    • Jun Wu
    • Hui Shi
    • Yanli Fu
    • Lijing Jiao
    • Changsheng Dong
    • Xiaowei Li
    • Yu Jin
    • Wei Zhao
    • Ling Xu
    • Xiaodong Zhao
  • View Affiliations

  • Published online on: July 16, 2018     https://doi.org/10.3892/ol.2018.9149
  • Pages: 4343-4352
  • Copyright: © Lu et al. This is an open access article distributed under the terms of Creative Commons Attribution License.

Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

The traditional Chinese medicine Jinfukang (JFK) has been shown as a valuable drug to treat non‑small cell lung cancer (NSCLC). Previously, it was reported that JFK‑induced epigenetic alteration is involved in anti‑lung cancer activity. In the present study, the effect of JFK on lung cancer cell lines was examined with the aim to further understand the underlying mechanisms of JFK‑induced anti‑lung cancer activity by transcriptome profiling analysis. JFK was observed to decrease lung cancer cell viability and simultaneously induce cellular morphology alteration. Additionally, this causes cell cycle arrest and apoptosis in A549 cells. The present RNA‑seq analysis identified 5,281 genes with differential expression (P<0.05). Gene ontology analysis indicated that genes involved in the cell cycle pathway are downregulated, including cyclin‑dependent kinase 2, cyclin‑dependent kinase 4, cyclin B1 and cyclin A2, and apoptosis‑associated genes are upregulated, including Fas, death receptor 4 (DR4), tumor protein P53 binding protein 2 and BCL2 interacting protein 3 like. Particularly, the present results indicate knockdown of Fas and DR4 attenuates JFK‑induced apoptosis in A549 cells. Overall, the present study suggests JFK induces cellular apoptosis through activation of Fas and DR4 in A549 cells and provides an insight for understanding the antitumor mechanisms of this Chinese traditional medicine.

Introduction

Lung cancer is one of the most malignant cancers, with the highest morbidity and mortality among all cancers in the world (1). Non-small cell lung cancer (NSCLC) is closely associated with a long history of tobacco smoking and accounts for ~80% of all lung cancer cases (2). The primary treatment for patients with locally advanced or metastatic NSCLC includes systemic chemotherapy (alone or in combination with radiation therapy) and targeted biological therapy (3). However, lung cancer cells frequently show significant resistance to chemotherapeutic drugs (4). Therefore, it is urgent to develop alternative therapeutic strategies against lung cancer.

Traditional Chinese Medicine (TCM) has been effectively used against diseases for thousands of years in China (5,6). Indeed, numerous Chinese medicinal herbs show promising effects in the treatment of cancers (7). Jinfukang (JFK), an Astragalus-based herbal formula consisting of 12 herbs (Table I), has been reported to have anti-tumor efficacy against NSCLC (810). It has been approved by the Chinese Food and Drug Administration as a drug against NSCLC. Although a previous study reported that JFK could inhibit proliferation and promote apoptosis of cancer cells in rats (9), the underlying mechanisms remain elusive.

Table I.

Composition of JFK formula.

Table I.

Composition of JFK formula.

Botanical nameHerbal nameCommon nameChinese nameRatioVoucher no.
Astragalu smembranaceus (Fish.) BungeRadix astragaliMilkvetch rootHuang-qi8 SJTU-JFK140121-1
Glehnia littoralis F. Schmidt ex Miq.Radix glehniaeCoastal glehnia rootBei-sha-shen8 SJTU-JFK140121-2
Asparagus cochinchinensis (Lour.) MerrRadix asparagiCochinchinese asparagus rootTian-men-dong2 SJTU-JFK140121-3
Ligustrum lucidum W.T. AitonFructus ligustri lucidiGlossy privet fruitNv-zhen-zi2 SJTU-JFK140121-4
Selaginella doederleinii Hieron.Herba selaginellaeSpikemossShi-Shang-Bai8 SJTU-JFK140121-5
Paris polyphylla Smith var. yunnanensis (Franch.) Hand MazzRhizoma paridis yunnanensisYunnan manyleafparis rhizomeChong-lou3 SJTU-JFK140121-6
Epimedium sagittatum (Siebold&Zucc.) MaximFolium epimedii ShorthornedepimediumYin-yang-huo2 SJTU-JFK140121-7
Gynostemma pentaphyllum (Thunb.) MakinoHerbal gynostemmatisFive leaf gynostemma herbJiao-gu-lan2 SJTU-JFK140121-8
Cornus officinalis Siebold & Zucc.Fructus corniAsiatic cornelian cherry fruitShan-zhu-yu2 SJTU-JFK140121-9
Salvia chinensis Benth.Herba salviae chinensisChinese sageShi-jian-chuan8 SJTU-JFK140121-10
Ophiopogon japonicas (Thunb.) Ker GawlRadix ophiopogonDwarf lilyturfMai-dong tuber2 SJTU-JFK140121-11
Trigonella foenum-graecum L.Semen trigonellaCommon fenugreek seedHu-lu-ba2 SJTU-JFK140121-12

[i] JFK, Jinfukang.

As the majority of TCMs consist of various components, it is necessary to utilize high-throughput strategies to delineate the underlying mechanisms (11). Previous studies have shown that cDNA profiling may be effectively used to characterize the antitumor mechanism by measuring gene expression changes (12,13). With the emergence of RNA-seq, this approach has provided a better platform to investigate the mechanisms of various drugs due to its performance in robustness and effectiveness (14,15).

A previous study indicated that JFK-induced epigenetic alteration is involved in anti-lung cancer activity (16). In present study, the alteration in cellular growth and apoptosis upon JFK treatment was examined in human lung cancer cell lines, and RNA-seq analysis was performed to characterize the JFK-induced transcriptome. Among the genes whose expression was modulated by JFK, the present study further characterized those involved in the apoptosis pathway to understand how JFK exerts its effects on lung cancer cells.

Materials and methods

Preparation of JFK

JFK contains 12 herbals described in Table I, and these raw herbs were obtained from the pharmacy dispensary of Longhua Hospital, Shanghai University of Traditional Chinese Medicine (Shanghai, China). The names of herbs have been verified via www.theplantlist.org. Voucher specimens were deposited at the herbarium in Shanghai Jiao Tong University. The raw components of JFK (20 g) were minced and extracted with 200 ml 70% ethanol at 80°C for 1 h according to the composition in Table I. Chromatographic and mass spectrographic finger prints for JFK ethanol extract were examined via LC-MS. The ethanol extract was filtered through a 0.45 µm syringe filter and diluted to various concentrations used in the present study.

Cell culture

The human lung cancer A549, NCI-H1975, NCI-H1650 and NCI-H2228 cell lines were maintained with RPMI-1640 medium (Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) containing 10% fetal bovine serum (Gibco; Thermo Fisher Scientific, Inc.) and 100 U/ml penicillin and 100 µg/ml streptomycin (Thermo Fisher Scientific, Inc.) at 37°C in a humidified atmosphere containing 5% CO2.

Cell viability analysis

Human lung cancer cell lines were treated with various concentrations of JFK extract (0, 0.041, 0.054, 0.081, 0.108, 0.162 and 0.216 mg/ml) for 48 h at 37°C, and then the cell viability was evaluated using Cell Counting Kit 8 (CCK8; Dojindo Molecular Technologies, Inc., Kumamoto, Japan) by spectrophotometric plate reader (Omega Bio-Tek, Inc., Norcross, GA, USA). All cell viability results were tested by three independent experiments.

Morphological changes and DAPI staining

To evaluate the effects of JFK extract on cell growth, 1×105 A549 cells were seeded in each well of 6-well plates, and exposed to JFK extract at a half maximal inhibitory concentration (IC50; determined by CCK8 assay) for 48 h. The morphological changes in A549 cells were observed with a phase-contrast microscope (Model Ti-E; NIS4.0; Nikon, Tokyo, Japan). A549 cells were fixed, stained with DAPI and observed using fluorescence microscopy (Model Ti-E; NIS4.0; Nikon).

Cell cycle analysis

Briefly, A549 cells were harvested by trypsin with no EDTA (Thermo Fisher Scientific, Inc.), and washed twice with PBS. The cells were fixed with cold 70% ethanol overnight, and then stained with a solution consisting of 20 µg/ml propidium iodine (PI) (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) and 0.1% TritonX-100 (Sigma-Aldrich; Merck KGaA), 100 µg/ml RNase A (Fermentas; Thermo Fisher Scientific, Inc.) for 15 min at 37°C in the dark. Cell cycle progression was then analyzed by flow cytometry (BD LSRFortessa; BD Biosciences, Franklin Lakes, NJ, USA) and ModFit LT software (version 3.2; Verity Software House, Topsham, ME, USA).

Cell apoptosis analysis

Determination of phosphatidyl serine (PS) and membrane integrity was performed using the Annexin V-FITC/PI Apoptosis kit (Beijing Zoman Biotechnology Co., Ltd., Beijing, China). In brief, A549, NCI-H1975, NCI-H1650 and NCI-H2228 cells were harvested by trypsin (no EDTA) and washed twice with PBS, then stained with Annexin V-FITC/PI and analyzed by flow cytometry as aforementioned. PI positive cells were designated as end stage apoptotic cells, and FITC-positive cells were designated as early stage apoptotic cells.

RNA-seq library construction

RNA-seq assays were performed in A549 cells without and with JFK treatment for 48 h (0.054 mg/ml), as described in our recent study (17). Briefly, total RNA was extracted by TRIzol (Thermo Fisher Scientific, Inc.), and further treated with DNase to remove genomic DNA contamination. Isolation of mRNA was performed with Oligotex mRNA Mini kit (Qiagen, Hilden, Germany) and then used for RNA-seq library construction with NEBNext Ultra Directional RNA Library Prep kit for Illumina (New England BioLabs, Inc., Ipswich, MA, USA), which was subjected to Illumina sequencing. The raw sequencing data are available in the EMBL database (www.ebi.ac.uk/arrayexpress) under accession number E-MTAB-3592.

Analysis of differentially expressed genes

The raw sequencing reads were mapped to the reference genome (hg19) by TopHat. Cufflinks was used to characterize the differential transcription pattern (18). The present study has taken biases in library preparation into account. The gene expression level was measured by reads per kilobase of transcript per million reads mapped.

Functional annotation and pathway analysis

The Database for Annotation, Visualization and Integrated Discovery (DAVID) bioinformatics resource was used to annotate gene functions and pathways (19,20).

Quantification of mRNA level

Transcription level of genes of interest was evaluated using quantitative reverse transcription-quantitative polymerase chain reaction (RT-qPCR) with SYBR-Green PCR Master Mix (Qiagen). RT-qPCR was performed according to our previous studies (13,16,17). All primer sequences used for RT-qPCR are presented in Table II.

Table II.

Primer sequences for reverse transcription-quantitative polymerase chain reaction.

Table II.

Primer sequences for reverse transcription-quantitative polymerase chain reaction.

Primer sequence

GeneGenBankForward (5′-3′)Reverse (5′-3′)
CDK2[NG_034014] TACACCCATGAGGTGACTCG GTCCCCAGAGTCCGAAAGAT
CDK4[NM_000075] CCCGAAGTTCTTCTGCAGTC CTGGTCGGCTTCAGAGTTTC
CCNA2[NM_001237] GGTACTGAAGTCCGGGAACC AAGATCCTTAAGGGGTGCAA
CCNB1[NM_172301] TGTGGATGCAGAAGATGGAG TTTGGTCTGACTGCTTGCTC
DR4[NM_003844] TGCAGGTCGTACCTAGCTCA GGACACAACTCTCCCAAAGG
Fas[NG_009089] ATTGCTCAACAACCATGCTG CCAATCCCTTGGAGTTGATG
TP53BP2[NG_029950] TCCTTGGTCATTCAGGCTTC GGCCAACTGGATGGATTTTA
BNIP3L[NM_004331] CAACAACAACTGCGAGGAAA TTGCTGCTGTTCATGGGTAG
GAPDH[NG_007073] GCACCGTCAAGGCTGAGAAC ATGGTGGTGAAGACGCCAGT
Western blot analysis

Cells were washed with PBS and collected in a 1.5 ml tube. A549 cells were lysed using the procedures essentially the same as described previously (13). The total protein extracts were obtained following centrifugation (18,000 × g for 15 min, at 4°C). The protein concentration was evaluated by Pierce BCA protein assay kit (Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. Protein samples (~50 µg) were fractionated by SDS-PAGE (10% polyacrylamide gels) and transferred to a polyvinylidene fluoride membrane (EMD Millipore, Billerica, MA, USA). The protein-binding membrane was incubated in PBS containing 0.1% Tween-20 (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) for 60 min at 4°C. 5% skim milk was used to block non-specific binding for 3 h at 4°C. This was followed by incubation overnight at 4°C with primary antibody. The primary antibodies used in the present study included; cyclin B1 (CCNB1; cat no. D160234-0100; dilution, 1:250; Sangon Biotech Co., Ltd., Shanghai, China), cyclin-dependent kinase 4 (CDK4; cat no. 11026-1-AP; dilution, 1:100; Proteintech Group, Inc., Wuhan, China), death receptor 4 (DR4; cat no. 24063-1-AP; dilution, 1:100; Proteintech Group, Inc.), Fas (cat no. D220092-0100; dilution, 1:550; Sangon Biotech Co., Ltd.), and GAPDH (cat no. 5174S; dilution, 1:2,000; Cell Signaling Technology, Inc., Danvers, MA, USA). The membrane with protein antibody complexes were washed with PBS containing 0.1% Tween-20, incubated for 2 h with a goat anti-rabbit horseradish peroxidase-conjugated secondary antibody (cat no. 14708S; dilution, 1:15,000; Cell Signaling Technology, Inc.) at 4°C. Immunodetection was performed using ECL reagent (Santa Cruz Biotechnology Inc., Dallas, TX, USA) and images were captured and analyzed using the LI-COR Odyssey Infrared Imaging system (LI-COR Biosciences, Lincoln, NE, USA). The protein amounts were semi-quantified by analyzing blot intensity using GAPDH as loading control.

siRNA and transfection

siRNA duplexes were designed to downregulate DR4 and Fas. The DR4-targeting siRNA sequence was 5′-CCUUCAAGUUUGUCGUCGUdTdT-3′ and the Fas-targeting siRNA sequence was 5′-GUGCAGAUGUAAACCAAACdTdT-3′. siRNAs for in vitro transfection were obtained from Shanghai Gene Pharma Co., Ltd. (Shanghai, China). Transfection was performed using Lipofectamine® 2000 reagent (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA), according to the manufacturer's instructions. Briefly, A549 and NCI-H2228 cells were transfected with 50 nmol/l of siRNAs directed against Fas and DR4 respectively, and incubated for 6 h at 37°C.

Statistical analysis

Data are presented as the mean ± standard deviation. Comparisons between the groups were examined by standard one-way analysis of variance ANOVA, SPSS for Windows 14.0 software package (SPSS, Inc., Chicago, IL, USA), followed by Tukey's post hoc test. P<0.05 was considered to indicate a statistically significant difference.

Results

JFK induces cell growth arrest and DNA damage in lung cancer cells

To examine the effects of JFK on lung cancer cell growth, A549, NCI-H1975, NCI-H1650 and NCI-H2228 cells were treated with JFK at various concentrations (0, 0.041, 0.054, 0.081, 0.108, 0.162 and 0.216 mg/ml) for 48 h and cell viability was assessed. The cell viability of these human lung cancer cell lines decreases significantly in a concentration-dependent manner following JFK treatment (Fig. 1A). Additionally, JFK was observed to exert an increased inhibition effect on A549 cells compared with other three human lung cancer cell lines, with a IC50 of ~0.054 mg/ml. JFK treatment (0.054 mg/ml) for 48 h reshapes a large number of A549 cells to be distinctly flat and enlarged in size (Fig. 1B) and makes the nucleus condensed and disintegrated (Fig. 1C), indicating multiple effects of JFK on A549 cells. Based on these observations, A549 was next focused on and the antitumor mechanisms of JFK were characterized.

JFK leads to cell cycle arrest and cell apoptosis in A549 cells

To further investigate whether JFK cytotoxicity involves cell cycle arrest, a flow cytometry assay was performed to characterize alterations of the cell cycle. As shown in Fig. 1D, cell cycle analysis indicates that a significant portion of A549 cells accumulates in G1 and G2 phase upon JFK (0.054 mg/ml) treatment, suggesting that JFK could induce G1/S and G2/M transition arrest. To examine whether JFK triggers apoptosis in A549 cells, the extent of apoptotic cells was investigated by flow cytometry, and it was observed that numerous A549 cells were induced to undergo apoptosis after exposure to JFK for 48 h (Fig. 1E). This phenomenon not only presents in early apoptosis, but also presents in total apoptosis (Fig. 1F). Thus, the cell apoptotic rates dramatically increase upon JFK treatment.

JFK-associated transcriptome analysis in A549 cells

Given the observations of anti-proliferation and pro-apoptosis effects induced by JFK, the present study subsequently aimed to understand the underlying molecular mechanisms by transcriptome-wide differential gene expression analysis through RNA-seq. In total, 13,130,096 and 10,433,359 reads were generated from JFK-treated and untreated A549 cells, 54 and 66% of which were uniquely mapped to the human genome, corresponding to 13,720 and 17,519 expressed genes, respectively (Table III). Compared with the control, 5,281 differentially expressed genes (P<0.05) were identified, with 2,777 (52.6%) downregulated and 2,504 (47.4%) upregulated (Fig. 2A).

Table III.

The statistics of RNA-seq data sets.

Table III.

The statistics of RNA-seq data sets.

GroupTotal readsUnique mapping readsMapping rate, %Expressed gene number
Control1043335969085696617519
JFK1313009670351445413720
Gene ontology analysis of differentially expressed genes

Gene Ontology (GO) analysis of the genes with JFK-induced differential expression was performed using DAVID (19) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways database (20). The top ten GO items were listed in Table IV, in which apoptosis-associated and cell cycle-associated biological processes are statistically enriched in the upregulated and downregulated genes, respectively. For the gene sets with differential expression, KEGG pathway analysis was performed. Similarly, it was observed that the cell cycle and apoptosis pathways are also included in the top 10 enriched pathways (Fig. 2B and C). These results suggest that JFK could induce growth inhibition potentially through repressing pathways of cell cycle, nuclear division and translation pathways. Simultaneously, it could induce apoptosis in A549 cells partially through activating apoptosis, cell death and protein transport pathways.

Table IV.

GO analysis of differentially expressed genes.

Table IV.

GO analysis of differentially expressed genes.

A, Downregulated

Gene IDFunctionCountP-value
GO:0006414Translational elongation85 6.79×10−57
GO:0006412Translation140 6.93×10−39
GO:0007049Cell cycle226 2.69×10−32
GO:0022402Cell cycle process178 7.65×10−30
GO:0000278Mitotic cell cycle132 7.16×10−28
GO:0000279M phase120 2.39×10−26
GO:0022403Cell cycle phase134 1.00×10−23
GO:0000087M phase of mitotic cell cycle88 5.95×10−22
GO:0000280Nuclear division87 6.22×10−22
GO:0007067Mitosis87 6.22×10−22

B, Upregulated

Gene ID FunctionCountP-value

GO:0046907Intracellular transport150 5.33×10−15
GO:0015031Protein transport166 1.36×10−14
GO:0045184Establishment of protein localization167 1.51×10−14
GO:0008104Protein localization182 1.28×10−13
GO:0010941Regulation of cell death165 1.09×10−11
GO:0042981Regulation of apoptosis163 1.32×10−11
GO:0043067Regulation of programmed cell death164 1.55×10−11
GO:0016265Death149 3.69×10−11
GO:0008219Cell death148 4.29×10−11
GO:0034613Cellular protein localization95 4.45×10−10

[i] GO, gene ontology.

JFK modulates the expression of genes involved in cell cycle and apoptosis

For gene sets with a differential expression pattern determined by RNA-seq analysis, cell cycle-associated genes, including CDK2, CDK4, CCNB1 and cyclin A2 (CCNA2), and apoptosis-associated genes, including Fas, DR4, tumor protein P53 binding protein 2 (TP53BP2) and BCL2 interacting protein 3 like (BNIP3L), for further validation (Fig. 3A). The transcriptional activities of selected genes were measured by RT-qPCR, and the results were shown in Fig. 3B and C. These results confirm that JFK represses cell cycle-associated genes, and activates apoptosis-associated genes as well. Among these selected genes, the alterations in protein level of CDK4, CCNB1, Fas and DR4 were examined by western blot analysis. As shown in Fig. 3D and E, protein levels of CDK4 and CCNB1 decrease and those of Fas and DR4 increase after JFK (0.054 mg/ml) treatment.

Activation of Fas and DR4 contributes to JFK-induced pro-apoptotic effect in A549 cells

To explore whether Fas and DR4 mediate the JFK-induced apoptosis in A549 cells, lastly siRNA assays were performed to suppress the expression of Fas and DR4 in JFK-treated A549 cells. As shown in Fig. 4A and B, the apoptotic rates (including early apoptosis rate and total apoptosis rate) significantly decrease when Fas and DR4 were knocked down. The protein expression levels of Fas and DR4 also drop when Fas and DR4 were knocked down (Fig. 4C). These results indicate that activation of Fas and DR4 is partially involved in JFK-induced apoptosis.

Discussion

Herbal intervention has been widely used for the treatment and prevention of various diseases for thousands of years in China (21). The majority of known anticancer drugs are derived from herbal plants (22). JFK, a type of Astragalus-based herbal formula, has been reported to be clinically effective in NSCLC patients (8,10,23). In the present study, the anticancer mechanisms of JFK were explored. The cellular behavior of lung cancer cell lines treated with JFK were examined, and it was found that JFK could induce cellular growth arrest and the cell cycle is regulated by a complex cascade of events and mediated by cell cycle regulatory proteins, including cyclins and CDKs (24). CDK2 and CDK4 are two key members of the cyclin-dependent kinase family, whose activities are restricted to the G1-S phase, and are essential for the G1-Stransition (25,26). CCNA2 is a critical regulatory factor that can interact with CDK kinases for regulating G1-S transition and G2-M transition (27). CCNB1 usually has an important role in mitosis, and indicates a poor prognosis when overexpressed in NSCLC (28). The present results show that A549 cells could be induced to a state of G1 and G2 phase enrichment upon JFK treatment (Fig. 1D), accompanying downregulation of cell cycle-associated genes, including CDK2, CDK4, CCNB1 and CCNA2 (Figs. 3A and 4B). These results suggest that JFK leads to A549 cell cycle arrest through the suppression of the cell cycle pathway.

Induction of apoptosis in tumor cells is one of the most common anticancer mechanisms in cancer therapies (29). The death receptor apoptotic pathway has previously been proposed as an anti-cancer drug target in human lung cancer (30). Fas and DR4, two members of the death receptor family, have a vital role during the process of apoptosis. TP53BP2 induces apoptosis through the mitochondrial death pathway (31). BNIP3L has been reported to promote cell death via apoptosis (32). In the present study, it was found the expression activities of Fas and DR4 in A549 cells are upregulated in both mRNA and protein levels after JFK treatment. TP53BP2 and BNIP3L are also activated by JFK (Fig. 3A and C). Particularly, it was observed that downregulation of Fas and DR4 could attenuate JFK-induced apoptosis in A549 cells (Fig. 4). However, this phenomenon was not observed to occur in the human lung cancer NCI-H1650 and NCI-H228 cell lines, although JFK also exerts an inhibitory viability effect on these two cell lines (Fig. 5A-C). JFK enhances the transcription of DR4 and Fas in NCI-H2228 cells, but induces marginal apoptosis in siRNA knockdown assays (Fig. 5D-F), suggesting JFK-induced apoptosis is cellular context-dependent.

Overall, the present study reported that JFK induces cellular growth arrest and apoptosis in lung cancer cells. The transcriptome profiling analysis identified 5,281 genes whose expression was modulated by JFK and it was demonstrated that JFK contributes to A549 cellular apoptosis partially through activation of DR4 and Fas. The present results provide new insight for understanding how this TCM formula exerts its effects against lung cancer.

Acknowledgements

The authors would like to thank Professor Daniel M. Czajkowsky (School of Biomedical Engineering and Bio-ID Center, Shanghai Jiao Tong University, Shanghai, China) for helpful discussion and careful proofreading. The present study was supported by Longhua Medical Project of State Clinical Research Center of TCM in Longhua Hospital (grant nos. LYTD-21 and JDZX2012123), National Basic Research Program of China (grant no. 2013CB967402) and National Natural Science Foundation of China (grant nos. 81373623 and 91229123).

Glossary

Abbreviations

Abbreviations:

JFK

Jinfukang formula

NSCLC

non-small cell lung cancer

TCM

Traditional Chinese Medicine

RNA-Seq

RNA sequencing

CCK8

Cell Counting Kit 8

PI

propidium iodine

GO

gene ontology

KEGG

Kyoto Encyclopedia of Genes and Genomes

References

1 

Li C and Hong W: Research status and funding trends of lung cancer biomarkers. J Thorac Dis. 5:698–705. 2013.PubMed/NCBI

2 

Siegel RL, Miller KD and Jemal A: Cancer statistics, 2015. CA Cancer J Clin. 65:5–29. 2015. View Article : Google Scholar : PubMed/NCBI

3 

Ettinger DS, Wood DE, Akerley W, Bazhenova LA, Borghaei H, Camidge DR, Cheney RT, Chirieac LR, D'Amico TA, Demmy TL, et al: Non-small cell lung cancer, version 1.2015. J Natl Compr Canc Netw. 12:1738–1761. 2014. View Article : Google Scholar : PubMed/NCBI

4 

Shanker M, Willcutts D, Roth JA and Ramesh R: Drug resistance in lung cancer. Lung Cancer (Auckl). 1:23–36. 2010.PubMed/NCBI

5 

Efferth T, Li PC, Konkimalla VS and Kaina B: From traditional Chinese medicine to rational cancer therapy. Trends Mol Med. 13:353–361. 2007. View Article : Google Scholar : PubMed/NCBI

6 

Lu J, Xu J and Shi Q: Effect of ethanol extract of HPRS, a Traditional Chinese Medicine formula, on HCT116 cell line. J Tradit Chin Med. 36:760–767. 2016. View Article : Google Scholar : PubMed/NCBI

7 

Han R: Highlight on the studies of anticancer drugs derived from plants in China. Stem Cells. 12:53–63. 1994. View Article : Google Scholar : PubMed/NCBI

8 

Jiao L, Wang Y, Xu L and You M: Lung cancer prevention and therapy using the JinFuKang herbal mixture. Curr Pharmacol Rep. 1:346–353. 2015. View Article : Google Scholar

9 

Sun JL and Liu JX: Effect of ‘Jinfukang Oral Solution’ on expression of apoptosis related genes of human lung adenocarcinoma cells transplanted in nude mice. Shanghai J Tradit Chin Med. 10:2007.

10 

Liu JX, Shi ZM, Li HG, Xu ZY, Zhu YW, Zhao LH, Gao H, Liu LS, Zhu HR and Zhang H: Clinical observation on 271 cases of non-small cell lung cancer treated with Yifei Kangliu Yin. Chin J Integr Tradit West Med. 7:247–250. 2001.

11 

Xue R, Fang Z, Zhang M, Yi Z, Wen C and Shi T: TCMID: Traditional Chinese medicine integrative database for herb molecular mechanism analysis. Nucleic Acids Res. 41(Database issue): D1089–D1095. 2013.PubMed/NCBI

12 

Bonham M, Arnold H, Montgomery B and Nelson PS: Molecular effects of the herbal compound PC-SPES: Identification of activity pathways in prostate carcinoma. Cancer Res. 62:3920–3924. 2002.PubMed/NCBI

13 

Lu J, Chen J, Xu N, Wu J, Kang Y, Shen T, Kong H, Ma C, Cheng M, Shao Z, et al: : Activation of AIFM2 enhances apoptosis of human lung cancer cells undergoing toxicological stress. Toxicol Lett. 258:227–236. 2016. View Article : Google Scholar : PubMed/NCBI

14 

Pickrell JK, Marioni JC, Pai AA, Degner JF, Engelhardt BE, Nkadori E, Veyrieras JB, Stephens M, Gilad Y and Pritchard JK: Understanding mechanisms underlying human gene expression variation with RNA sequencing. Nature. 464:768–772. 2010. View Article : Google Scholar : PubMed/NCBI

15 

Wang Z, Gerstein M and Snyder M: RNA-Seq: A revolutionary tool for transcriptomics. Nat Rev Genet. 10:57–63. 2009. View Article : Google Scholar : PubMed/NCBI

16 

Lu J, Zhang X, Shen T, Ma C, Wu J, Kong H, Tian J, Shao Z, Zhao X and Xu L: Epigenetic profiling of H3K4Me3 reveals herbal medicine Jinfukang-induced epigenetic alteration is involved in anti-lung cancer activity. Evid Based Complement Alternat Med. 2016:132016. View Article : Google Scholar

17 

Qi Y, Zhang X, Kang Y, Wu J, Chen J, Li H, Guo Y, Liu B, Shao Z and Zhao X: Genome-wide transcriptional profiling analysis reveals annexin A6 as a novel EZH2 target gene involving gastric cellular proliferation. Mol Biosyst. 11:1980–1986. 2015. View Article : Google Scholar : PubMed/NCBI

18 

Trapnell C, Roberts A, Goff L, Pertea G, Kim D, Kelley DR, Pimentel H, Salzberg SL, Rinn JL and Pachter L: Differential gene and transcript expression analysis of RNA-seq experiments with TopHat and Cufflinks. Nat Protoc. 7:562–578. 2012. View Article : Google Scholar : PubMed/NCBI

19 

Huang da W, Sherman BT and Lempicki RA: Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat Protoc. 4:44–57. 2009. View Article : Google Scholar : PubMed/NCBI

20 

Kanehisa M and Goto S: KEGG: Kyoto encyclopedia of genes and genomes. Nucleic Acids Res. 28:27–30. 2000. View Article : Google Scholar : PubMed/NCBI

21 

Hesketh T and Zhu WX: Health in China. Traditional Chinese medicine: One country, two systems. BMJ. 315:115–117. 1997. View Article : Google Scholar : PubMed/NCBI

22 

Gordaliza M: Natural products as leads to anticancer drugs. Clin Transl Oncol. 9:767–776. 2007. View Article : Google Scholar : PubMed/NCBI

23 

Cassileth BR, Rizvi N, Deng G, Yeung KS, Vickers A, Guillen S, Woo D, Coleton M and Kris MG: Safety and pharmacokinetic trial of docetaxel plus an Astragalus-based herbal formula for non-small cell lung cancer patients. Cancer Chemother Pharmacol. 65:67–71. 2009. View Article : Google Scholar : PubMed/NCBI

24 

Nigg EA: Cyclin-dependent protein kinases: Key regulators of the eukaryotic cell cycle. Bioessays. 17:471–480. 1995. View Article : Google Scholar : PubMed/NCBI

25 

Chohan TA, Qian H, Pan Y and Chen JZ: Cyclin-dependent kinase-2 as a target for cancer therapy: Progress in the development of CDK2 inhibitors as anti-cancer agents. Curr Med Chem. 22:237–263. 2015. View Article : Google Scholar : PubMed/NCBI

26 

Vermeulen K, Van Bockstaele DR and Berneman ZN: The cell cycle: A review of regulation, deregulation and therapeutic targets in cancer. Cell Prolif. 36:131–149. 2003. View Article : Google Scholar : PubMed/NCBI

27 

Volm M, Koomägi R, Mattern J and Stammler G: Cyclin A is associated with an unfavourable outcome in patients with non-small-cell lung carcinomas. Br J Cancer. 75:1774–1778. 1997. View Article : Google Scholar : PubMed/NCBI

28 

Soria JC, Jang SJ, Khuri FR, Hassan K, Liu D, Hong WK and Mao L: Overexpression of cyclin B1 in early-stage non-small cell lung cancer and its clinical implication. Cancer Res. 60:4000–4004. 2000.PubMed/NCBI

29 

Ouyang L, Shi Z, Zhao S, Wang FT, Zhou TT, Liu B and Bao JK: Programmed cell death pathways in cancer: A review of apoptosis, autophagy and programmed necrosis. Cell Prolif. 45:487–498. 2012. View Article : Google Scholar : PubMed/NCBI

30 

Oh SB, Hwang CJ, Song SY, Jung YY, Yun HM, Sok CH, Sung HC, Yi JM, Park DH, Ham YW, et al: Anti-cancer effect of tectochrysin in NSCLC cells through overexpression of death receptor and inactivation of STAT3. Cancer Lett. 353:95–103. 2014. View Article : Google Scholar : PubMed/NCBI

31 

Kobayashi S, Kajino S, Takahashi N, Kanazawa S, Imai K, Hibi Y, Ohara H, Itoh M and Okamoto T: 53BP2 induces apoptosis through the mitochondrial death pathway. Genes Cells. 10:253–260. 2005. View Article : Google Scholar : PubMed/NCBI

32 

Fei P, Wang W, Kim Sh, Wang S, Burns TF, Sax JK, Buzzai M, Dicker DT, McKenna WG, Bernhard EJ and El-Deiry WS: Bnip3L is induced by p53 under hypoxia, and its knockdown promotes tumor growth. Cancer Cell. 6:597–609. 2004. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

October-2018
Volume 16 Issue 4

Print ISSN: 1792-1074
Online ISSN:1792-1082

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Lu J, Chen J, Kang Y, Wu J, Shi H, Fu Y, Jiao L, Dong C, Li X, Jin Y, Jin Y, et al: Jinfukang induces cellular apoptosis through activation of Fas and DR4 in A549 cells. Oncol Lett 16: 4343-4352, 2018
APA
Lu, J., Chen, J., Kang, Y., Wu, J., Shi, H., Fu, Y. ... Zhao, X. (2018). Jinfukang induces cellular apoptosis through activation of Fas and DR4 in A549 cells. Oncology Letters, 16, 4343-4352. https://doi.org/10.3892/ol.2018.9149
MLA
Lu, J., Chen, J., Kang, Y., Wu, J., Shi, H., Fu, Y., Jiao, L., Dong, C., Li, X., Jin, Y., Zhao, W., Xu, L., Zhao, X."Jinfukang induces cellular apoptosis through activation of Fas and DR4 in A549 cells". Oncology Letters 16.4 (2018): 4343-4352.
Chicago
Lu, J., Chen, J., Kang, Y., Wu, J., Shi, H., Fu, Y., Jiao, L., Dong, C., Li, X., Jin, Y., Zhao, W., Xu, L., Zhao, X."Jinfukang induces cellular apoptosis through activation of Fas and DR4 in A549 cells". Oncology Letters 16, no. 4 (2018): 4343-4352. https://doi.org/10.3892/ol.2018.9149