Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
December-2020 Volume 20 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
December-2020 Volume 20 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Neural stem cells induce M2 polarization of macrophages through the upregulation of interleukin‑4

  • Authors:
    • Zhuangqi Ji
    • Xianming Jiang
    • Yubin Li
    • Jian Song
    • Cuicui Chai
    • Xiaofang Lu
  • View Affiliations / Copyright

    Affiliations: Department of Gastrointestinal‑Hepatobiliary Surgery, Shenzhen Longhua District Central Hospital, Shenzhen, Guangdong 518110, P.R. China, Department of Ophthalmology, The Seventh Affiliated Hospital, Sun Yat‑sen University, Shenzhen, Guangdong 518107, P.R. China, The Reproductive Center, The First Affiliated Hospital, Sun Yat‑sen University, Guangzhou, Guangdong 510080, P.R. China, Department of Pathology, The Seventh Affiliated Hospital, Sun Yat‑sen University, Shenzhen, Guangdong 518107, P.R. China
  • Article Number: 148
    |
    Published online on: October 5, 2020
       https://doi.org/10.3892/etm.2020.9277
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Macrophages are divided into two types: M1‑ and M2‑type macrophages. Both types of macrophages serve important roles during the process of inflammation. M1‑type macrophages release various pro‑inflammatory cytokines, such as IL‑1, IFN‑γ and other inflammatory mediators, such as nitric oxide, glutamate and reactive oxygen species to generate inflammation. In contrast, M2‑type macrophages counteract the pro‑inflammatory M1 conditions and promote tissue repair by secreting anti‑inflammatory cytokines, such as IL‑10. In spinal cord injury (SCI), an imbalance in M1/M2 macrophages leads to irreversible tissue destruction. Thus, it is crucial to increase the number of M2‑type macrophages and promote M2 polarization of macrophages in SCI. Accordingly, in this study an in vitro co‑culture system was established to investigate the effect of neural stem cells (NSCs) on macrophages. The results of the present study demonstrated that NSCs induced M2 polarization and suppressed M1 polarization of macrophages in an interleukin (IL)‑4‑dependent manner. Furthermore, the nuclear factor (NF)‑κB/p65 signaling pathway was involved in the M1 polarization of macrophages and NSCs suppressed the activation of the NF‑κB/p65 pathway in an IL‑4‑dependent manner to induce M2 macrophage polarization. These findings provide more insight into SCI and help to identify novel treatment strategies.

Introduction

Inflammatory processes are generally divided into four stages: Initiation, inflammation, resolution and tissue repair (1,2). Macrophages mainly serve important roles throughout the whole process of inflammation and have different effects in different stages (2,3). Consequently, macrophages have been divided into two types according to different and opposite functional states (pro-inflammatory and anti-inflammatory); these two types of macrophages are characterized by different phenotypes (1). A previous study suggested that macrophages differentiated into the M1 or M2 type are involved in the restoration of homeostasis and tissue repair by switching gene expression (3).

Macrophages are able to change their phenotype in response to numerous different stimuli and this process is termed polarization (4). In the 1990s, M2-type macrophages were first recognized as anti-inflammatory and tissue-repairing macrophages (5). This phenotype is different from that of typical inflammatory macrophages (M1) (5,6). M1-type macrophages are produced after monocytes are stimulated with lipopolysaccharide (LPS) or interferon-γ (IFN-γ); M2-type macrophages are produced after monocytes are stimulated with interleukin (IL)-10 or IL-4 (1,7). In most wound repairs, M1-type macrophages are important in initiating the inflammatory response to produce exudation; in the later inflammatory stage, most of M1-type macrophages switch to the M2 phenotype to promote inflammation resolution and tissue repair (8). However, a previous study demonstrated that in spinal cord injury (SCI), the microenvironment of damaged spinal cord is consistently filled with M1-type macrophages that do not switch to the M2 phenotype (9). Ultimately, the consistent effect of M1-type macrophages results in irreversible spinal cord tissue destruction (9). Thus, it is important to promote M1 to M2 switching in macrophages and maintain the presence of M2-type macrophages to promote tissue repair in SCI.

Currently, regulating macrophage polarization using various agents has been considered a novel potential strategy for a number of diseases. For example, blocking CD64 with neutralizing antibodies induces M2 polarization of macrophages to decrease M1 cells and increase M2 cells in acute inflammatory diseases, such as ovarian cyst (10). In addition, some strategies involve cell-cell interactions. Cheng et al (11) demonstrated that conditioned medium from neural stem cells (NSCs) promoted M2 polarization of macrophages by suppressing the expression of inducible nitric oxide synthase (iNOS). Matsubara et al and Kano et al (12,13) also reported that conditioned stem cell medium induced spinal cord tissue recovery that was associated with promoting M2 polarization of macrophages. Thus, it is considered that there is a specific interaction between NSCs and macrophages, but the mechanism is still unknown.

The present study explored the effect of NSCs on macrophages and demonstrated that NSCs induce M2 polarization and suppress M1-polarization of macrophages, which is beneficial for tissue repair and neural regeneration through the secretion of IL-4. Knockdown of IL-4 in NSCs by specific short hairpin (sh)RNA abolished the promotion of M2 polarization. NSCs suppressed activation of the NF-κB/p65 pathway in an IL-4-dependent manner. Hence, the results of the present study demonstrated the novel effect of NSCs on macrophages and the underlying mechanism, which may provide useful information for its potential translational application in NSCs transplantation.

Materials and methods

NSC isolation and culturing

All procedures performed on experimental animals were approved by the Animal Care and Use Committee of Sun Yat-sen University (Guangdong, China).

Rats

All animal protocols were approved by China Council on Animal care and Sun Yet-San University Committee and have therefore been performed in accordance with the ethical standards laid down in the 1964 Declaration of Helsinki and its later amendments. Adult male Wistar rats (200-250 g; 6 weeks of age) were purchased from animal facility of Sun Yat-sen University and housed in stainless steel cages. Rats were fed under controlled environment at 25±3˚C, humidity of 40-65% and 12 h light/dark cycle, and free access to food and drink water. Normal food (Animal Facility of Sun Yat-sen University) was provided.

Rats were anesthetized with 1% pentobarbital sodium (40-45 mg/kg) to cause minimum pain and sacrificed by CO2 asphyxiation. To be sacrificed, animals were placed into euthanasia cases, then 100% CO2 were injected into cases at the filling rate of 30% per min. Death was confirmed by cardio-respiratory arrest and loss of reflexes. The duration of animal experiments was <30 min.

NSCs were isolated from the fetal brains of embryonic day 14 rats, which were extracted from pregnant Sprague-Dawley (SD) rats and identified as previously described (14). Briefly, the fetal brain tissue was mechanically dissected and dissociated in Hanks Balanced Salt Solution and the cell suspension was centrifuged at 4˚C, 111 x g for 5 min. The supernatant was discarded and the cell pellet was diluted to a single-cell suspension. NSCs (1x105) were plated on a T25 culture flask (Corning Inc.) containing Dulbecco's modified Eagle's medium (DMEM)/F-12 nutrient mixture, 2% B27, 1% penicillin/streptomycin, 1% l-glutamine (all purchased from Gibco; Thermo Fisher Scientific, Inc.), 20 ng/ml fibroblast growth factor-2 (FGF-2) and 20 ng/ml epidermal growth factor (EGF; both purchased from PeproTech, Inc.). NSCs were cultured at 37˚C in 5% CO2 and were passaged weekly by digestion with Accutase (EMD Millipore) in the medium described above. All NSCs (passage 2-3) used in this study were between passages 2 and 4.

To induce neural differentiation, cells were plated at a density of 2x105 cells/well in 6- or 12-well tissue-culture plates and allowed to adhere for 24 h at 37˚C, at which time cells were switched to neural differentiated medium consisting of basic medium supplemented with 2% B27, 1% penicillin/streptomycin and 1% l-glutamine. The medium was changed every 2-3 days (14,15).

Monocytes were isolated from the femurs of adult SD rats as previously described (2). In co-culture system, cells were differentiated into the macrophages when culturing in DMEM supplemented with 20 ng/ml macrophage colony-stimulating factor (M-CSF) (PeproTech, Inc.) at 37˚C in 5% CO2 for 7 days (12).

Reverse transcription-quantitative (RT-q)PCR

Total RNA was extracted from cells according to the manufacturer's protocol (16) and 2 µg of total DNA-free RNA was used to synthesize cDNA using the ReverTra Ace® qPCR RT kit (Toyobo Life Science). The reactions were set up in 96-well plates using 1 µl cDNA with Thunderbird SYBR qPCR Mix (Toyobo Life Science), to which gene-specific forward and reverse PCR primers were added. RT-qPCR was performed under the following conditions: 95˚C for 10 min, followed by 40 cycles of 95˚C for 10 sec and 55˚C for 34 sec. These analyses were performed to detect the expression of CD58, iNOS, CD206, CD163, IL-4, IL-10, IL-13, tumor necrosis factor (TNF)-α, IFN-γ and β-actin was used as an internal control. Primer sequences were as demonstrated in Table I.

Table I

Primer sequences used for reverse transcription-quantitative PCR.

Table I

Primer sequences used for reverse transcription-quantitative PCR.

GeneSequence (5'-3')
CD85F: TCACGGCTGAGATTCGACAG
 R: GTTTTGTGACGGACTGAGGTTAT
Inducible nitric oxide synthaseF: GAGGAGAGAGATCCGGTTCACA
 R: CCGCATTAGCACAGAAGCAA
CD206F: GACAGATATGAACAAGCATTCC
 R: TGAACATCTGAGAGTCCTGTC
CD163F: CGTCACCTTGGAAACAGAGACAG
 R: AGATCTCCACACGTCCAGAACAG
IL-4F: ACCTTGCTGTCACCCTGTTCT
 R: AGCTCGTTCTCCGTGGTGT
IL-10F: CAGACCCACATGCTCCGAGA
 R: CAAGGCTTGGCAACCCAAGTA
IL-13F: GCTCTCGCTTCGCTTGGTGGTC
 R: CATCCGAGGCCTTTTGGTTACAG
Tumor necrosis factor-α Interferon-γF: TCAGTTCCATGGCCCAGAC
 R: GTTGTCTTTGAGATCCATGCCATT
 F: TCGCACCTGATCACTAACTTCTTC
 R: CGACTCCTTTTCCGCTTCC
β-actinF: CCTCTTTGCATGTCTCACTC
 R: AATGTCACGCACGATTTCC

[i] IL, interleukin; F, forward; R, reverse.

Western blotting analysis

Cells were lysed in RIPA buffer (25 mM Tris-HCl pH 7.5, 150 mM NaCl, 1% Na-deoxycholale, 0.5 M EDTA, 1% Nonidet P40, 0.1% SDS, Beijing Solarbio Science & Technology Co., Ltd; cat. no. R0010), total protein was extracted, and the protein concentration was determined with a bicinchoninic acid assay. SDS-PAGE gels (10 and 12%) were loaded with 20 µg/lane of total protein. The separated proteins were transferred by electro blotting to PVDF membranes. The membranes were blocked with 5% non-fat dry milk in TBST at room temperature for 2 h (50 mM Tris; pH 7.6; 150 mM NaCl; and 0.1% Tween-20) and incubated with the primary antibody overnight at 4˚C in 5% non-fat dry milk in TBST. Immunology-labeling was detected using ECL reagent (Invitrogen; Thermo Fisher Scientific, Inc.). The primary antibodies used were as follows: Anti-p65 (1:1,000, Room temperature, 45 min, Cell Signaling Technology, Inc; cat. no. 8242), anti-phospho-p65 (1:1,000; Room temperature, 45 min; Cell Signaling Technology Inc; cat. no. 93H1), anti-IL-4 antibody (1:500; Room temperature, 45 min, Proteintech Group, Inc; cat. no. 66142), anti-β-actin (1:10,000; Room temperature, 45 min, Sigma-Aldrich; Merck KGaA; cat. no. A5316) and anti-GAPDH (1:10,000; Room temperature, 45 min, Sigma-Aldrich; Merck KGaA; cat. no. G9545). The secondary antibody (1:1,000; Cell Signaling Technology, Inc.) were incubated for 1 h at room temperature.

Transfection

Recombinant lentiviruses for IL-4 silencing (shIL-4) and control lentivirus (scramble) were obtained from Shanghai Genechem Co., Ltd. For transfection, cells in the log phase were plated at a concentration of 1x105 cells/well in 6-well plates and transfected with the scramble and shIL-4 (MOI: 20) in DMEM/F12 with 10% FBS. Polybrene (Beijing Solarbio Science & Technology Co., Ltd; cat. no. H8761) was added as an enhancing reagent to improve transduction efficiency at a concentration of 10 mg/ml. After 8 h, the medium was changed with fresh complete medium. Cells were harvested for the co-culture system 24 h after transfection.

Immunofluorescence confocal microscopy

Macrophages (5x103/well) were transferred to flat-bottom 96-well plates at the indicated density. After being treated and incubated, the cells were fixed with 4% paraformaldehyde in 15 min at room temperature, permeabilized with 0.5% Triton X-100 in PBS for 10 min at room temperature, blocked with PBS containing 1% BSA in 15 min at room temperature, and then incubated with an antibody against p65 (1:50; Cell Signaling Technology Inc.) overnight at the 4˚C. After being washed with PBS, the cells were incubated with an Alexa Fluor-488-conjugated anti-rabbit secondary antibody (1:1,000; Invitrogen; Thermo Fisher Scientific, Inc; cat. no. A11029.) for 1 h at room temperature before being imaged with a confocal microscope using a LCPlanFl objective (magnification x200; Olympus Corporation).

Enzyme linked immunosorbent assay for the quantitation of IL-4, IL-10 and IL-13

The ELISA of IL-4 (Abcam; cat. no. ab215089), IL-10 (Abcam; cat. no. ab185986) and IL-13 (Abcam; cat. no. ab100553) were performed using ELISA kits. The protocol was as follows: Prepare all reagents, working standards, and the culture medium. Remove unused microplate strips from the plate frame, return them to the foil pouch containing the desiccant pack, and reseal. Wash each well three times with PBS (300 µl/well) using a squirt bottle, multi-channel pipette, manifold dispenser or autowasher. Complete removal of liquid at each step is essential to good performance. Remove any remaining Wash Buffer by aspirating or decanting. Invert the plate and blot it against clean paper towels. Add 100 µl of each serially diluted protein standard or culture medium per well including a zero standard. Ensure reagent addition is uninterrupted and completed within 15 min. Cover/seal the plate and incubate for 2 h at room temperature. Add 100 µl of Detection Antibody in working concentration to each well. Cover/seal the plate and incubate for 1 h at room temperature. Add 200 µl of Substrate Solution to each well. Incubate for 20 min at room temperature. Protect from light. Add 50 µl of Stop Solution to each well. If color change does not appear uniform, gently tap the plate to ensure thorough mixing. Determine the optical density of each well within 20 min, using a microplate reader set to 450 nm.

Flow cytometric analysis

Single-cell suspensions were prepared and stained with fluorochrome-conjugated antibodies (Invitrogen; Thermo Fisher Scientific, Inc, cat. no. A35029) at the room temperature for 1 h. Data were collected on a BD LSRII flow cytometer (BD Biosciences) and analyzed with FlowJo software V2.0 (Tree Star, Inc.). Data were acquired as the fraction of labeled cells within a live-cell gate set for 50,000 events. For flow cytometric sorting, cells were stained with specific antibodies (APC Mouse Anti-Human HLA-DR; 1:200; BD Biosciences; cat. no. 559868; PE Mouse Anti-Human CD163; 1:200; BD Biosciences; cat. no. 556018; BV421 Mouse Anti-Human CD206, 1:200, BD Biosciences; cat. no. 564062) and isolated on a BD FACSAria cell sorter (BD Biosciences) (17).

Statistical analysis

Data were represented as the mean ± SD of three independent repeats. Shapiro-Wilk test was used to analyze the normality of data and one-way ANOVA with Levene's test was used to test the homogeneity of variance, followed by the Bonferroni post hoc test for multiple comparisons. The analyses were performed using SPSS (version 16.0; SPSS, Inc.). P<0.05 was considered to indicate a statistically significant difference.

Results

NSCs induce M2-polarization and suppress M1-polarization of macrophages

To determine the interactions between NSCs and macrophages, an in vitro co-culture system was established to investigate the effect of NSCs on macrophages. The frequencies of macrophages by flow cytometry was measured. The results demonstrated that the M1-type macrophages (HLA-DR+) were significantly reduced from 0.18±0.03 to 0.02±0.01% after co-culture with NSCs (Fig. 1A and B). The RT-qPCR results demonstrated that the mRNA expression levels of the M1-type macrophage markers (CD85 and iNOS) were significantly decreased in co-cultured cells compared with M0-macrophages alone (Fig. 1C). In contrast, flow cytometric analysis demonstrated that the M2-type macrophages (CD206+ and CD163+) were significantly increased from 1.87±0.17 to 32.93±3.43% after co-culture with NSCs (Fig. 1D and E). Additionally, the RT-qPCR results demonstrated that the mRNA expression levels of the M2-type macrophage markers (CD206 and CD163) were significantly increased in co-cultured cells compared with M0-type macrophages cultured alone (Fig. 1F). These results suggested that NSCs induce M2 polarization and suppress M1 polarization in macrophages.

Figure 1

NSCs induce M2-polarization and suppress M1-polarization of macrophages. (A) Flow cytometric analyses of M1-type macrophages (HLA-DR+) in macrophages co-cultured with NSCs. (B) Quantification of the macrophage number for part A. (C) RT-qPCR analyses of CD85 and inducible nitric oxide synthase expression in macrophages cocultured with NSCs. (D) Flow cytometric analyses of M2-type macrophages (CD206+ CD163+) in macrophages co-cultured with NSCs. (E) Quantification of the macrophage number for part D. (F) RT-qPCR analyses of CD206 and CD163 expression in macrophages cocultured with NSCs. **P<0.01. NSCs, neural stem cells; RT-qPCR, reverse transcription-quantitative PCR; iNOS, inducible nitric oxide synthase; M0, non-polarized macrophage.

NSCs induce M2 polarization of macrophages in an IL-4-dependent manner

Previous studies have demonstrated that stimulation with different cytokines affects macrophage polarization (M1 or M2) (4,18,19). IL-4 or IL-13 stimulation induces M2 polarization; TNF-α or IFN-γ stimulation induces M1 polarization (1). To confirm whether these cytokines were involved in the interactions between NSCs and macrophages, NSCs were cultured in neural differentiation medium. The RT-qPCR and ELISA results demonstrated that the mRNA and protein expression levels of IL-4, but not IL-13 or IL-10 were significantly increased in cells with the increase in time (Fig. 2A and B). In contrast, no significant differences were observed in the mRNA or protein expression levels of TNF-α and IFN-γ during neural differentiation (Fig. 2C and D). To further confirm whether the secretion of IL-4 was crucial for NSC-induced M2 polarization, a target-specific lentivirus was used to knock down the expression levels of IL-4 in NSCs (NSCshIL-4), then the NSCshIL-4 were co-cultured with macrophages. The RT-qPCR results demonstrated that the mRNA expression levels of the M1-type macrophage marker (CD85 and iNOS) were significantly increased in macrophages co-cultured with NSCsshIL-4 compared with those of macrophages cultured alone (Fig. 2E). By contrast, the mRNA expression levels of the M2-type macrophages marker (CD206 and CD163) were significantly decreased in macrophages co-cultured with NSCshIL-4 compared with those of macrophages cultured alone (Fig. 2F). These results suggested that NSCs induce M2 polarization of macrophages in an IL-4-dependent manner.

Figure 2

NSCs induce M2 polarization of macrophages by upregulating IL-4. (A) RT-qPCR analyses of IL-4, IL-10 and IL-13 expression in NSCs during neural differentiation. (B) ELISA analyses of IL-4, IL-10 and IL-13 concentrations in the culture medium of NSCs during neural differentiation. (C) RT-qPCR analyses of TNF-α and IFN-γ expression in NSCs during neural differentiation. (D) ELISA analyses of TNF-α and IFN-γ concentrations in the culture medium of NSCs during neural differentiation. (E and F) RT-qPCR analyses of CD85, inducible nitric oxide synthase, CD206 and CD163 expression in macrophages co-cultured with NSCs. *P<0.05, **P<0.01. NSCs, neural stem cells; IL, interleukin; RT-qPCR, reverse transcription-quantitative PCR; TNF, tumor necrosis factor; IFN, interferon; INOS, inducible nitric oxide synthase; M0, non-polarized macrophage.

NSCs suppress the nuclear factor (NF)-κB/p65 pathway to promote M2-polarization of macrophages in an IL-4-dependent manner

Activation of the NF-κB/p65 pathway by inflammatory cytokines such as TNF-α in macrophages induce the M1 polarization of macrophages (20,21). To determine whether IL-4 was crucial for NSC-mediated inhibition of NF-ΚB/p65 pathway activation, a target-specific lentivirus was used to knock down the expression levels of IL-4 in NSCs (Fig. 3A), then the NSCshIL-4 were co-cultured with macrophages. The results demonstrated that silencing IL-4 expression significantly diminished the inhibitory effect of NSCs on p65 translocation (from cytoplasm to nucleus) and p65 phosphorylation in macrophages (Fig. 3B and C). These results suggested that NSCs suppress the NF-κB/p65 pathway to promote M2 polarization of macrophages in an IL-4-dependent manner.

Figure 3

NSCs induce M2 polarization of macrophages by suppressing the nuclear factor-κB/p65 pathway in an IL-4-dependent manner. (A) Western blot analyses of IL-4 expression in NSCs transfected with scramble and short hairpin IL-4. (B) Western blot analyses of p65 phosphorylation in macrophages co-cultured with NSCs. (C) Immunofluorescence staining demonstrating the nuclear localization of p65 in macrophages co-cultured with NSCs. Scale bar, 50 µm. NSCs, neural stem cells; IL, interleukin; sh, short hairpin; p-p65, phosphorylated p65; M0, non-polarized macrophage.

Discussion

The present study established an in vitro co-cultured system to investigate the interactions between NSCs and macrophages and the effect of NSCs on the polarization of macrophages. The results demonstrated that M1-type macrophages markers, such as CD85 and iNOS, were significantly decreased in macrophages that were co-cultured with NSCs compared with those of macrophages cultured alone. In addition, the number of HLA-DR-positive cells was decreased in this co-cultured system. By contrast, M2-type macrophage markers, such as CD206 and CD163, were significantly increased in macrophages that were co-cultured with NSCs compared with those of macrophages cultured alone. In addition, CD206 and CD163 double-positive cells were decreased in this co-cultured system. Additionally, IL-4 mRNA and protein expression levels were significantly increased during neural differentiation. Knockdown of IL-4 expression in NSCs diminished the M2 polarization-promoting effect on macrophages and the NF-κB/p65 pathway was the primary pathway involved in this process.

Macrophages are important in a number of processes, such as inflammation, tumorigenesis and tissue repair (22). M1/M2 polarization is a specific characteristic of macrophages that divides macrophages into M1-type macrophages and M2-type macrophages (23). M1-type macrophages are termed inflammatory macrophages because this type of cell is related to inflammatory production; M2-type macrophages are termed healing macrophages because they have an anti-inflammatory effect and have been reported to promote tissue repair (1).

As previously mentioned, a number of diseases are caused by the imbalances in M1/M2 macrophage phenotypes (24,25). For example, M1-type macrophages attack tumors and prevent tumor growth (26). In contrast, infiltration of M2-type macrophages promotes tumor deterioration (27). In chronic inflammatory processes, inflammatory cytokine production by M1-type macrophages leads to cancer or dysregulation and promote tissue destruction, followed by the M2-type macrophage response, promoting tissue repair in these situations (28). In SCI, macrophages also have an important role in the pathological mechanism. Previous studies reported that both types of macrophages, which have opposing neurotoxic and neuroprotective functions, are recruited (8,29,30). It has been reported that consistent infiltration of M1-type macrophages is strongly related to numerous pathological processes of SCI, such as neuronal death and demyelination (31,32). On the other hand, studies have reported that the M2-type macrophages switches from the M1-type macrophages. M2-type macrophages act as anti-inflammatory cells, expressing IL-4 and IL-10 and generating TGF-β, while downregulating the expression of numerous proinflammatory cytokines, such as IL-1, IL-6, IL-18, TNF-α and IFNγ (8). These mediators of M2-type macrophages suppress inflammatory responses and promote tissue remodeling and repair (33,34). Thus, increasing the population of M2-type macrophages and maintaining the survival of this type of cell in the microenvironment of damaged tissue may represent a promising strategy for tissue repair after SCI.

A number of clinical trials have reported the efficacy of the stem cell transplantation as a potential strategy to repair damaged tissue and recover locomotor functional after SCI (15,35,36). These studies demonstrated that the transplanted cells differentiate into neurons, which mainly rebuilt neural circuits to promote tissue repair and locomotor function recovery (37). In addition, the current study indicated that transplanted cells have been considered to modulate the polarization of macrophages to improve the microenvironment. However, the mechanism by which transplanted NSCs affect macrophages in the inflammatory microenvironment is still unclear. A previous study reported that the medium from NSCs has anti-inflammatory effects in vitro and in vivo, suppressing the expression of inflammatory cytokines in macrophages and injured spinal cord tissues (11). Matsubara et al (12) reported that conditioned medium from stem cells induced spinal cord tissue recovery by promoting M2 polarization of macrophages. To the best of our knowledge, the current study, provided the first evidence of the interaction between NSCs and macrophages. The results of the present study demonstrated that NSCs promoted M2 polarization in macrophages in an in vitro co-cultured system. Nakajima et al (38) demonstrated similar results that MSC transplantation promoted M2 polarization of macrophages and prevented M1 polarization of macrophages through the secretion of IL-4 and IL-13.

The underlying mechanism of NSC-induced M2 polarization of macrophages remains unclear. M1-type macrophages are produced after monocytes are stimulated with LPS or IFN-γ, and M2-type macrophages are produced after monocytes are stimulated with IL-10 or IL4(7). Based on these findings, this study investigated whether IL-4, IL-10 and IL-13 are involved in the interactions between NSCs and macrophages. The results of the present study demonstrated that the production of IL-4, but not IL-10 or IL-13, was increased in NSCs during neural differentiation. Additionally, knockdown of IL-4 expression in NSCs diminished the promotion of M2 polarization in the co-culture system. These findings suggested that NSCs induce M2 polarization of macrophages in an IL-4-dependent manner, which has not been reported previously to the best of our knowledge.

M1-type macrophages have strong cytotoxicity and anti-proliferative activities. They have been reported to promote neuron death, prevent neuronal differentiation and tissue destruction after SCI (39-41). Activation of the NF-κB/p65 pathway by inflammatory cytokines such as TNF-α and IL-1 in macrophages is important for M1 polarization (42,43). The present study investigated the effect of NSCs on the NF-κB/p65 pathway in macrophages; the results demonstrated that NSCs suppress the activation of NF-κB/p65 signaling by suppressing the phosphorylation and translocation of p65 in an IL-4-dependent manner. Taken together, the results of the present study suggested that NSCs induce M2 polarization and suppress the activation of NF-κB/p65 signaling to prevent M1 polarization in an IL-4-dependent manner. In future studies, the effect and mechanism of M2-type macrophage protection of neurons and promotion of neuronal differentiation in SCI will be investigated.

There are some limitations of the current study; in vivo experiments are better to indicate the effects of IL-4 on improved tissue repair in SCI. Additionally, the current study should discuss more information regarding the mechanisms of IL-4 induced macrophage polarization. Also, studies on the negative effects of M1 macrophage on the neuronal differentiation are required in the future.

In conclusion, the results of the present study suggested that NSCs secrete the cytokine IL-4 to induce M2 polarization of macrophages and suppress activation of NF-κB/p65 signaling to prevent M1 polarization of macrophages during neural differentiation. The results of the present study may provide useful information to overcome the challenges of tissue repair in SCI and propose a potential therapeutic strategy for improving locomotor function recovery.

Acknowledgement

The authors would like to thank Dr Yue Hu (The First Affiliated Hospital of Sun Yat-sen University) for their assistance with the experiments.

Funding

This study was supported by the National Natural Science Foundation of China (grant no. 81971151) and the Guangdong Natural Science Foundation (grant no. 2019A1515010241; 2020A1515010265).

Availability of data and materials

The datasets used and/or analyzed during the present study are available from the corresponding author on reasonable request.

Authors' contributions

ZJ and XL designed the study. ZJ, XJ and XL conducted the study. YL, JS and CC collected the data. ZJ, XJ, JS, CC, and XL analyzed the data. ZJ, XJ, YL, and XL interpreted the data. ZJ, XJ and XL drafted the manuscript. ZJ and XJ revised the manuscript. All authors take responsibility for the integrity of the data analysis. All authors read and approved the final manuscript.

Ethics approval and consent to participate

This study was approved by the Animal Care and Use Committee of Sun Yat-sen University (approval no. 4557, Guangzhou, China).

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Funes SC, Rios M, Escobar-Vera J and Kalergis AM: Implications of macrophage polarization in autoimmunity. Immunology. 154:186–195. 2018.PubMed/NCBI View Article : Google Scholar

2 

Murray PJ and Wynn TA: Protective and pathogenic functions of macrophage subsets. Nat Rev Immunol. 11:723–737. 2011.PubMed/NCBI View Article : Google Scholar

3 

Varga T, Mounier R, Horvath A, Cuvellier S, Dumont F, Poliska S, Ardjoune H, Juban G, Nagy L and Chazaud B: Highly dynamic transcriptional signature of distinct macrophage subsets during sterile inflammation, resolution, and tissue repair. J Immunol. 196:4771–4782. 2016.PubMed/NCBI View Article : Google Scholar

4 

Mosser DM and Edwards JP: Exploring the full spectrum of macrophage activation. Nat Rev Immunol. 8:958–969. 2008.PubMed/NCBI View Article : Google Scholar

5 

Stein M, Keshav S, Harris N and Gordon S: Interleukin 4 potently enhances murine macrophage mannose receptor activity: A marker of alternative immunologic macrophage activation. J Exp Med. 176:287–292. 1992.PubMed/NCBI View Article : Google Scholar

6 

Fahlman C, Jacobsen FW, Veiby OP, McNiece IK, Blomhoff HK and Jacobsen SE: Tumor necrosis factor-alpha (TNF-alpha) potently enhances in vitro macrophage production from primitive murine hematopoietic progenitor cells in combination with stem cell factor and interleukin-7: Novel stimulatory role of p55 TNF receptors. Blood. 84:1528–1533. 1994.PubMed/NCBI

7 

He Y, Gao Y, Zhang Q, Zhou G, Cao F and Yao S: IL-4 switches microglia/macrophage M1/M2 polarization and alleviates neurological damage by modulating the JAK1/STAT6 pathway following ICH. Neuroscience. 437:161–171. 2020.PubMed/NCBI View Article : Google Scholar

8 

Kong X and Gao J: Macrophage polarization: A key event in the secondary phase of acute spinal cord injury. J Cell Mol Med. 21:941–954. 2017.PubMed/NCBI View Article : Google Scholar

9 

Kigerl KA, Gensel JC, Ankeny DP, Alexander JK, Donnelly DJ and Popovich PG: Identification of two distinct macrophage subsets with divergent effects causing either neurotoxicity or regeneration in the injured mouse spinal cord. J Neurosci. 29:13435–13444. 2009.PubMed/NCBI View Article : Google Scholar

10 

Akinrinmade OA, Chetty S, Daramola AK, Islam MU, Thepen T and Barth S: CD64: An attractive immunotherapeutic target for M1-type macrophage mediated chronic inflammatory diseases. Biomedicines. 5(56)2017.PubMed/NCBI View Article : Google Scholar

11 

Cheng Z, Bosco DB, Sun L, Chen X, Xu Y, Tai W, Didier R, Li J, Fan J, He X and Ren Y: Neural stem cell-conditioned medium suppresses inflammation and promotes spinal cord injury recovery. Cell Transplant. 26:469–482. 2017.PubMed/NCBI View Article : Google Scholar

12 

Matsubara K, Matsushita Y, Sakai K, Kano F, Kondo M, Noda M, Hashimoto N, Imagama S, Ishiguro N, Suzumura A, et al: Secreted ectodomain of sialic acid-binding Ig-like lectin-9 and monocyte chemoattractant protein-1 promote recovery after rat spinal cord injury by altering macrophage polarity. J Neurosci. 35:2452–2464. 2015.PubMed/NCBI View Article : Google Scholar

13 

Kano F, Matsubara K, Ueda M, Hibi H and Yamamoto A: Secreted ectodomain of sialic acid-binding ig-like lectin-9 and monocyte chemoattractant protein-1 synergistically regenerate transected rat peripheral nerves by altering macrophage polarity. Stem Cells. 35:641–653. 2017.PubMed/NCBI View Article : Google Scholar

14 

Chen N, Cen JS, Wang J, Qin G, Long L, Wang L, Wei F, Xiang Q, Deng DY and Wan Y: Targeted inhibition of leucine-rich repeat and immunoglobulin domain-containing protein 1 in transplanted neural stem cells promotes neuronal differentiation and functional recovery in rats subjected to spinal cord injury. Crit Care Med. 44:e146–e157. 2016.PubMed/NCBI View Article : Google Scholar

15 

Li X, Peng Z, Long L, Tuo Y, Wang L, Zhao X, Le W and Wan Y: Wnt4-Modified NSC transplantation promotes functional recovery after spinal cord injury. FASEB J. 34:82–94. 2020.PubMed/NCBI View Article : Google Scholar

16 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001.PubMed/NCBI View Article : Google Scholar

17 

Yang Q, Shi M, Shen Y, Cao Y, Zuo S, Zuo C, Zhang H, Gabrilovich DI, Yu Y and Zhou J: COX-1-Derived thromboxane A2 plays an essential role in early B-cell development via regulation of JAK/STAT5 signaling in mouse. Blood. 124:1610–1621. 2014.PubMed/NCBI View Article : Google Scholar

18 

Orecchioni M, Ghosheh Y, Pramod AB and Ley K: Macrophage polarization: Different gene signatures in M1(LPS+) vs. classically and M2(LPS-) vs. alternatively activated macrophages (vol 10, 1084, 2019). Front Immunol. 24(1084)2020.PubMed/NCBI View Article : Google Scholar

19 

Miller JE, Ahn SH, Marks RM, Monsanto SP, Fazleabas AT, Koti M and Tayade C: IL-17A Modulates peritoneal macrophage recruitment and m2 polarization in endometriosis. Front Immunol. 14:1082020.PubMed/NCBI View Article : Google Scholar

20 

Gu X, Zhang Y, Li D, Cai H, Cai L and Xu Q: N6-Methyladenosine demethylase FTO promotes M1 and M2 macrophage activation. Cell Signal. 69(109553)2020.PubMed/NCBI View Article : Google Scholar

21 

Zhang L, Zhang J, Jiang X, Yang L, Zhang Q, Wang B, Cui L and Wang X: Hydroxytyrosol inhibits LPS-induced neuroinflammatory responses via suppression of TLR-4-mediated NF-kappaB P65 activation and ERK signaling pathway. Neuroscience. 426:189–200. 2020.PubMed/NCBI View Article : Google Scholar

22 

Bagheri M, Mostafavinia A, Abdollahifar MA, Amini A, Ghoreishi SK, Chien S, Hamblin MR, Bayat S and Bayat M: Combined effects of metformin and photobiomodulation improve the proliferation phase of wound healing in type 2 diabetic rats. Biomed Pharmacother. 123(109776)2020.PubMed/NCBI View Article : Google Scholar

23 

Milich LM, Ryan CB and Lee JK: The origin, fate, and contribution of macrophages to spinal cord injury pathology. Acta Neuropathol. 137:785–797. 2019.PubMed/NCBI View Article : Google Scholar

24 

Liu YC, Zou XB, Chai YF and Yao YM: Macrophage polarization in inflammatory diseases. Int J Biol Sci. 10:520–529. 2014.PubMed/NCBI View Article : Google Scholar

25 

Labonte AC, Tosello-Trampont AC and Hahn YS: The role of macrophage polarization in infectious and inflammatory diseases. Mol Cells. 37:275–285. 2014.PubMed/NCBI View Article : Google Scholar

26 

Bai YH, Yin KM, Su T, Ji F and Zhang S: CTHRC1 in ovarian cancer promotes M2-like polarization of tumor-associated macrophages via regulation of the STAT6 signaling pathway. Onco Targets Ther. 13:5743–5753. 2020.PubMed/NCBI View Article : Google Scholar

27 

Gabrilovich DI, Ostrand-Rosenberg S and Bronte V: Coordinated regulation of myeloid cells by tumours. Nat Rev Immunol. 12:253–268. 2012.PubMed/NCBI View Article : Google Scholar

28 

Dvorak HF: Tumors: Wounds that do not heal-redux. Cancer Immunol Res. 3:1–11. 2015.PubMed/NCBI View Article : Google Scholar

29 

Hauk TG, Muller A, Lee J, Schwendener R and Fischer D: Neuroprotective and axon growth promoting effects of intraocular inflammation do not depend on oncomodulin or the presence of large numbers of activated macrophages. Exp Neurol. 209:469–482. 2008.PubMed/NCBI View Article : Google Scholar

30 

Li SY, Nie K, Zhang QX, Guo ML, Qiu YH, Li Y, Gao Y and Wang L: Macrophage migration inhibitory factor mediates neuroprotective effects by regulating inflammation, apoptosis and autophagy in Parkinson's disease. Neuroscience. 416:50–62. 2019.PubMed/NCBI View Article : Google Scholar

31 

Ghasemlou N, Lopez-Vales R, Lachance C, Thuraisingam T, Gaestel M, Radzioch D and David S: Mitogen-Activated protein kinase-activated protein kinase 2 (MK2) contributes to secondary damage after spinal cord injury. J Neurosci. 30:13750–13759. 2010.PubMed/NCBI View Article : Google Scholar

32 

Ghasemlou N, Bouhy D, Yang J, López-Vales R, Haber M, Thuraisingam T, He G, Radzioch D, Ding A and David S: Beneficial effects of secretory leukocyte protease inhibitor after spinal cord injury. Brain. 133:126–138. 2010.PubMed/NCBI View Article : Google Scholar

33 

Mantovani A, Biswas SK, Galdiero MR, Sica A and Locati M: Macrophage plasticity and polarization in tissue repair and remodelling. J Pathol. 229:176–185. 2013.PubMed/NCBI View Article : Google Scholar

34 

Marchetti V, Yanes O, Aguilar E, Wang M, Friedlander D, Moreno S, Storm K, Zhan M, Naccache S, Nemerow G, et al: Differential macrophage polarization promotes tissue remodeling and repair in a model of ischemic retinopathy. Sci Rep. 76(1038)2011.PubMed/NCBI View Article : Google Scholar

35 

Ahuja CS, Nori S, Tetreault L, Wilson J, Kwon B, Harrop J, Choi D and Fehlings MG: Traumatic spinal cord injury-repair and regeneration. Neurosurgery. 80:S9–S22. 2017.PubMed/NCBI View Article : Google Scholar

36 

Saberi H, Firouzi M, Habibi Z, Moshayedi P, Aghayan HR, Arjmand B, Hosseini K, Razavi HE and Yekaninejad MS: Safety of intramedullary schwann cell transplantation for postrehabilitation spinal cord injuries: 2-Year follow-up of 33 cases. J Neurosurg Spine. 15:515–525. 2011.PubMed/NCBI View Article : Google Scholar

37 

Assinck P, Duncan GJ, Hilton BJ, Plemel JR and Tetzlaff W: Cell transplantation therapy for spinal cord injury. Nat Neurosci. 20:637–647. 2017.PubMed/NCBI View Article : Google Scholar

38 

Nakajima H, Uchida K, Guerrero AR, Watanabe S, Sugita D, Takeura N, Yoshida A, Long G, Wright KT, Johnson WE and Baba H: Transplantation of mesenchymal stem cells promotes an alternative pathway of macrophage activation and functional recovery after spinal cord injury. J Neurotrauma. 29:1614–1625. 2012.PubMed/NCBI View Article : Google Scholar

39 

Kaushal V, Koeberle PD, Wang Y and Schlichter LC: The Ca2+-activated K+ channel KCNN4/KCa3.1 contributes to microglia activation and nitric oxide-dependent neurodegeneration. J Neurosci. 27:234–244. 2007.PubMed/NCBI View Article : Google Scholar

40 

Bao F, Bailey CS, Gurr KR, Bailey SI, Rosas-Arellano MP, Dekaban GA and Weaver LC: Increased oxidative activity in human blood neutrophils and monocytes after spinal cord injury. Exp Neurol. 215:308–316. 2009.PubMed/NCBI View Article : Google Scholar

41 

Rathore KI, Kerr BJ, Redensek A, Lopez-Vales R, Jeong SY, Ponka P and David S: Ceruloplasmin protects injured spinal cord from iron-mediated oxidative damage. J Neurosci. 28:12736–12747. 2008.PubMed/NCBI View Article : Google Scholar

42 

Kroner A, Greenhalgh AD, Zarruk JG, Passos Dos Santos R, Gaestel M and David S: TNF and increased intracellular iron alter macrophage polarization to a detrimental M1 phenotype in the injured spinal cord. Neuron. 83:1098–1116. 2014.PubMed/NCBI View Article : Google Scholar

43 

Brykczynska U, Geigges M, Wiedemann SJ, Dror E, Boni-Schnetzler M, Hess C, Donath MY and Paro R: Distinct transcriptional responses across tissue-resident macrophages to short-term and long-term metabolic challenge. Cell Rep. 30:1627–1643. 2020.PubMed/NCBI View Article : Google Scholar

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Ji Z, Jiang X, Li Y, Song J, Chai C and Lu X: Neural stem cells induce M2 polarization of macrophages through the upregulation of interleukin‑4. Exp Ther Med 20: 148, 2020.
APA
Ji, Z., Jiang, X., Li, Y., Song, J., Chai, C., & Lu, X. (2020). Neural stem cells induce M2 polarization of macrophages through the upregulation of interleukin‑4. Experimental and Therapeutic Medicine, 20, 148. https://doi.org/10.3892/etm.2020.9277
MLA
Ji, Z., Jiang, X., Li, Y., Song, J., Chai, C., Lu, X."Neural stem cells induce M2 polarization of macrophages through the upregulation of interleukin‑4". Experimental and Therapeutic Medicine 20.6 (2020): 148.
Chicago
Ji, Z., Jiang, X., Li, Y., Song, J., Chai, C., Lu, X."Neural stem cells induce M2 polarization of macrophages through the upregulation of interleukin‑4". Experimental and Therapeutic Medicine 20, no. 6 (2020): 148. https://doi.org/10.3892/etm.2020.9277
Copy and paste a formatted citation
x
Spandidos Publications style
Ji Z, Jiang X, Li Y, Song J, Chai C and Lu X: Neural stem cells induce M2 polarization of macrophages through the upregulation of interleukin‑4. Exp Ther Med 20: 148, 2020.
APA
Ji, Z., Jiang, X., Li, Y., Song, J., Chai, C., & Lu, X. (2020). Neural stem cells induce M2 polarization of macrophages through the upregulation of interleukin‑4. Experimental and Therapeutic Medicine, 20, 148. https://doi.org/10.3892/etm.2020.9277
MLA
Ji, Z., Jiang, X., Li, Y., Song, J., Chai, C., Lu, X."Neural stem cells induce M2 polarization of macrophages through the upregulation of interleukin‑4". Experimental and Therapeutic Medicine 20.6 (2020): 148.
Chicago
Ji, Z., Jiang, X., Li, Y., Song, J., Chai, C., Lu, X."Neural stem cells induce M2 polarization of macrophages through the upregulation of interleukin‑4". Experimental and Therapeutic Medicine 20, no. 6 (2020): 148. https://doi.org/10.3892/etm.2020.9277
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team