Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Molecular Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1107-3756 Online ISSN: 1791-244X
Journal Cover
July-2016 Volume 38 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
July-2016 Volume 38 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

IL-1α induces apoptosis and inhibits the osteoblast differentiation of MC3T3-E1 cells through the JNK and p38 MAPK pathways

  • Authors:
    • Chun Guo
    • Xu-Guang Yang
    • Fei Wang
    • Xu-Yuan Ma
  • View Affiliations / Copyright

    Affiliations: Department of Medicine, Luohe Medical College, Luohe, Henan 462002, P.R. China, Huaihe Hospital, Henan University, Kaifeng, Henan 475000, P.R. China
  • Pages: 319-327
    |
    Published online on: May 25, 2016
       https://doi.org/10.3892/ijmm.2016.2606
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Interleukin (IL)-1 is a proinflammatory cytokine that plays important roles in inflammation and host responses to infection. The present study aimed to evaluate the effects of IL-1α on the apoptosis and differentiation of osteoblasts, and to elucidate the mechanism responsible for these effects in the osteoblast‑like cell line MC3T3-E1. The MC3T3-E1 cells were non-treated or treated with IL-1α. Following treatment, cell viability, alkaline phosphatase (ALP) activity and caspase-3 activity were evaluated. The expression of osteoblast-specific genes as well as Bax, Bcl-2 and caspase-3 were determined by reverse transcription-quantitative polymerase chain reaction (RT-qPCR). The protein levels of Bax, Bcl-2, caspase-3 and the phosphorylation of mitogen-activated protein kinases (MAPKs, also known as MAP kinases) were evaluated using western blot analysis. The MAPK signaling pathway was blocked by pre-treatment with MAPK inhibitors SB203580, PD98059 and SP600125. IL-1α treatment induced a significant decrease in cell viability and ALP activity in the MC3T3-E1 cells. IL-1α also significantly decreased the mRNA expression and protein levels of osteoblast-related genes in the MC3T3-E1 cells. On the other hand, IL-1α significantly upregulated the mRNA expression and protein levels of Bax and caspase-3 as well as caspase-3 activity, whereas Bcl-2 expression was decreased in the MC3T3-E1 cells. Furthermore, IL-1α activated the apoptotic signaling pathway by increasing the phosphorylation of c-Jun N-terminal kinase (JNK) and p38-MAPK, whereas it inhibited the phosphorylation of extracellular signal-regulated kinase 1/2 (ERK1/2). Moreover, pre-treatment with MAPK inhibitors attenuated the phosphorylation of JNK, p38 and Bax expression enhanced by IL-1α. However, MAPK inhibitors markedly increased the protein expression of osteoblast-related genes and Bcl-xL in the MC3T3-E1 cells downregulated by IL-1α. Taken together, these findings suggest that IL-1α induces the apoptosis of osteoblasts and inhibits osteoblast differentiation by activating the JNK and the p38 MAPK pathways.

Introduction

Bone is a dynamic tissue that constantly undergoes remodeling through a coupled process of bone formation by osteoblasts and resorption by osteoclasts throughout life (1). Chronic osteomy-elitis, a persistent infection of the bone, involves dysregulation of this process which results in excessive bone resorption (2).

Interleukin (IL)-1 is a proinflammatory cytokine that plays important roles in inflammation and host responses to infection (3,4). Once released, IL-1 elicits a multitude of effects on target cells that lead to and modulate the inflammatory response as well as tissue damage (3). The two forms of IL-1, IL-1α and IL-1β, have similar biological activities but different functional roles in the body (3,5). Bone is highly sensitive to IL-1, which is involved in the regulation of bone formation (6–8) and bone resorption (9–12).

Mitogen-activated protein kinases (MAPKs, also known as MAP kinases), including c-Jun N-terminal kinase (JNK) and p38, are involved in the progression of inflammatory responses and in the apoptosis of osteoblasts (13–15). Moreover, the mechanism responsible for the effects of IL-1 on the differentiation and apoptosis of osteoblasts, which may occur through the MAPK signaling pathways, remains unclear. Thus, research into the effects of IL-1 on osteoblast differentiation and function as well as the subsequent development and evaluation of potential drugs suitable for preventing bone destruction in infective bone diseases remains an area of great interest.

The aim of the present study was to evaluate the mechanism responsible for the effects of IL-1α on the differentiation and apoptosis of osteoblasts. We also aimed to elucidate the mechanism through which IL-1α induces MAPK phosphorylation.

Materials and methods

Reagents

IL-1α was purchased from PeproTec (Rocky Hill, NJ, USA). 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), 4-(2-hydroxyethyl)-1-piperazineethane-sulfonic acid (HEPES), protease inhibitor cocktail, and the selective MAPK inhibitors SB203580, PD98059 and SP600125 were all purchased from Calbiochem (San Diego, CA, USA). An alkaline phosphatase (ALP) colorimetric assay kit and a caspase-3 activity kit were purchased from Beyotime Institute of Biotechnology (Shanghai, China). Dulbecco's modified Eagle's medium (DMEM), fetal bovine serum (FBS) and penicillin/streptomycin were purchased from Gibco (Rockville, MD, USA). Antibodies to Bcl-2 (#2870), Bcl-xL (#2764), p38 MAPK (#9212), phosphorylated (p-)p38 (#9211), extracellular signal-regulated kinase (ERK)1/2 (#4695) and p-ERK1/2 (#4370) were purchased from Cell Signaling Technology, Inc. (Beverly, MA, USA). Antibodies to caspase-3 (sc-7148), Bax (sc-493), cytochrome c (sc-13156), JNK1/2 (sc-571), p-JNK1/2 (sc-12882), osterix (OSX; sc-393325), osteocalcin (OCN; sc-390877), ALP (sc-137213) and β-actin (sc-47778) were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, USA). Antibodies to runt-related transcription factor 2 (Runx2; ab76956) were purchased from Abcam (Cambridge, UK). The osteoblast-like cell line MC3T3-E1 was obtained from the American Type Culture Collection (ATCC; Manassas, VA, USA). All other chemicals and reagents used in the present study were of analytical grade.

Cell culture

The MC3T3-E1 cells were grown in DMEM supplemented with 10% (v//v) FBS, 1% (v/v) penicillin-strep-tomycin solution, 10 mM HEPES solution and incubated at 37°C in a 5% CO2 humidified atmosphere in air. To evaluate the effect of IL-1α on the differentiation and function of osteoblasts, the MC3T3-E1 cells at a density of 5×104 cells/cm2 were cultured in osteogenic differentiation medium (DMEM with 10% FBS, 10 mM HEPES, 50 µg/ml L-ascorbic acid and 5 mM β-glycerophosphate (β-GP) for 2 days. On differentiation day 3, the cells were treated with 0.5, 1, 2.5, 5 and 10 ng/ml IL-1α or without IL-1α for the indicated times. To evaluate the effect of MAPK inhibitors on the phosphorylation of MAPKs in osteoblasts induced by IL-1α, MAPK inhibitors were applied for 2 h prior to IL-1α treatment.

Cell viability assay

Cell viability was measured using an MTT assay. The MC3T3-E1 cells (5×103 cells/well) were plated in 96-well culture plates in 0.2 ml culture medium and incubated overnight. To evaluate the effect of IL-1α on cell viability, the cells were treated with 0.5, 1, 2.5, 5 and 10 ng/ml IL-1α or without IL-1α for 1, 3 and 5 days. At the end of treatment, 20 µl MTT (5 mg/ml) was added to each well. The cells were cultured for an additional 4 h, the supernatant was removed, and then 100 µl dimethyl sulfoxide was added to each well. After shaking for 3 min, absorbance was measured at 490 nm using a microplate reader (Thermo MK3; Thermo Fisher Scientific Inc., Pittsburgh, PA, USA). The experiment was performed in triplicate.

Determination of ALP activity

The MC3T3-E1 cells were cultured in 100-mm diameter culture dishes in the presence or absence of IL-1α for 24 h. The supernatant was discarded and then subjected to the intracellular ALP enzyme assay as previously described (14). Briefly, the cells were detached mechanically with a cell scraper in phosphate-buffered saline (PBS), and then centrifuged at 15,000 × g for 8 min. Cell pellets was placed in 300 µl of lysis buffer (Cytobuster protein extraction reagent; Novagen, Darmstadt, Germany) with 1X protease inhibitor cocktail. The ALP activity in the lysates was determined by the measurement of p-nitrophenyl phosphate (PNPP) using a commercial assay kit (Beyotime Institute of Biotechnology). The absorbance of the reaction mixture was measured by spectrophotometry (Eppendorf BioSpectrometer; Eppendorf AG, Hamburg, Germany) at 405 nm. Three replicates from each group were analyzed. Total protein concentrations were quantified by spectrophotometry (Eppendorf BioSpectrometer). ALP activity was normalized to the total protein in each sample.

Measurement of caspase-3 activity

The MC3T3-E1 cells were cultured in 100-mm-diameter culture dishes in the presence or absence of IL-1α for 24 h. The activity of caspase-3 was determined using the caspase-3 activity kit (Beyotime Institute of Biotechnology) according to the manufacturer's instructions, and then detected by spectrophotometry (Eppendorf BioSpectrometer). Briefly, the cells were detached with the aid of a cell scraper in PBS buffer, then centrifuged at 15,000 × g for 8 min and the cell pellets was placed in 300 µl of lysis buffer (Cytobuster protein extraction reagent) with 1X protease inhibitor cocktail. Total protein concentrations were quantified by spectrophotometry (Eppendorf BioSpectrometer). The samples were then incubated with a mixture provided in the kit, containing Ac-DEVD-pNA, the substrate of caspase-3. The optical density (coloration) resulting from the cleavage of the substrate and the release of pNA, was detected and quantified by spectrophotometry at 405 nm. A standard curve was also generated using a series of diluted pNA of known concentrations. The concentration was calculated by projecting the optical densities on the standard curve. All the experiments were performed in triplicate.

Analysis of the apoptosis of osteoblasts

To measure apoptosis, we performed Hoechst 33258 staining (Beyotime Institute of Biotechnology) to visualize nuclear morphology and nucleo-somal DNA fragmentation in osteoblasts. The MC3T3-E1 cells (4×104 cells/cm2) were seeded into 12-well plates and incubated overnight prior to the experiment. The cells were treated with 0.5, 1, 2.5, 5 and 10 ng/ml IL-1α or without IL-1α for 1 day. At the end of the treatment, the cells were washed to remove non-adherent cells, and the adherent cells were fixed in 4% paraformaldehyde solution for 10 min. After washing with PBS, the cells were incubated with 0.2 mM Hoechst 33258 for 5 min in the dark. The cells with nuclei containing clearly condensed chromatin or the cells with fragmented nuclei were scored as apoptotic; the results were expressed as the number of apoptotic cells. The images of apoptotic osteoblasts were captured with a fluorescence microscope (Olympus IX71; Olympus Optical, Tokyo, Japan).

RNA isolation and reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Total RNA was isolated using TRIzol reagent (Invitrogen, Grand Island, NY, USA) and quantified by spectrophotometry. After isolation, 2 µg total RNA from each sample was reverse transcribed utilizing the HiFi-MMLV cDNA kit (Beijing CoWin Biotech Co., Ltd., Beijing, China) according to the manufacturer's instructions. The primer sequences of the osteoblast-associated genes, caspase-3, Bax and β-actin (Generay Biotech Co., Ltd., Shanghai, China) and annealing temperatures used in this study are listed in Table I. qPCR was performed with SYBR® Premix Ex Taq™ (Takara, Dalian, China) according to the manufacturer's instructions. All qPCR reactions were performed using the ABI 7300 sequence detection system (Applied Biosystems, Grand Island, NY, USA). In each reaction, 1 µl cDNA, 10 µl SYBR® Premix Ex Taq (Takara), and 0.4 µM forward and reverse primer in a total volume of 20 µl were used. The reaction conditions were as follows: 1 cycle of 95°C for 30 sec followed by 40 cycles of 95°C for 5 sec and 60–66°C for 30 sec. qPCR assays were run in triplicate for each sample. β-actin was used as the internal control, and all results were analyzed using the standard 2−ΔΔCT method as described previously (16).

Table I

List of primers used for RT-qPCR.

Table I

List of primers used for RT-qPCR.

GenePrimer sequences 5′→3′ (forward/reverse)Accession numberAnnealing temperature (°C)Product size (bp)
ALP GAGCGTCATCCCAGTGGAG
TAGCGGTTACTGTAGACACCC
NM_00743362158
OCN CTGACCTCACAGATCCCAAGC
TGGTCTGATAGCTCGTCACAAG
NM_03136862187
Runx2 TTCAACGATCTGAGATTTGTGGG
GGATGAGGAATGCGCCCTA
NM_00114603862221
OSX ATGGCGTCCTCTCTGCTTG
TGAAAGGTCAGCGTATGGCTT
NM_13045862156
Bax AGACAGGGGCCTTTTTGCTAC
AATTCGCCGGAGACACTCG
NM_00752760137
Caspase-3 TGGTGATGAAGGGGTCATTTATG
TTCGGCTTTCCAGTCAGACTC
BC03882560105
β-actin GGCTGTATTCCCCTCCATCG
CCAGTTGGTAACAATGCCATGT
NM_00739360154

[i] ALP, alkaline phosphatase; OCN, osteocalcin; Runx2, runt-related transcription factor 2; OSX, osterix.

Western blot analysis

At the end of treatment, the cell culture medium was aspirated and the cells were detached in PBS by scraping. The detached cells were centrifuged at 15,000 × g at 4°C for 8 min. Cell pellets were lysed in 300 µl lysis buffer (Cytobuster protein extraction reagent) with 25 mM NaF, 1 mM Na3VO4, and 1X protease inhibitor cocktail. Protein concentrations were quantified by spectrophotometry (Eppendorf BioSpectrometer). For the western blot analysis, equal amounts of protein from each sample were separated by SDS-PAGE and electrotrans-ferred onto PVDF membranes (Millipore, Bedford, MA, USA). The membranes were then blocked with 5% (w/v) bovine serum albumin in TBST [10 mM Tris, 150 mM NaCl, and 0.1% (v/v) Tween-20, pH 7.5] for 1 h at room temperature, and incubated with primary antibodies: rabbit polyclonal anti-JNK, p-JNK, β-actin, capase-3, Bax, mouse polyclonal anti-OSX, ALP, OCN, Runx2 and cytochrome c at dilutions of 1:300 (all from Santa Cruz Biotechnology, Inc.); rabbit polyclonal anti-ERK1/2, p-ERK1/2, p38, p-p38, Bcl-2 and Bcl-xL at dilutions of 1:800 (Cell Signaling Technology, Inc.). The secondary antibodies used for detection were horseradish peroxidase (HRP)-conjugated goat anti-rabbit immunoglobulin G (IgG) and HRP-conjugated goat anti-mouse IgG (both from Santa Cruz Biotechnology, Inc.). Enhanced chemiluminescence (ECL; Beijing CoWin Biotech Co., Ltd.) was performed in order to detect immunoreactive protein signals. Protein signals were visualized and images were captured with a chemiluminescence detection system (MiniChemi™ III; Beijing Sage Creation Science Co., Ltd., Beijing, China) and quantified using ImageJ software (National Institutes of Health, Bethesda, MD, USA). For re-probing, the PVDF membranes were stripped with 0.2 M NaOH for 15 min prior to blocking with another primary antibody. The expression of molecules of interest was determined relative to β-actin.

Statistical analysis

The data are expressed as the means ± standard deviation (SD) for three or more independent experiments. Significant differences were determined using factorial analysis of variance (ANOVA). Statistical analysis was performed using SPSS 13.0 software. A P-value <0.05 was considered to indicate a statistically significant difference.

Results

Effect of IL-1α on the viability of MC3T3-E1 cells

The MC3T3-E1 cells were treated with IL-1α at concentrations of 0.5, 1, 2.5, 5 and 10 ng/ml or without IL-1α for 1, 3 and 5 days. MTT assays showed that the viability of the MC3T3-E1 cells exposed to IL-1α was significantly reduced compared with that in the non-treated culture at 1, 3 and 5 days (P<0.01) (Fig. 1A).

Figure 1

(A) Effect of interleukin (IL)-1α on the viability of MC3T3-E1 cells at days 1, 3 and 5. (B) Effect of IL-1α on alkaline phosphatase (ALP) activity in MC3T3-E1 cells at 24 h. *P<0.05 and **P<0.01 vs. non-treated culture. Data represent the means ± SD from three independent experiments.

Effect of IL-1α on ALP activity in MC3T3-E1 cells

The MC3T3-E1 cells were treated with IL-1α at concentrations of 0.5, 1, 2.5, 5 and 10 ng/ml or without IL-1α for 24 h. The ALP activity in the MC3T3-E1 cells exposed to IL-1 was signifi-cantly decreased in a dose-dependent manner compared with that in the non-treated culture at 1 day (P<0.01) (Fig. 1B).

Effect of IL-1α on caspase-3 activity in MC3T3-E1 cells

To evaluate IL-1α-induced caspase-3 activity, the MC3T3-E1 cells were treated with IL-1α at concentrations of 0.5, 1, 2.5, 5 and 10 ng/ml or without IL-1α for 24 h. IL-1α significantly increased caspase-3 activity in a dose-dependent manner compared with that in the non-treated culture at 24 h (P<0.01) (Fig. 2A).

Figure 2

(A) Effect of interleukin (IL)-1α on caspase-3 activity in MC3T3-E1 cells following IL-1α treatment for 24 h. (B) Effect of IL-1α on the mRNA expression of caspase-3 and Bax in MC3T3-E1 cells following IL-1α treatment for 24 h. *P<0.05 and **P<0.01 vs. non-treated culture. Data represent the means ± SD from three independent experiments.

Effect of IL-1α on the mRNA and protein expression of Bax, Bcl-2 and caspase-3 in MC3T3-E1 cells

The MC3T3-E1 cells were treated with IL-1α at concentrations of 0.5, 1, 2.5, 5 and 10 ng/ml or without IL-1α for 24 h. IL-1 significantly increased the mRNA expression and the protein levels of Bax and caspase-3 in a dose-dependent manner compared with that in the non-treated culture at 24 h (P<0.01), whereas Bcl-2 expression was decreased (P<0.01) in the MC3T3-E1 cells (Figs. 2B and 3). Following treatment with IL-1α at 5 ng/ml for 24 h, IL-1α significantly increased the protein expression of Bax, cytochrome c and caspase-3 in a time-dependent manner compared with that in the non-treated culture, whereas Bcl-2 expression was unaffected (Fig. 4).

Figure 3

(A and B) Effect of interleukin (IL)-1α on the protein expression of caspase-3, cytochrome c, Bax and Bcl-2 at 24 h after IL-1α treatment (0, 0.5, 1, 2.5, 5 or 10 ng/ml) in MC3T3-E1 cells. *P<0.05 and **P<0.01 vs. non-treated culture.

Figure 4

Effect of interleukin (IL)-1α on the protein expression of caspase-3, cytochrome c, Bax and Bcl-2 at 0, 15, 30 min, 1, 2, 4, 8, 16 and 24 h after IL-1α treatment (5 ng/ml) in MC3T3-E1 cells.

Effect of IL-1α on cell apoptosis

Following incubation with IL-1α at 0.5, 1, 2.5, 5 and 10 ng/ml or without IL-1α for 24 h, Hoechst 33258 staining of the cells was analyzed under a fluorescence microscope. The cells with nuclei containing condensed chromatin or the cells with fragmented nuclei were defined as apoptotic cells. The number of fluorescence-positive osteoblasts was increased by IL-1α treatment in a dose-dependent manner compared with that in the non-IL-1α-treated group at 24 h (Fig. 5).

Figure 5

Effect of interleukin (IL)-1α on nuclear condensation in MC3T3-E1 cells at 24 h after IL-1α treatment. Hoescht 33258-stained cells were analyzed under a fluorescence microscope (magnification, ×40). (A) IL-1α induced nuclear condensation in MC3T3-E1 cells. (B) The number of fluorescence-positive osteoblasts increased with IL-1α in a dose-dependent manner compared with that in the non-treated osteoclasts. *P<0.05 and **P<0.01 vs. non-treated cells. Data represent the means ± SD from three independent experiments.

Effect of IL-1α on the mRNA and protein expression of osteoblast-specific genes in MC3T3-E1 cells

The MC3T3-E1 cells were treated with IL-1α at concentrations of 0.5, 1, 2.5, 5 and 10 ng/ml or without IL-1α for 24 or 48h. IL-1 significantly decreased the mRNA expression and the protein levels of the osteoblast-specific genes Runx2, ALP, OSX and OCN in the MC3T3-E1 cells in a dose-dependent manner compared with those in the non-treated culture at 24 h (P<0.01) (Figs. 6 and 7).

Figure 6

mRNA expression of runt-related transcription factor 2 (Runx2), alkaline phosphatase (ALP), osterix (OSX) and osteocalcin (OCN) following interleukin (IL)-1α treatment (0, 0.5, 1, 2.5, 5 or 10 ng/ml) in MC3T3-E1 cells at 24 h. *P<0.05 and **P<0.01 vs. non-treated culture. Data represent the means ± SD from three independent experiments.

Figure 7

(A and C) Effect of interleukin (IL)-1α on the protein expression of osterix (OSX), osteocalcin (OCN), runt-related transcription factor 2 (Runx2) and alkaline phosphatase (ALP) at 24 h after IL-1α treatment (0, 0.5, 1, 2.5, 5 or 10 ng/ml) in MC3T3-E1 cells. (B) Effect of IL-1α on the protein expression of OSX, OCN, Runx2 and ALP at 0, 12, 24 and 48 h after IL-1α treatment (5 ng/ml) in MC3T3-E1 cells. *P<0.05 and **P<0.01.

Effect of IL-1 on the activation of MAPK in MC3T3-E1 cells

As MAP kinases are important regulators of inflammatory mediators and osteoblast differentiation, we performed western blot analysis to examine the effect of IL-1α on the activation of MAPKs in the MC3T3-E1 cells. The results showed that IL-1α at concentrations of 5 ng/ml significantly enhanced the protein levels of phosphorylated p38 MAPK, JNK1/2 and ERK1/2 at the 1 h incubation time (Fig. 8); moreover IL-1α at concentrations >5 ng/ml enhanced the protein levels of p-p38 MAPK and p-JNK1/2, whereas it markedly inhibited those of p-ERK1/2 (Fig. 9).

Figure 8

(A and B) Effect of interleukin (IL)-1α treatment (5 ng/ml) on the protein expression of mitogen-activated protein kinases (MAPKs) at 0, 15, 30 min, 1, 2 and 4 h in MC3T3-E1 cells. *P<0.05 and **P<0.01. Data represent the means ± SD from three independent experiments.

Figure 9

(A and B) Effect of interleukin (IL)-1α treatment (0, 0.5, 1, 2.5, 5 or 10 ng/ml) on the protein expression of mitogen-activated protein kinases (MAPKs) at 1 h in MC3T3-E1 cells. *P<0.05 and **P<0.01. Data represent the means ± SD from three independent experiments.

As controls, the MAPK inhibitors SP600125, PD98059 and SB203580 were applied for 2 h prior to IL-1α treatment and then proteins were prepared at 1 or 24 h after IL-1α treatment in the presence of MAPK inhibitors. The results showed that pre-treatment with the MAPK inhibitors attenuated the phosphorylation of JNK and p38 MAPK induced by IL-1α; however, pre-treatment with the PD98059 (ERK inhibitor) resulted in the further inhibition of the phosphorylation of ERK1/2 induced by IL-1α (Fig. 10). Moreover, pre-treatment with the MAPK inhibitors decreased the protein expression of Bax induced by IL-1α in the MC3T3-E1 cells. However, MAPK inhibitors markedly increased the protein expression of osteoblast-related genes and Bcl-xL in the MC3T3-E1 cells downregulated by IL-1α (Fig. 11).

Figure 10

Effect of pre-treatment with mitogen-activated protein kinase (MAPK) inhibitors on the protein expression of MAPKs in MC3T3-E1 cells following interleukin (IL)-1α treatment (5 ng/ml) at 1 h. (A) PD98059 [extracellular signal-regulated kinase (ERK) inhibitor]; (B) SB203580 (p38 inhibitor); (C) SP600125 [c-Jun N-terminal kinase (JNK) inhibitor].

Figure 11

(A) Effect of pre-treatment with mitogen-activated protein kinase (MAPK) inhibitors on the protein expression of osteoblast-related genes in MC3T3-E1 cells following interleukin (IL)-1α treatment (5 ng/ml) at 24 h. (B) Effect of pre-treatment with MAPK inhibitors on the protein expression of Bax and Bcl-xL in MC3T3-E1 cells following IL-1α treatment (5 ng/ml) at 24 h.

Discussion

Excessive bone resorption in chronic inflammatory diseases, such as septic arthritis, osteomyelitis and infected orthopedic implant failure, is at least partially caused by the activation of bacteria-induced inflammatory responses (2). IL-1, a proin-flammatory cytokine that is important in inflammation and host responses to infection, plays a well documented role in the modulation of osteoclastic bone resorption (10–12) and bone formation (6–9). However, the mechanism responsible for the effects of IL-1 on the differentiation and function of osteoblasts remains unclear. In the present study, IL-1α directly induced apoptosis and inhibited osteoblast differentiation of MC3T3-E1 osteoblasts. Our results confirmed that IL-1α inhibits osteoblast differentiation directly (6–9).

The inhibitory effect of IL-1α on osteoblast differentiation was confirmed by evaluating the expression of osteoblast marker genes. Runx2 (Cbfa1) is required for mesenchymal cell differentiation into preosteoblasts (17,18). OSX, downstream of Runx2, is an osteoblast-specific transcription factor essential for osteoblast differentiation and bone formation (19,20). ALP has been suggested to be involved in the early-stage molecular events of osteoblast differentiation, whereas OCN is involved in the late-stage molecular events (13,21). In the present study, the mRNA expression and protein levels of Runx2, ALP, OSX and OCN as well as ALP activity in MC3T3-E1 cells were significantly downregulated by IL-1α in a dose-dependent manner. Taken together, these findings indicate that the inhibitory effect of IL-1α on osteoblast differentiation may be due to the inhibition of osteoblast-related genes.

The induction of osteoblast apoptosis results in further bacteria-induced bone destruction (2). We evaluated the effect of IL-1α on inducing the apoptosis of MC3T3-E1 cells. Our data show that IL-1α significantly upregulated the expression of Bax, cytochrome c and caspase-3 as well as increasing caspase-3 activity, whereas Bcl-2 expression was decreased in the MC3T3-E1 cells. These results indicated that IL-1 induced osteoblast apoptosis in a dose-dependent manner compared with the non-treated cells. Moreover, IL-1α enhanced the protein levels of p-JNK and p-p38 MAPK in the MC3T3-E1 cells. Based on our results, we suggest that IL-1 induces the apoptosis of osteoblasts through a mitochondrial pathway.

MAP kinases are activated by various stresses, including proinflammatory cytokines, and affect apoptosis either positively or negatively (22,23). In many cell types, JNK and p38 MAPK contribute to the induction of apoptosis, whereas ERK inhibits apoptotic processes (23–26). In the present study, treatment with IL-1α enhanced the protein levels of p-p38 and p-JNK whereas it inhibited the phosphorylation of ERK. Pre-treatment with MAPK inhibitors attenuated the phosphorylation of JNK and p38 enhanced by IL-1α. Moreover, pre-treatment with MAPK inhibitors decreased the protein expression of Bax induced by IL-1α in the MC3T3-E1 cells. However, MAPK inhibitors markedly increased the protein expression of osteoblast-related genes and Bcl-xL in MC3T3-E1 cells downregulated by IL-1α. This suggests that the JNK and the p38 MAPK pathways play a vital role in regulating IL-1α-induced apoptosis and osteoblast differentiation of MC3T3-E1 cells.

In conclusion, our data suggest that IL-1α induces osteo-blast apoptosis and inhibits bone formation by activating the JNK and the p38 MAPK pathways. These results indicate that agents modulating the JNK and the p38 MAPK pathways may be of potential therapeutic use for restoring osteoblast function in bacteria-induced bone diseases.

Acknowledgments

The present study was supported by a research grant from the National Natural Science Foundation of China (grant no. 81371981), the School Fund of Luohe Medical College (no. 2014-DF-002; 2013-S-LMC04) and the Fund of Henan Provincial Health Bureau (no. 201203081).

References

1 

Roodman GD: Advances in bone biology: the osteoclast. Endocr Rev. 17:308–332. 1996.PubMed/NCBI

2 

Nair SP, Meghji S, Wilson M, Reddi K, White P and Henderson B: Bacterially induced bone destruction: mechanisms and misconceptions. Infect Immun. 64:2371–2380. 1996.PubMed/NCBI

3 

Dinarello CA: Biologic basis for interleukin-1 in disease. Blood. 87:2095–2147. 1996.PubMed/NCBI

4 

Nakae S, Asano M, Horai R and Iwakura Y: Interleukin-1 beta, but not interleukin-1 alpha, is required for T-cell-dependent antibody production. Immunology. 104:402–409. 2001. View Article : Google Scholar

5 

Garlanda C, Dinarello CA and Mantovani A: The interleukin-1 family: back to the future. Immunity. 39:1003–1018. 2013. View Article : Google Scholar : PubMed/NCBI

6 

Stashenko P, Dewhirst FE, Rooney ML, Desjardins LA and Heeley JD: Interleukin-1 beta is a potent inhibitor of bone formation in vitro. J Bone Miner Res. 2:559–565. 1987. View Article : Google Scholar : PubMed/NCBI

7 

Ohmori Y, Hanazawa S, Amano S, Hirose K, Kumegawa M and Kitano S: Effects of recombinant human interleukin I alpha and interleukin 1 beta on cell growth and alkaline phosphatase of the mouse osteoblastic cell line MC3T3-E1. Biochim Biophys Acta. 970:22–30. 1988. View Article : Google Scholar : PubMed/NCBI

8 

Lacey DL, Grosso LE, Moser SA, Erdmann J, Tan HL, Pacifici R and Villareal DT: IL-1-induced murine osteoblast IL-6 production is mediated by the type 1 IL-1 receptor and is increased by 1,25 dihydroxyvitamin D3. J Clin Invest. 91:1731–1742. 1993. View Article : Google Scholar : PubMed/NCBI

9 

Lee YM, Fujikado N, Manaka H, Yasuda H and Iwakura Y: IL-1 plays an important role in the bone metabolism under physiological conditions. Int Immunol. 22:805–816. 2010. View Article : Google Scholar : PubMed/NCBI

10 

Gowen M, Wood DD, Ihrie EJ, McGuire MK and Russell RG: An interleukin 1-like factor stimulates bone resorption in vitro. Nature. 306:378–380. 1983. View Article : Google Scholar : PubMed/NCBI

11 

Lorenzo JA, Sousa SL, Alander C, Raisz LG and Dinarello CA: Comparison of the bone-resorbing activity in the supernatants from phytohemagglutinin-stimulated human peripheral blood mononuclear cells with that of cytokines through the use of an antiserum to interleukin 1. Endocrinology. 121:1164–1170. 1987. View Article : Google Scholar : PubMed/NCBI

12 

Nakamura I and Jimi E: Regulation of osteoclast differentiation and function by interleukin-1. Vitam Horm. 74:357–370. 2006. View Article : Google Scholar : PubMed/NCBI

13 

Matsuguchi T, Chiba N, Bandow K, Kakimoto K, Masuda A and Ohnishi T: JNK activity is essential for Atf4 expression and late-stage osteoblast differentiation. J Bone Miner Res. 24:398–410. 2009. View Article : Google Scholar

14 

Guo C, Yuan L, Wang JG, Wang F, Yang XK, Zhang FH, Song JL, Ma XY, Cheng Q and Song GH: Lipopolysaccharide (LPS) induces the apoptosis and inhibits osteoblast differentiation through JNK pathway in MC3T3-E1 cells. Inflammation. 37:621–631. 2014. View Article : Google Scholar

15 

Guo C, Wang SL, Xu ST, Wang JG and Song GH: SP600125 reduces lipopolysaccharide-induced apoptosis and restores the early-stage differentiation of osteoblasts inhibited by LPS through the MAPK pathway in MC3T3-E1 cells. Int J Mol Med. 35:1427–1434. 2015.PubMed/NCBI

16 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 25:402–408. 2001. View Article : Google Scholar

17 

Komori T and Kishimoto T: Cbfa1 in bone development. Curr Opin Genet Dev. 8:494–499. 1998. View Article : Google Scholar : PubMed/NCBI

18 

Komori T, Yagi H, Nomura S, Yamaguchi A, Sasaki K, Deguchi K, Shimizu Y, Bronson RT, Gao YH, Inada M, et al: Targeted disruption of Cbfa1 results in a complete lack of bone formation owing to maturational arrest of osteoblasts. Cell. 89:755–764. 1997. View Article : Google Scholar : PubMed/NCBI

19 

Nakashima K, Zhou X, Kunkel G, Zhang Z, Deng JM, Behringer RR and de Crombrugghe B: The novel zinc finger-containing transcription factor osterix is required for osteoblast differentiation and bone formation. Cell. 108:17–29. 2002. View Article : Google Scholar : PubMed/NCBI

20 

Fu H, Doll B, McNelis T and Hollinger JO: Osteoblast differentiation in vitro and in vivo promoted by Osterix. J Biomed Mater Res A. 83:770–778. 2007. View Article : Google Scholar : PubMed/NCBI

21 

Kim HK, Cho SG, Kim JH, Doan TK, Hu QS, Ulhaq R, Song EK and Yoon TR: Mevinolin enhances osteogenic genes (ALP, type I collagen and osteocalcin), CD44, CD47 and CD51 expression during osteogenic differentiation. Life Sci. 84:290–295. 2009. View Article : Google Scholar : PubMed/NCBI

22 

Pearson G, Robinson F, Beers Gibson T, Xu BE, Karandikar M, Berman K and Cobb MH: Mitogen-activated protein (MAP) kinase pathways: regulation and physiological functions. Endocr Rev. 22:153–183. 2001.PubMed/NCBI

23 

Kyriakis JM and Avruch J: Mammalian MAPK signal transduction pathways activated by stress and inflammation: a 10-year update. Physiol Rev. 92:689–737. 2012. View Article : Google Scholar : PubMed/NCBI

24 

Xia Z, Dickens M, Raingeaud J, Davis RJ and Greenberg ME: Opposing effects of ERK and JNK-p38 MAP kinases on apoptosis. Science. 270:1326–1331. 1995. View Article : Google Scholar : PubMed/NCBI

25 

Tang C, Liang J, Qian J, Jin L, Du M, Li M and Li D: Opposing role of JNK-p38 kinase and ERK1/2 in hydrogen peroxide-induced oxidative damage of human trophoblast-like JEG-3 cells. Int J Clin Exp Pathol. 7:959–968. 2014.PubMed/NCBI

26 

Fister S, Günthert AR, Aicher B, Paulini KW, Emons G and Gründker C: GnRH-II antagonists induce apoptosis in human endometrial, ovarian, and breast cancer cells via activation of stress-induced MAPKs p38 and JNK and proapoptotic protein Bax. Cancer Res. 69:6473–6481. 2009. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Guo C, Yang X, Wang F and Ma X: IL-1α induces apoptosis and inhibits the osteoblast differentiation of MC3T3-E1 cells through the JNK and p38 MAPK pathways. Int J Mol Med 38: 319-327, 2016.
APA
Guo, C., Yang, X., Wang, F., & Ma, X. (2016). IL-1α induces apoptosis and inhibits the osteoblast differentiation of MC3T3-E1 cells through the JNK and p38 MAPK pathways. International Journal of Molecular Medicine, 38, 319-327. https://doi.org/10.3892/ijmm.2016.2606
MLA
Guo, C., Yang, X., Wang, F., Ma, X."IL-1α induces apoptosis and inhibits the osteoblast differentiation of MC3T3-E1 cells through the JNK and p38 MAPK pathways". International Journal of Molecular Medicine 38.1 (2016): 319-327.
Chicago
Guo, C., Yang, X., Wang, F., Ma, X."IL-1α induces apoptosis and inhibits the osteoblast differentiation of MC3T3-E1 cells through the JNK and p38 MAPK pathways". International Journal of Molecular Medicine 38, no. 1 (2016): 319-327. https://doi.org/10.3892/ijmm.2016.2606
Copy and paste a formatted citation
x
Spandidos Publications style
Guo C, Yang X, Wang F and Ma X: IL-1α induces apoptosis and inhibits the osteoblast differentiation of MC3T3-E1 cells through the JNK and p38 MAPK pathways. Int J Mol Med 38: 319-327, 2016.
APA
Guo, C., Yang, X., Wang, F., & Ma, X. (2016). IL-1α induces apoptosis and inhibits the osteoblast differentiation of MC3T3-E1 cells through the JNK and p38 MAPK pathways. International Journal of Molecular Medicine, 38, 319-327. https://doi.org/10.3892/ijmm.2016.2606
MLA
Guo, C., Yang, X., Wang, F., Ma, X."IL-1α induces apoptosis and inhibits the osteoblast differentiation of MC3T3-E1 cells through the JNK and p38 MAPK pathways". International Journal of Molecular Medicine 38.1 (2016): 319-327.
Chicago
Guo, C., Yang, X., Wang, F., Ma, X."IL-1α induces apoptosis and inhibits the osteoblast differentiation of MC3T3-E1 cells through the JNK and p38 MAPK pathways". International Journal of Molecular Medicine 38, no. 1 (2016): 319-327. https://doi.org/10.3892/ijmm.2016.2606
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team