Identification of a long non-coding RNA gene, growth hormone secretagogue receptor opposite strand, which stimulates cell migration in non-small cell lung cancer cell lines

  • Authors:
    • Eliza J. Whiteside
    • Inge Seim
    • Jana P. Pauli
    • Angela J. O'Keeffe
    • Patrick B. Thomas
    • Shea L. Carter
    • Carina M. Walpole
    • Jenny N.T. Fung
    • Peter Josh
    • Adrian C. Herington
    • Lisa K. Chopin
  • Corresponding author:
  • View Affiliations

  • Published online on: Thursday, May 30, 2013
  • Pages: 566-574
  • DOI: 10.3892/ijo.2013.1969

Abstract

The molecular mechanisms involved in non‑small cell lung cancer tumourigenesis are largely unknown; however, recent studies have suggested that long non-coding RNAs (lncRNAs) are likely to play a role. In this study, we used public databases to identify an mRNA-like, candidate long non-coding RNA, GHSROS (GHSR opposite strand), transcribed from the antisense strand of the ghrelin receptor gene, growth hormone secretagogue receptor (GHSR). Quantitative real-time RT-PCR revealed higher expression of GHSROS in lung cancer tissue compared to adjacent, non-tumour lung tissue. In common with many long non-coding RNAs, GHSROS is 5' capped and 3' polyadenylated (mRNA-like), lacks an extensive open reading frame and harbours a transposable element. Engineered overexpression of GHSROS stimulated cell migration in the A549 and NCI-H1299 non-small cell lung cancer cell lines, but suppressed cell migration in the Beas-2B normal lung-derived bronchoepithelial cell line. This suggests that GHSROS function may be dependent on the oncogenic context. The identification of GHSROS, which is expressed in lung cancer and stimulates cell migration in lung cancer cell lines, contributes to the growing number of non-coding RNAs that play a role in the regulation of tumourigenesis and metastatic cancer progression.

Introduction

Lung cancer is the leading cause of cancer deaths world-wide (1) and the majority of cases (70–85%) are non-small cell lung cancers (NSCLC) (2). Most patients with NSCLC are diagnosed after their cancer has metastasised and this is associated with a poor prognosis (3,4). As metastatic disease is currently incurable, new therapeutic approaches to lung cancer are urgently required (4). The molecular mechanisms involved in NSCLC tumourigenesis and metastatic progression are largely unknown, however, recent studies have demonstrated that non-coding RNAs are key regulators of these processes (59). Less than 2% of the human genome is transcribed into protein-coding mRNAs, while approximately 90% is transcribed into non-protein coding RNAs (ncRNAs) and many are of unknown function (9,10). Non-coding RNAs, therefore, provide promising targets for the development of novel therapeutics for cancer (11).

Here, we report the identification, genomic organisation and initial characterisation of the candidate antisense long ncRNA gene, GHSROS, which is located on the opposite strand of the gene for the ghrelin receptor, the growth hormone secretagogue receptor (GHSR) gene. We demonstrate that GHSROS is expressed at a higher level in human lung tumours compared to other tissue types and, when over-expressed in lung cancer cell lines, promotes cell migration. The ability of cancer cells to migrate and ultimately to metastasise to distant sites in the body is a key hallmark of cancer (12,13). We hypothesise that, like other recently described lncRNAs, GHSROS contributes to lung cancer progression by stimulating cancer cell migration.

Materials and methods

Sequence analysis and database searches

Multiple sequence alignments were generated using the Evolutionary Conserved Regions (ECR) Browser (14) and Clustal W2.0 (15). To examine putative coding sequences we used the ExPASy Translate Tool (http://www.expasy.ch/tools/dna.html) and the Coding Potential Calculator (16). The presence of transposable elements was examined using CENSOR v4.2.8 (17).

Human tissues and RNA

Normal lung and lung tumour specimens were obtained from the Ontario Tumour Bank (Toronto, Canada; Table I). Commercial total RNA was obtained from human stomach, ovary (FirstChoice, Invitrogen, Carlsbad, CA), cerebellum, thymus, whole brain, lung, testis, foetal brain, lung adenocarcinoma and pancreas (Clontech, Mountain View, CA).

Table I.

Specimen characteristics of a range of paired normal and non-small cell lung carcinoma tumour biopsies from patients diagnosed with NSCLC.

Table I.

Specimen characteristics of a range of paired normal and non-small cell lung carcinoma tumour biopsies from patients diagnosed with NSCLC.

Sample IDAge/genderSource of specimenHistological tumour typeTumour size (cm) Grade/differentiationTumourNodeMetastasis
N177/MAdjacent normal tissueN/AN/AN/AN/AN/AN/A
T177/MPrimary tumourSquamous carcinoma4.5IIT2N0MX
N273/MAdjacent normal tissueN/AN/AN/AN/AN/AN/A
T273/MPrimary tumourAdenocarcinoma2.5IIT2N0MX
N373/MAdjacent normal tissueN/AN/AN/AN/AN/AN/A
T373/MPrimary tumourSquamous carcinoma3IIIT2N0M0
N470/MAdjacent normal tissueN/AN/AN/AN/AN/AN/A
T470/MPrimary tumourSquamous carcinoma11IIT2N0M0
N552/FAdjacent normal tissueN/AN/AN/AN/AN/AN/A
T552/FPrimary tumourAdenocarcinoma4IIIT2N0MX
N6N/AAdjacent normal tissueN/AN/AN/AN/AN/AN/A
T6N/AN/AAdenocarcinomaN/AN/AN/AN/AN/A
N7N/AAdjacent normal tissueN/AN/AN/AN/AN/AN/A
T884/MPrimary tumourAdenocarcinoma6IIIT2N0M0

[i] Sample N/A, not applicable/not determined; N0, no cancer found in the lymph nodes; MX, cancer spread (metastasis) can not be assessed; M0, cancer has not spread (metastasised). Samples were obtained from the Ontario Tumour Bank, with the exception of samples N6, T6 and N7 which were purchased from Clontech.

Cell lines

The A549 cell line (American Type Culture Collection, ATCC 10801, Rockville, MD) was cultured in DMEM/F12 (Invitrogen), while the NCI-H1299 (ATCC CRL-5803) and Beas-2B (ATCC CRL-9609) cell lines were cultured in RPMI-1640 medium (Invitrogen). The complete medium contained 10% cosmic calf serum (HyClone, ThermoFisher Scientific, Waltham, MA), 50 U/ml penicillin and 50 μg/ml streptomycin (Invitrogen). Cells were incubated at 37°C in air and 5% CO2 and free of Mycoplasma contamination.

RNA extraction

Total RNA was harvested from tissues and cultured cells using an RNeasy Plus mini kit (QIAGEN, Germantown, MD) according to the manufacturer’s instructions.

Quantitative real-time RT-PCR

cDNA was synthesised using a GHSROS strand-specific primer (GHSROS-RT), and quantitative RT-PCR of GHSR antisense mRNA was performed as previously described (18,19) using the Prism 7000 Sequence Detection System (Applied Biosystems, Foster City, CA). Data were analysed using the comparative 2−ΔΔCt method with normalisation to the 18S housekeeping gene (20). The primers used are listed in Table II. All RT-PCR products were purified using PureLink (Invitrogen) or MinElute (QIAGEN) PCR Purification Kits, cloned into pCR-XL-TOPO (Invitrogen), or pGEM-T Easy (Promega, Fitchburg, WI), transformed into One Shot MAX Efficiency DH5α-T1R chemically competent cells (Invitrogen) and sequenced at the Australian Genome Research Facility (AGRF, Brisbane, Australia) using BigDye III (Applied Biosystems).

Table II.

Designations and sequences of oligonucleotides.

Table II.

Designations and sequences of oligonucleotides.

NameSequence (5′-3′)TaPCR cycles
GHSROS-RT CGACTGGAGCACGAGGACACTGACAACAGAATTCACTACTTCCCCAAA
GHSROS-F ACATTCAGCAAATCCAGTTATGACA6040
LK CGACTGGAGCACGAGGACACTGA
18S-F TTCGGAACTGAGGCCATGAT6040
18S-R CGAACCTCCGACTTTCGTTCT
5′-RACE-adapter GCUGAUGGCGAUGAAUGAACACUGCGUUUGCUGGCUUUGAUGAAA
5′-RACEout-F ATGGCGATGAATGAACACTG5835
5′-RACEout-R GGGATCACTAAAGTGTTACAACGAC
5′-RACE-in-F AATGAACACTGCGTTTGCTG5735
5′-RACE-in-R ATTTTTCCCTGATTTCTGAATTT
3′-RACE-adapter GCGAGCACAGAATTAATACGACTCACTATAGGTTTTTTTTTTTTVN
3′-RACE-F GTTTCCACAAAGTCTCCTTTCC5935
3′-RACE-R GCACAGAATTAATACGACTCAC
3′-RACE-in-F ACTTCACTGATTTGTCACTG5835
Northern-F CGTTGTAACACTTTAGTGATCCC5835
Northern-T7-RCTAATACGACTCACTATAGGGAGATTTACAGTTCCTGGATCCTC
GHSROS-pTargeT-F CAGAGGATTGAATATACAGTTAGG5835
GHSROS-pTargeT-R ATAATTGCATCAATTCTGTTTACC

[i] Linker sequence (LK) in the primer GHSROS-RT is shown in bold. In primer 3′-RACE-adapter V denotes an A/G/C residue and N denotes A/G/C. T7 promoter sequence in primer, Northern-T7-R, is underlined. Annealing temperatures (Ta) of oligonucleotides employed in PCRs are shown.

GHSR antisense transcript mapping

5′-RLM-RACE was performed using the FirstChoice RLM-RACE kit (Invitrogen) according to the manufacturer’s instructions, except that heat-labile shrimp alkaline phosphatase (SAP; Fermentas, Burlington, ON, Canada) was used to dephosphorylate degraded RNA. For 3′-RACE, 2 μg total RNA was reverse transcribed using Transcriptor reverse transcriptase (Roche, Penzberg, Germany) and a 3′-RACE adapter primer (Table II).

Northern blot analysis

Northern blot analysis was carried out on mRNA purified from A549 cells, using the Oligotex mRNA mini-kit (QIAGEN) and the NorthernMax-Gly kit (Invitrogen) according to the manufacturer’s instructions. Briefly, 250 ng mRNA and 50 ng RNA Molecular Weight Marker II (Roche) were electrophoresed through a 1% glyoxal agarose gel, transferred onto a positively charged nylon membrane (Roche) and probed with 10 ng/ml 331 nt GHSROS-specific riboprobe. The riboprobe was generated from A549 genomic DNA using PCR (primers Northern-F and Northern-T7-R, Table II). The PCR product was purified using a MinElute PCR Purification kit (QIAGEN), and the cRNA probe was synthesised using a digoxigenin RNA labelling kit (Roche). The membrane was hybridised overnight at 70°C with the riboprobe using ULTRAhyb buffer (Invitrogen), followed by high stringency washing conditions (70°C).

Stable transfection of GHSROS cDNA in cell lines

Full-length GHSROS was generated by RT-PCR from A549 cell line mRNA (using primers GHSROS-pTargeT-F and GHSROS-pTargeT-R; Table II), and cloned into the pTargeT mammalian expression vector (Promega). Cells were transfected with DNA (linearised GHSROS-pTargeT, or vector alone/mock) using Lipofectamine LTX reagent (Invitrogen). After 48 h, stable polyclonal cell populations were generated by culturing in complete medium containing G418 (Invitrogen), at 1,000 μg/ml for the A549 and the Beas-2B cell lines and 600 μg/ml for the NIH-H1299 cell line. Cells were grown in the presence of G418 for at least two weeks before functional analyses were performed. GHSROS expression was verified twice weekly using quantitative real-time RT-PCR, as described above.

Cell migration assays

Migration assays were performed using Transwell inserts with polycarbonate membranes (8 μm pore size; BD Biosciences, Franklin Lakes, NJ) in 12-well plates. Cells were added to the upper chamber of the Transwell inserts in serum-free medium and medium with 10% cosmic calf serum was used as a chemo-attractant in the lower chamber. Control inserts containing medium only were used to determine background staining. Cells were cultured for 6–24 h and cells remaining on the upper surface of the inserts were removed. The number of cells that migrated to the underside of the inserts was quantified by fixing the cells (100% methanol) and staining with 1% crystal violet. The stain was extracted using 10% (v/v) acetic acid and absorbance measured at 595 nm. Cell migration in GHSROS overexpressing cells was compared to cells expressing the vector alone. Each experiment consisted of three replicates and was repeated independently at least three times.

Cell proliferation assays

Cell proliferation was assessed by quantifying both metabolic activity (WST-1 assay, Roche) and DNA synthesis (CyQUANT NF Cell Proliferation Assay Kit; Invitrogen). Cells were cultured in replicate 96-well plates (BD Biosciences) for 4, 24 and 48 h. Absorbance was measured at 440 nm with a reference wavelength of 600 nm for the WST-1 assay and with excitation at 485 nm and emission at 530 nm for the CyQUANT assay. All proliferation experiments were performed independently at least three times, with 10 replicates each.

Statistical analyses

Statistical significance was determined using Student’s t-test, with a p-value <0.05 considered to be statistically significant.

Results

Identification of a GHSR antisense transcript

Inspection of the UCSC Genome Browser for Functional RNA (21) revealed two overlapping expressed sequence tags (ESTs) (GenBank entries AW451317 and AI681234) which were antisense to the growth hormone secretagogue receptor gene (GHSR) (Fig. 1). We named the putative antisense transcript growth hormone secretagogue receptor opposite strand (GHSROS). These ESTs were sequenced as a part of the Cancer Genome Anatomy Project (http://cgap.nci.nih.gov) and were derived from lung carcinoid tumour tissue, which is a rare, neuroendocrine lung tumour type (22). The two overlapping EST entries together span approximately 900 bp within the 2.1 kb intron 1 of GHSR. Moreover, a 904 nucleotide transcript (TIN_36629), derived from oligoarray analysis for intronic non-coding RNAs of the liver, kidney and prostate (23), also maps to the region covered by the two ESTs (Fig. 1). This 904 nucleotide GHSROS transcript was one of 55,000 transcripts denoted intronic non-coding RNA in a large-scale study by Nakaya et al (23).

Structure of GHSROS

To map the full-length GHSROS transcript, a multi-pronged approach was employed. As noted, the public domain oligoarray-deduced sequence (TIN_36629, Fig. 1) spans 904 bp of genomic DNA. A sequence conforming to the consensus TATA box motif (TATAAA) (24) is present just upstream of this sequence (Fig. 2A), suggesting that an antisense promoter is present in the intron of GHSR. To confirm the oligoarray data, 5′- and 3′-RACE PCR products and a full-length cDNA clone from a lung carcinoid tumour (Image cDNA clone 2272492) were sequenced. The sequenced full-length transcript is 1078 nucleotides in size, consists of a single exon and maps within the GHSR intron (Fig. 2A) (GenBank entries FJ355932, FJ355933 and GU289929). Northern blot analysis of mRNA from the A549 NSCLC cell line showed that the polyadenylated, full-length GHSROS is approximately 1,500 bp in size (Fig. 2B), and this corresponds closely to the predicted size of GHSROS mRNA. As shown in Fig. 2A, GHSROS has three transcription start sites: one just downstream of the consensus TATA-box and two immediately upstream of a poly-T-repeat within an ancient MER5B (medium reiteration frequency 5B) DNA transposable element (25). This thymidine-rich repeat is absent in non-primates (data not shown), suggesting that a primate-specific antisense promoter in the GHSR intron may have emerged through accumulated mutations (ab initio generation) (26). Interestingly, it is well known that poly-T-repeats in promoters can result in highly efficient transcription by depleting repressive nucleosomes from promoters (27). Together, these observations suggest that an antisense promoter in the GHSR intron gives rise to single-exon GHSROS transcripts that are processed into mRNA (5′ capped and 3′ polyadenylated).

GHSROS is a candidate long non-coding RNA

While it is difficult to predict and experimentally prove that a transcript either codes for very small peptides or is a non-coding RNA, a number of parameters can be assessed (28). Analysis using the coding potential calculator (CPC) tool predicted that GHSROS is a non-coding transcript. The CPC tool is a highly accurate algorithm that takes into account multiple features, including putative peptide length, amino acid composition, secondary structure, the conservation of protein homologues and alignment information (28). GHSROS demonstrates a number of features typical of a non-coding RNA. As the open reading frames are very short, GHSROS would encode very small peptides (with 13 open reading frames which are 6–46 amino acids in size). GHSROS also has a high frequency of stop codons throughout the 1.1 kb GHSROS sequence in all three reading frames (Table III). Moreover, GHSROS open reading frames have poor consensus to the translation initiation sequence proposed by Kozak (29) (Table III). Multiple sequence alignments show that the GHSROS nucleotide sequence is highly conserved in the chimpanzee, while there is low nucleotide and open reading frame conservation compared to the mouse (data not shown). The current data, therefore, suggests that GHSROS is a non-protein-coding RNA gene.

Table III.

Open reading frames (ORFs) in the GHSROS transcript determined using the ExPASy translate tool (http://www.expasy.ch/tools/dna.html).

Table III.

Open reading frames (ORFs) in the GHSROS transcript determined using the ExPASy translate tool (http://www.expasy.ch/tools/dna.html).

ORF no.aFrameStartStopLength (bp)Length (AA)Initiator sequenceb
115385673611 TttAatATGG
21586606216 CCtGgaATGG
31610633247 TAaAatATGc
424715912340 ACtGagATGa
52302322216 ACacCaATGa
624615175718 taacCtATGa
7279793714146 CCaGttATGa
835174247 AgatgaATGa
931592458728 tttttaATGa
103570596278 GgaAatATGa
1136787557825 TtgAaaATGc
123813842309 GCCcagATGt
133100510464213 AgCtgtATGa
A
Consensus Kozak’s rule:GCC CCATGG
G

a The assigned numbers for ORFs ordered by the start position from the 5′ end.

b The −6 to +4 sequence of the putative initiator site. The start codon (ATG) is shown in bold. The nucleotides that match with the Kozak’s consensus are capitalised.

GHSROS is overexpressed in lung cancer

To examine the expression of GHSROS, quantitative real-time RT-PCR was performed using commercially available RNA from a range of normal human tissues. Stomach, cerebellum, ovary, thymus, whole brain, lung, pancreas and foetal brain displayed relatively low levels of GHSROS expression with relatively moderate expression in the testis (Fig. 3A). In contrast, GHSROS was highly expressed in a lung tumour sample (Fig. 3A). In the lung-derived cell lines examined, the lowest level of GHSROS expression was seen in the normal tissue-derived, Beas-2B bronchoepithelial cell line, while higher expression levels were seen in the NCI-H1299 and A549 NSCLC cell lines (Fig. 3B). Finally, quantitative real-time RT-PCR was performed using tumour and matched adjacent normal tissue from six patients with NSCLC lung cancer, as well as two non-matched samples (for clinical details, see Table I). A higher level of GHSROS expression was observed in each of the tumour samples compared to their matched adjacent normal tissue with samples 1, 2 and 3 being statistically significant (Fig. 4).

GHSROS overexpression increases the migration of A549 and NCI-H1299 NSCLC cell lines, but reduces migration in the Beas-2B cell line

The functional significance of GHSROS in the lung was studied by creating stable transfectants in the A549, NCI-H1299 and Beas-2B cell lines. Migration was significantly decreased in GHSROS overexpressing Beas-2B cells over 24 h (49% below vector-only control, P<0.05) (Fig. 5, lanes 1 and 2). In contrast, migration was significantly increased in the GHSROS overexpressing NSCLC cell lines examined, with an increase of 67% above control (p<0.05) in A549 cells (Fig. 5, lanes 3 and 4) and 129% above control (p<0.05) in NCI-H1299 cells after 6 h (Fig. 5, lanes 5 and 6). The observed differences in cell migration were not due to changes in cell number, as overexpression of GHSROS did not significantly alter cell proliferation in the A549, NCI-N1299, or Beas-2B cell lines at these time points compared to cells expressing the vector alone (data not shown).

Discussion

We demonstrate that the intronic region of the ghrelin receptor gene, GHSR, encodes a long non-coding RNA, termed GHSROS, which is expressed in lung cancer and promotes cell migration in lung cancer cell lines. Research into the role of ncRNAs in normal development and disease processes has predominantly focused on microRNAs (miRNAs), however, a number of long ncRNAs (lncRNAs), including MALAT-1, H19, B2 and lincRNA-p21 are known to play a role in lung cancer progression (11). Long ncRNAs are greater than 200 nucleotides in length, lack significant open reading frames and often harbour protein-coding mRNA-like features such as transcription by RNA polymerase II, polyadenylation and alternative splice variants. They control gene expression via the regulation of a broad range of processes including gene expression at the transcriptional and post-transcriptional levels (splicing, transcript degradation, epigenetic modification, chromatin remodelling, and sub-cellular transport) and some are precursors for small RNAs (11,30).

The GHSROS gene encodes a transcript ∼1.1 kb in size and is a putative mRNA-like non-coding RNA, as it is likely to be derived from a classical TATA-box promoter and is 5′ capped and 3′ polyadenylated. Although we predict that GHSROS is a non-coding gene, we cannot currently dismiss the possibility that GHSROS encodes short, bioactive peptides. For example, the assumed ncRNA gene pri in Drosophila has been shown to encode functional peptides of 11 and 32 amino acids (31,32). It has recently been recognised that short open reading frame-encoded polypeptides (SEPs) may be very abundant in the proteome and are also derived from ncRNAs (33). Proteomics studies, for example using assays such as multiple reaction monitoring mass spectrometry (34), would be most useful in assessing whether any of the 13 short open reading frames of GHSROS are indeed translated and have independent functions.

GHSROS overlaps a MER5B DNA transposable element. Repeat elements in non-coding RNAs have been reported by a number of investigators (3540). Accumulating evidence suggests that transposable elements often harbour promoters for natural antisense transcripts (41) and these elements lead to the transcription of novel, species-specific, non-coding RNA transcripts involved in gene regulation (42). It has been hypothesised that non-coding RNAs in introns may regulate the abundance, or splicing of their overlapping protein-coding transcripts (22,23,4346). It is equally likely, however, that many intronic RNAs regulate a large number of genes in trans, at sites that are distant to their host loci (44,47).

We report that GHSROS is expressed in clinical samples from lung tissues and lung cell lines, with a similar, but not statistically significant, trend towards higher GHSROS expression in lung tumours. We hypothesise that this observation could be due to adjacent normal tissue samples with elevated GHSROS levels exhibiting pre-neoplastic alterations in gene expression, as described in other studies (48,49), or that tumour cells have spread into the normal tissue. Moreover, lung tissue is highly heterogeneous, consisting of a range of cell types, including cartilage, smooth muscle, epithelial and endothelial cells (50). Laser capture microdissection would be useful to isolate specific cell types for future experiments (50,51). As was the case for the lncRNA, HOTAIR, that is overexpressed in metastatic breast tumours (52), it is also feasible that the heterogeneous GHSROS expression pattern observed in our limited panel of primary tumours can be resolved by measuring the levels of the transcript in a larger and more diverse patient tissue panel. This will determine whether GHSROS could be a useful biomarker for predicting metastatic progression and patient survival.

The most well-studied long non-coding RNA in lung cancer, MALAT-1 (Metastasis Associated in Lung Adeno-carcinoma Transcript-1), plays a role in cancer progression through a number of mechanisms including the regulation of gene transcription (53). MALAT-1 is overexpressed in NSCLC, in NSCLC cell lines and in a number of other tumour types (5,5456). It has an important role in cancer cell motility and migration, and regulating genes related to these processes, and may be involved in other cancer related processes (11,55). Furthermore, knockdown of MALAT-1 expression in NSCLC xenograft mouse models reduces tumour growth and prevents lung cancer cell metastasis (6,53). MALAT-1 is, therefore, a potential therapeutic target for lung cancer (53) and also has potential as a prognostic biomarker for NSCLC, breast, prostate, pancreatic, colon, liver and endometrial cancers (6,5760).

H19 is an imprinted lncRNA which is highly expressed in the embryo and is oncogenic in some cell types including lung cancer cell lines, while it has tumour-suppressing activity in other cell types (6165). It is upregulated by a number of carcinogens, and expression is greatly increased in the airway epithelium of smokers (66). Long non-coding RNAs work through a number of different mechanisms and H19 is a precursor for at least one miRNA (67,68). This may allow it to play contrasting roles in different tissues and at different stages of development. The lncRNA lincRNA-p21 is a global repressor of the p53 tumor suppressor pathway (69) and acts a post-transcriptional inhibitor of the translation of target genes through an interaction with the RNA binding protein HuR (70).

A hallmark of tumour cell behaviour is the ability to migrate and ultimately to metastasise to secondary sites in the body (12,13). Engineered GHSROS overexpression resulted in a decreased rate of migration in the normal lung-derived Beas-2B cell line, while it stimulated cell migration in the two NSCLC cell lines. Such cell-type and context-specific effects are also observed for miRNAs, which can regulate a large number of genes and function as either oncogenes or tumour suppressors (71,72). Indeed, evidence is emerging that many short and long RNA transcripts may have dual functions, and their ultimate biological effects may be dependent on complex ncRNA-DNA-protein interactions (73,74). Interestingly, it has recently been reported that lncRNAs are able to deplete miRNA, acting as miRNA sponges (7577). This could explain the global changes in gene expression observed with lncRNA overexpression and/or knockdown. Conversely, lncRNAs may also exert global effects as precursors for miRNAs, as observed for H19 (67). Further studies are underway in our laboratory to explore the mechanisms by which GHSROS promotes migration in lung cancer cells.

In conclusion, we have identified a novel, long non-coding RNA gene in the intron of the ghrelin receptor gene, GHSR, that exhibits high levels of expression in lung tumour tissue and regulates cell migration in cultured cells of lung origin. These observations suggest that GHSROS may be significant in cancer progression and could be a useful therapeutic target for inhibiting tumour migration. Further studies on the role of GHSROS in normal physiology and cancer progression are required to dissect the function and mechanism of action of this long non-coding RNA gene. The identification of novel stimulators of NSCLC progression such as GHSROS will lead to earlier detection, better prognostic biomarkers and therapeutic approaches for patients diagnosed with NSCLC in the future.

Acknowledgements

This study was supported by grants from the National Health and Medical Research Council (NHMRC), the National Breast Cancer Foundation, The Cancer Council Queensland (to L.K.C. and A.C.H.), the Queensland University of Technology (QUT) Early Career Researcher grants (to I.S. and E.J.W.). We thank Professor Kwun Fong, Professor Ian Yang and Professor Rayleen Bowman, and Santiyagu Mary Savarimuthu Francis (Department of Thoracic Medicine, the Prince Charles Hospital, Brisbane, Australia) for the Beas-2B normal bronchoepithelial lung cell line. We also thank the staff at the Ontario Tumour Bank (OTC), Canada, for the recruitment, retention and dispersion of the lung-derived tissue samples.

References

1. 

Jemal A, Siegel R, Xu J and Ward E: Cancer statistics, 2010. CA Cancer J Clin. 60:277–300. 2010.

2. 

Molina JR, Yang P, Cassivi SD, Schild SE and Adjei AA: Non-small cell lung cancer: epidemiology, risk factors, treatment, and survivorship. Mayo Clin Proc. 83:584–594. 2008.

3. 

Nagamachi Y, Tani M, Shimizu K, Tsuda H, Niitsu Y and Yokota J: Orthotopic growth and metastasis of human non-small cell lung carcinoma cell injected into the pleural cavity of nude mice. Cancer Lett. 127:203–209. 1998.

4. 

Wang Y, Yang H, Liu H, Huang J and Song X: Effect of staurosporine on the mobility and invasiveness of lung adenocarcinoma A549 cells: an in vitro study. BMC Cancer. 9:1742009.

5. 

Ji P, Diederichs S, Wang W, et al: MALAT-1, a novel noncoding RNA, and thymosin beta4 predict metastasis and survival in early-stage non-small cell lung cancer. Oncogene. 22:8031–8041. 2003.

6. 

Schmidt LH, Spieker T, Koschmieder S, et al: The long noncoding MALAT-1 RNA indicates a poor prognosis in non-small cell lung cancer and induces migration and tumor growth. J Thorac Oncol. 6:1984–1992. 2011.

7. 

Lee J, Yoo J, Yoo H, et al: The novel miRNA hc-smR-S2-5 decrease the proliferation and migration of human lung cancer cells by targeting c-Met. Mol Cancer Res. 11:43–53. 2013.

8. 

Liu J, Lu KH, Liu ZL, Sun M, De W and Wang ZX: MicroRNA-100 is a potential molecular marker of non-small cell lung cancer and functions as a tumor suppressor by targeting polo-like kinase 1. BMC Cancer. 12:5192012.

9. 

Enfield KS, Pikor LA, Martinez VD and Lam WL: Mechanistic roles of noncoding RNAs in lung cancer biology and their clinical implications. Genet Res Int. 2012:7374162012.

10. 

Prasanth KV and Spector DL: Eukaryotic regulatory RNAs: an answer to the ‘genome complexity’ conundrum. Genes Dev. 21:11–42. 2007.

11. 

Gutschner T and Diederichs S: The hallmarks of cancer: a long non-coding RNA point of view. RNA Biol. 9:703–719. 2012.

12. 

Chiang AC and Massague J: Molecular basis of metastasis. N Engl J Med. 359:2814–2823. 2008.

13. 

Hanahan D and Weinberg RA: Hallmarks of cancer: the next generation. Cell. 144:646–674. 2011.

14. 

Ovcharenko I, Nobrega MA, Loots GG and Stubbs L: ECR Browser: a tool for visualizing and accessing data from comparisons of multiple vertebrate genomes. Nucleic Acids Res. 32:W280–W286. 2004.

15. 

Larkin MA, Blackshields G, Brown NP, et al: Clustal W and Clustal X version 2.0. Bioinformatics. 23:2947–2948. 2007.

16. 

Kong L, Zhang Y, Ye ZQ, et al: CPC: assess the protein-coding potential of transcripts using sequence features and support vector machine. Nucleic Acids Res. 35:W345–W349. 2007.

17. 

Kohany O, Gentles AJ, Hankus L and Jurka J: Annotation, submission and screening of repetitive elements in Repbase: RepbaseSubmitter and Censor. BMC Bioinformatics. 7:4742006.

18. 

Lai J, Lehman ML, Dinger ME, et al: A variant of the KLK4 gene is expressed as a cis sense-antisense chimeric transcript in prostate cancer cells. RNA. 16:1156–1166. 2010.

19. 

Fung JN, Seim I, Wang D, Obermair A, Chopin LK and Chen C: Expression and in vitro functions of the ghrelin axis in endometrial cancer. Horm Cancer. 1:245–255. 2010.

20. 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) method. Methods. 25:402–408. 2001.

21. 

Mituyama T, Yamada K, Hattori E, et al: The functional RNA database 3.0: databases to support mining and annotation of functional RNAs. Nucleic Acids Res. 37:D89–D92. 2009.

22. 

Bertino EM, Confer PD, Colonna JE, Ross P and Otterson GA: Pulmonary neuroendocrine/carcinoid tumors: a review article. Cancer. 115:4434–4441. 2009.

23. 

Nakaya HI, Amaral PP, Louro R, et al: Genome mapping and expression analyses of human intronic noncoding RNAs reveal tissue-specific patterns and enrichment in genes related to regulation of transcription. Genome Biol. 8:R432007.

24. 

Wobbe CR and Struhl K: Yeast and human TATA-binding proteins have nearly identical DNA sequence requirements for transcription in vitro. Mol Cell Biol. 10:3859–3867. 1990.

25. 

Jurka J: Novel families of interspersed repetitive elements from the human genome. Nucleic Acids Res. 18:137–141. 1990.

26. 

Tsuritani K, Irie T, Yamashita R, et al: Distinct class of putative ‘non-conserved’ promoters in humans: comparative studies of alternative promoters of human and mouse genes. Genome Res. 17:1005–1014. 2007.

27. 

Segal E and Widom J: Poly(dA:dT) tracts: major determinants of nucleosome organization. Curr Opin Struct Biol. 19:65–71. 2009.

28. 

Dinger ME, Pang KC, Mercer TR and Mattick JS: Differentiating protein-coding and noncoding RNA: challenges and ambiguities. PLoS Comput Biol. 4:e10001762008.

29. 

Kozak M: An analysis of 5′-noncoding sequences from 699 vertebrate messenger RNAs. Nucleic Acids Res. 15:8125–8148. 1987.

30. 

Taft R, Pang K, Mercer T, Dinger M and Mattick J: Non-coding RNAs: regulators of disease. J Pathol. 220:126–139. 2010.

31. 

Kondo T, Hashimoto Y, Kato K, Inagaki S, Hayashi S and Kageyama Y: Small peptide regulators of actin-based cell morphogenesis encoded by a polycistronic mRNA. Nat Cell Biol. 9:660–665. 2007.

32. 

Kondo T, Plaza S, Zanet J, et al: Small peptides switch the transcriptional activity of Shavenbaby during Drosophila embryogenesis. Science. 329:336–339. 2010.

33. 

Slavoff SA, Mitchell AJ, Schwaid AG, et al: Peptidomic discovery of short open reading frame-encoded peptides in human cells. Nat Chem Biol. 9:59–64. 2013.

34. 

Makawita S and Diamandis EP: The bottleneck in the cancer biomarker pipeline and protein quantification through mass spectrometry-based approaches: current strategies for candidate verification. Clin Chem. 56:212–222. 2010.

35. 

Jacquot C, Carbonnelle D, Tomasoni C, Papaconstadinou A, Roussis V and Roussakis C: Identification of a novel putative non-coding RNA involved in proliferation arrest of a non-small cell lung carcinoma cell line treated with an original chemical substance, methyl-4-methoxy-3-(3-methyl-2-butanoyl) benzoate. Int J Oncol. 25:519–527. 2004.

36. 

Chen LL and Carmichael GG: Long noncoding RNAs in mammalian cells: what, where, and why? Wiley Interdiscip Rev RNA. 1:2–21. 2010.

37. 

Moh MC, Lee LH, Yang X and Shen S: Identification of a novel gene HEPT3 that is overexpressed in human hepatocellular carcinoma and may function through its noncoding RNA. Int J Oncol. 31:293–301. 2007.

38. 

Panzitt K, Tschernatsch MM, Guelly C, et al: Characterization of HULC, a novel gene with striking up-regulation in hepatocellular carcinoma, as noncoding RNA. Gastroenterology. 132:330–342. 2007.

39. 

Sonkoly E, Bata-Csorgo Z, Pivarcsi A, et al: Identification and characterization of a novel, psoriasis susceptibility-related noncoding RNA gene, PRINS. J Biol Chem. 280:24159–24167. 2005.

40. 

Amaral PP, Neyt C, Wilkins SJ, et al: Complex architecture and regulated expression of the Sox2ot locus during vertebrate development. RNA. 15:2013–2027. 2009.

41. 

Conley AB, Miller WJ and Jordan IK: Human cis natural antisense transcripts initiated by transposable elements. Trends Genet. 24:53–56. 2008.

42. 

Pheasant M and Mattick JS: Raising the estimate of functional human sequences. Genome Res. 17:1245–1253. 2007.

43. 

Reis EM, Louro R, Nakaya HI and Verjovski-Almeida S: As antisense RNA gets intronic. Omics. 9:2–12. 2005.

44. 

Louro R, Smirnova AS and Verjovski-Almeida S: Long intronic noncoding RNA transcription: expression noise or expression choice? Genomics. 93:291–298. 2009.

45. 

Louro R, Nakaya HI, Amaral PP, et al: Androgen responsive intronic non-coding RNAs. BMC Biol. 5:42007.

46. 

Michael DR, Phillips AO, Krupa A, et al: The human hyaluronan synthase 2 (HAS2) gene and its natural antisense RNA exhibit coordinated expression in the renal proximal tubular epithelial cell. J Biol Chem. 286:19523–19532. 2011.

47. 

Khaitan D, Dinger ME, Mazar J, et al: The melanoma-upregulated long noncoding RNA SPRY4-IT1 modulates apoptosis and invasion. Cancer Res. 71:3852–3862. 2011.

48. 

Lonergan KM, Chari R, Coe BP, et al: Transcriptome profiles of carcinoma-in-situ and invasive non-small cell lung cancer as revealed by SAGE. PLoS One. 5:e91622010.

49. 

Dempsey EC, Cool CD and Littler CM: Lung disease and PKCs. Pharmacol Res. 55:545–559. 2007.

50. 

Espina V, Wulfkuhle JD, Calvert VS, et al: Laser-capture microdissection. Nat Protoc. 1:586–603. 2006.

51. 

Edwards RA: Laser capture microdissection of mammalian tissue. J Vis Exp. 2007:3092007.

52. 

Gupta RA, Shah N, Wang KC, et al: Long non-coding RNA HOTAIR reprograms chromatin state to promote cancer metastasis. Nature. 464:1071–1076. 2010.

53. 

Gutschner T, Hammerle M, Eissmann M, et al: The non-coding RNA MALAT1 is a critical regulator of the metastasis phenotype of lung cancer cells. Cancer Res. 73:1180–1189. 2013.

54. 

Xu C, Yang M, Tian J, Wang X and Li Z: MALAT-1: a long non-coding RNA and its important 3′ end functional motif in colorectal cancer metastasis. Int J Oncol. 39:169–175. 2011.

55. 

Ying L, Chen Q, Wang Y, Zhou Z, Huang Y and Qiu F: Upregulated MALAT-1 contributes to bladder cancer cell migration by inducing epithelial-to-mesenchymal transition. Mol Biosyst. 8:2289–2294. 2012.

56. 

Tano K, Mizuno R, Okada T, et al: MALAT-1 enhances cell motility of lung adenocarcinoma cells by influencing the expression of motility-related genes. FEBS Lett. 584:4575–4580. 2010.

57. 

Guffanti A, Iacono M, Pelucchi P, et al: A transcriptional sketch of a primary human breast cancer by 454 deep sequencing. BMC Genomics. 10:1632009.

58. 

Lai MC, Yang Z, Zhou L, et al: Long non-coding RNA MALAT-1 overexpression predicts tumor recurrence of hepatocellular carcinoma after liver transplantation. Med Oncol. 29:1810–1816. 2012.

59. 

Yamada K, Kano J, Tsunoda H, et al: Phenotypic characterization of endometrial stromal sarcoma of the uterus. Cancer Sci. 97:106–112. 2006.

60. 

Lin R, Maeda S, Liu C, Karin M and Edgington T: A large noncoding RNA is a marker for murine hepatocellular carcinomas and a spectrum of human carcinomas. Oncogene. 26:851–858. 2007.

61. 

Lottin S, Adriaenssens E, Dupressoir T, et al: Overexpression of an ectopic H19 gene enhances the tumorigenic properties of breast cancer cells. Carcinogenesis. 23:1885–1895. 2002.

62. 

Matouk IJ, DeGroot N, Mezan S, et al: The H19 non-coding RNA is essential for human tumor growth. PLoS One. 2:e8452007.

63. 

Yoshimizu T, Miroglio A, Ripoche MA, et al: The H19 locus acts in vivo as a tumor suppressor. Proc Natl Acad Sci USA. 105:12417–12422. 2008.

64. 

Barsyte-Lovejoy D, Lau SK, Boutros PC, et al: The c-Myc oncogene directly induces the H19 noncoding RNA by allele-specific binding to potentiate tumorigenesis. Cancer Res. 66:5330–5337. 2006.

65. 

Yang F, Bi J, Xue X, et al: Up-regulated long non-coding RNA H19 contributes to proliferation of gastric cancer cells. FEBS J. 279:3159–3165. 2012.

66. 

Kaplan R, Luettich K, Heguy A, Hackett NR, Harvey BG and Crystal RG: Monoallelic up-regulation of the imprinted H19 gene in airway epithelium of phenotypically normal cigarette smokers. Cancer Res. 63:1475–1482. 2003.

67. 

Cai X and Cullen BR: The imprinted H19 noncoding RNA is a primary microRNA precursor. RNA. 13:313–316. 2007.

68. 

Keniry A, Oxley D, Monnier P, et al: The H19 lincRNA is a developmental reservoir of miR-675 that suppresses growth and Igf1r. Nat Cell Biol. 14:659–665. 2012.

69. 

Huarte M, Guttman M, Feldser D, et al: A large intergenic noncoding RNA induced by p53 mediates global gene repression in the p53 response. Cell. 142:409–419. 2010.

70. 

Yoon JH, Abdelmohsen K, Srikantan S, et al: LincRNA-p21 suppresses target mRNA translation. Mol Cell. 47:648–655. 2012.

71. 

Gebeshuber CA, Zatloukal K and Martinez J: miR-29a suppresses tristetraprolin, which is a regulator of epithelial polarity and metastasis. EMBO Rep. 10:400–405. 2009.

72. 

Krol M, Polanska J, Pawlowski KM, et al: Transcriptomic signature of cell lines isolated from canine mammary adenocarcinoma metastases to lungs. J Appl Genet. 51:37–50. 2010.

73. 

Mattick JS and Makunin IV: Non-coding RNA. Hum Mol Genet 15 Spec No. 1:R17–R29. 2006.

74. 

Ulveling D, Francastel C and Hube F: When one is better than two: RNA with dual functions. Biochimie. 93:633–644. 2011.

75. 

Cesana M, Cacchiarelli D, Legnini I, et al: A long noncoding RNA controls muscle differentiation by functioning as a competing endogenous RNA. Cell. 147:358–369. 2011.

76. 

Wang J, Liu X, Wu H, et al: CREB up-regulates long non-coding RNA, HULC expression through interaction with microRNA-372 in liver cancer. Nucleic Acids Res. 38:5366–5383. 2010.

77. 

Franco-Zorrilla JM, Valli A, Todesco M, et al: Target mimicry provides a new mechanism for regulation of microRNA activity. Nat Genet. 39:1033–1037. 2007.

Journal Cover

August 2013
Volume 43 Issue 2

Print ISSN: 1019-6439
Online ISSN:1791-2423

2013 Impact Factor: 2.773
Ranked #30/202 Oncology
(total number of cites)

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
APA
Whiteside, E.J., Seim, I., Pauli, J.P., O'Keeffe, A.J., Thomas, P.B., Carter, S.L. ... Chopin, L.K. (2013). Identification of a long non-coding RNA gene, growth hormone secretagogue receptor opposite strand, which stimulates cell migration in non-small cell lung cancer cell lines. International Journal of Oncology, 43, 566-574. http://dx.doi.org/10.3892/ijo.2013.1969
MLA
Whiteside, E. J., Seim, I., Pauli, J. P., O'Keeffe, A. J., Thomas, P. B., Carter, S. L., Walpole, C. M., Fung, J. N., Josh, P., Herington, A. C., Chopin, L. K."Identification of a long non-coding RNA gene, growth hormone secretagogue receptor opposite strand, which stimulates cell migration in non-small cell lung cancer cell lines". International Journal of Oncology 43.2 (2013): 566-574.
Chicago
Whiteside, E. J., Seim, I., Pauli, J. P., O'Keeffe, A. J., Thomas, P. B., Carter, S. L., Walpole, C. M., Fung, J. N., Josh, P., Herington, A. C., Chopin, L. K."Identification of a long non-coding RNA gene, growth hormone secretagogue receptor opposite strand, which stimulates cell migration in non-small cell lung cancer cell lines". International Journal of Oncology 43, no. 2 (2013): 566-574. http://dx.doi.org/10.3892/ijo.2013.1969