Microarray analysis of microRNA expression patterns in the semen of infertile men with semen abnormalities

  • Authors: Te Liu, Weiwei Cheng, Yongtao Gao, Hui Wang, Zhixue Liu
  • View Affiliations

  • Published online on: Monday, June 25, 2012
  • Pages: 535-542
  • DOI: 10.3892/mmr.2012.967

Abstract

microRNAs (miRNAs) play a crucial role in tissue development and the pathology of many diseases, however, the effects and roles of miRNAs in the development of semen abnormalities in infertile males have not yet been investigated. In this study, we analyzed and compared the miRNA expression profiles of abnormal semen from 86 infertile males with normal semen from 86 healthy males using an miRNA microarray. In total, 52 miRNAs were differentially expressed between the abnormal semen of infertile males and the normal semen of healthy males. The differential expression of selected miRNAs was validated by real time qRT-PCR and northern blotting: miR-574-5p, miR-297, miR-122, miR-1275, miR-373, miR-185 and miR-193b were upregulated (fold change >1.5, p<0.001) and miR-100, miR-512-3p, miR-16, miR-19b, miR-23b and miR-26a were downregulated (fold change <0.667, p<0.001) in the semen of infertile males with semen abnormalities. In conclusion, this study provides new insights into specific miRNAs that are associated with semen abnormalities in infertile males.

Introduction

Semen abnormalities are a form of male infertility which present in a variety of ways and may prevent the sperm from achieving fertilization (14). Previous studies have shown that there are several causes of abnormal semen, including infection with sexually transmitted diseases (STDs), retrograde ejaculation and an inability of the ejaculate to clot properly, all of which can significantly affect male fertility. In addition, sperm abnormalities may be inherited or due to a hormone imbalance, medication or previous infection (5). Narayana et al indicated that O,O-dimethyl O-4-nitrophenyl phosphorothioate could affect the sperm morphology and count in rats (6), and Padmalatha Rai et al demonstrated that the anticancer drug tamoxifen citrate acts as a germ cell mutagen by inducing sperm shape abnormalities in mice in vivo (7). Additionally, Calogero et al reported that a large proportion of patients with oligoasthenoteratozoospermia and teratozoospermia have an increased rate of sperm aneuploidy, and these patients also have semen abnormalities (8). Studies have also indicated that abnormal semen characteristics are induced by testicular cancer (9,10). Although a number of the factors which cause abnormal semen, including chemotherapeutic agents, testicular tumors and microwave radiation (5,11,12) have been identified, differences in epigenetic regulation between normal and abnormal sperm have not been fully investigated.

microRNAs (miRNAs) are a class of naturally occurring single-stranded short 21–23 nt non-coding RNAs (13,14) which exist in a wide range of eukaryotic organisms (1318). Each mammalian miRNA can prevent the translation of a number of downstream target mRNAs and ultimately lead to the inhibition of target gene expression (19,20). Therefore, a shift away from the targeting of crucial target genes towards miRNA interference techniques may improve the effectiveness of current gene-based diagnostic and therapeutic strategies (15). However, most miRNA studies have focused on the growth and development of stem cells, differentiation, tumorigenesis and other pathological processes (19,20) and have given little consideration to the role of miRNAs in the development of abnormal semen and male infertility.

Several methods, including northern blot analysis, cloning and sequencing strategies, Invader assays, qRT-PCR and sequencing-based assays have been used to determine the expression of miRNAs in biological samples (21). However, miRNA microarrays have become the method of choice for global miRNA profiling studies, as large numbers of molecules can be screened simultaneously using a flexible probe design strategy (21). Additionally, miRNA microarrays provide a powerful tool for the analysis of miRNA expression patterns and quantitative miRNA expression levels. Microarray technology has become the most commonly utilized miRNA research tool, as it is more efficient than time-consuming traditional methods (2227).

In this study, we used a miRNA microarray-based high throughput approach to identify and quantify the miRNAs that were differentially expressed between the total RNA isolated from the normal semen from healthy males and the abnormal semen from infertile males. The identification of differentially expressed miRNAs in the abnormal semen of infertile males may support further studies to elucidate the causes and characteristics of abnormal semen.

Materials and methods

Patients

The present study involved 86 infertile males (B) with abnormal semen and 86 normal healthy adult males (H) as the control. The samples were collected from the inpatient clinic of the International Peace Maternity and Child Health Hospital of the China Welfare Institute (Shanghai, China) between February and September 2010. All human materials were obtained according to consent regulations and approved by the Ethical Review Committee of the World Health Organization Collaborating Center for Research in Human Reproduction in Shanghai, China as authorized by the Shanghai Municipal Government. Due to material limitations, we could only analyze a limited number of severely abnormal sperm samples.

Semen collection and assessment of semen function

Semen samples were produced by masturbation, collected in sterile containers and immediately transported to the laboratory. A conventional semen profile was obtained for each sample using the procedures described by the World Health Organization (10).

Total RNA extraction

Total RNA was isolated from each semen sample using the TRIzol reagent (Invitrogen Life Technologies, Carlsbad, CA, USA) according to the manufacturer’s instructions (28,29). The RNA samples were treated with DNase I (Sigma-Aldrich, St. Louis, MO, USA) and then quantified.

miRNA microarray analysis

RNA labeling and hybridization were performed on miRNA microarray chips as previously described (25,27,30). Briefly, 50 μg of total RNA was purified using the mirVana miRNA isolation kit (Ambion, Austin, TX, USA) to enrich the small RNA fraction. The purified RNA was labeled with fluorescein and hybridized using the CapitalBio mammalian miRNA array V3.0 (CapitalBio Corporation, Beijing, China) containing 2844 mature miRNA gene oligonucleotide probes in triplicate, corresponding to 1823 human, 648 mouse and 373 rat miRNAs. Each individual’s semen RNA was analyzed on a separate chip. Finally, scanned images of the microarray were captured and the hybridization signals were quantified. The signal intensity values were normalized to per-chip mean values.

Total RNA extraction and reverse transcription into cDNA

Following the detection of total RNA, we used a Poly(A) Tailing kit (Ambion) to add a poly(A) tail to the RNA products according to the kit’s instructions. The RNA samples were treated with DNase I, quantified and reverse-transcribed into cDNA using the ReverTra Ace-α First Strand cDNA Synthesis kit (Toyobo, Osaka, Japan). Notably, this reverse transcription reaction uses the oligo(dT) reverse transcription primer 5′-GCTGTCAACGATACGCTACCTAACGGCATGACAGTGTTTTTTTTTTTTTTT(C/G/A)-3′. All reaction steps were carried out according to the manufacturer’s instructions.

Quantitative real-time PCR validation miRNA expression

In accordance with the manufacturer’s instructions and as previously described (23), qRT-PCR was conducted in the realplex4 real-time PCR detection system from Eppendorf (Hamburg, Germany), using SYBR® Green RealTime PCR Master mix (Toyobo) as the detection dye. The qRT-PCR amplification process comprised 40 cycles of denaturation at 95°C for 10 sec and annealing at 57°C for 20 sec. The target cDNA was quantified using a relative quantification method. A comparative threshold cycle (Ct) was used to quantify the gene expression relative to the control (calibrator). The steady-state mRNA levels were expressed as an n-fold difference relative to the calibrator. For each sample, the Ct values were normalized using the formula: ΔCt = CtmiRNA − Ct18S rRNA. To detemine relative expression levels, the following formula was used: ΔΔCt = ΔCtB − ΔCtH. The values used to plot the relative miRNA expression levels were calculated using the expression 2−ΔΔCt. The miRNA levels were calibrated by 18S rRNA. The miRNA primers used in the cDNA amplification are shown in Table I.

Table I

The miRNA qRT-PCR primers used in the study.

Table I

The miRNA qRT-PCR primers used in the study.

Accession no.miRNAqRT-PCR primers (5′→3′)
MI0003581miR-574-5p 5′-TGAGTGTGTGTGTGTGAGTGTGT-3′ (forward)
5′-GCTGTCAACGATACGCTACCTA-3′ (reverse)
MI0000063let-7b 5′-CTATACAACCTACTGCCTTCCC-3′ (forward)
5′-GCTGTCAACGATACGCTACCTA-3′ (reverse)
MI0005775miR-297 5′-ATGTATGTGTGCATGTGCATG-3′ (forward)
5′-GCTGTCAACGATACGCTACCTA-3′ (reverse)
MI0000442miR-122 5′-AACGCCATTATCACACTAAATA-3′ (forward)
5′-GCTGTCAACGATACGCTACCTA-3′ (reverse)
MI0006415miR-1275 5′-GTGGGGGAGAGGCTGTC-3′ (forward)
5′-GCTGTCAACGATACGCTACCTA-3′ (reverse)
MI0006428miR-1281 5′-TCGCCTCCTCCTCTCCC-3′ (forward)
5′-GCTGTCAACGATACGCTACCTA-3′ (reverse)
MI0000781miR-373 5′-GAAGTGCTTCGATTTTGGGGTGT-3′ (forward)
5′-GCTGTCAACGATACGCTACCTA-3′ (reverse)
MI0000482miR-185 5′-AGGGGCTGGCTTTCCTCTGGTC-3′ (forward)
5′-GCTGTCAACGATACGCTACCTA-3′ (reverse)
MI0003137miR-193b 5′-AACTGGCCCTCAAAGTCCCGCT-3′ (forward)
5′-GCTGTCAACGATACGCTACCTA-3′ (reverse)
MI0000461miR-145 5′-GGATTCCTGGAAATACTGTTCT-3′ (forward)
5′-GCTGTCAACGATACGCTACCTA-3′ (reverse)
MI0000290miR-214 5′-ACAGCAGGCACAGACAGGCAGT-3′ (forward)
5′-GCTGTCAACGATACGCTACCTA-3′ (reverse)
MI0000089miR-31 5′-TGCTATGCCAACATATTGCCAT-3′ (forward)
5′-GCTGTCAACGATACGCTACCTA-3′ (reverse)
MI0003513miR-455-3p 5′-GCAGTCCATGGGCATATACAC-3′ (forward)
5′-GCTGTCAACGATACGCTACCTA-3′ (reverse)
MI0000102miR-100 5′-CAAGCTTGTATCTATAGGTATG-3′ (forward)
5′-GCTGTCAACGATACGCTACCTA-3′ (reverse)
MI0003161miR-517a 5′-ATCGTGCATCCCTTTAGAGTGT-3′ (forward)
5′-GCTGTCAACGATACGCTACCTA-3′ (reverse)
MI0003140miR-512-3p 5′-AAGTGCTGTCATAGCTGAGGTC-3′ (forward)
5′-GCTGTCAACGATACGCTACCTA-3′ (reverse)
MI0000070miR-16 5′-CCAGTATTAACTGTGCTGCTGA-3′ (forward)
5′-GCTGTCAACGATACGCTACCTA-3′ (reverse)
MI0003153miR-523 5′-GAACGCGCTTCCCTATAGAGGGT-3′ (forward)
5′-GCTGTCAACGATACGCTACCTA-3′ (reverse)
MI0000074miR-19b 5′-TGTGCAAATCCATGCAAAACTGA-3′ (forward)
5′-GCTGTCAACGATACGCTACCTA-3′ (reverse)
MI0000439miR-23b 5′-ATCACATTGCCAGGGATTACC-3′ (forward)
5′-GCTGTCAACGATACGCTACCTA-3′ (reverse)
MI0000083miR-26a 5′-CCTATTCTTGGTTACTTGCACG-3′ (forward)
5′-GCTGTCAACGATACGCTACCTA-3′ (reverse)

[i] miRNA, microRNA; qRT-PCR, quantitative real-time PCR.

Northern blot analysis

All steps in the northern blotting process were carried out as previously described (28,29). For all samples, 20 μg good quality total RNA was analyzed on a 7.5 M urea 12% PAA denaturing gel and transferred to a Hybond-N+ nylon membrane (Amersham, Freiburg, Germany). The membranes were crosslinked using UV light for 30 sec at 1200 mJ/cm2. Hybridization was performed using miRNA antisense StarFire probes to detect the 22-nt miRNA fragments, according to the manufacturer’s instructions. After washing, the membranes were exposed for 20–40 h to Kodak XAR-5 films (Sigma-Aldrich). The ethidium bromide-stained gels prior to the transfer of tRNA were used as controls to ensure equal loading of the RNA samples.

Statistical analysis

Each experiment was performed at least three times and data are the mean ± SE, where applicable. Differences were evaluated using the Student’s t-test. p<0.05 was considered to indicate a statistically significant result.

Results

Comparison of the characteristics and semen parameters of the healthy males and infertile males

A total of 172 males were invited to participate in this study: 86 healthy males with normal semen and 86 infertile males with semen abnormalities. The only significant difference between the populations was the percentage of progressive motile (a+b) forms (p<0.001). The results of laboratory tests indicated that asthenozoospermia was the most frequent finding in the 86 infertile males. The characteristics of the study participants are presented in Table II.

Table II

Comparison of the clinical characteristics of the infertile males with semen abnormalities and the healthy adult males.

Table II

Comparison of the clinical characteristics of the infertile males with semen abnormalities and the healthy adult males.

ParameterInfertile males (n=86)Healthy males (n=86)
Age (years)32±1 (27–41)32±2 (29–42)
Volume (ml)1.92±0.08 (1–2)2
Concentration (105/ml)97.59±18.05 (24.0–224.7)57.37±13.17 (39.0–117.4)
a+b (%)23.11±5.03 (0–46.2)45.17±6.34 (12.6–65.7)
a+b+c (%)32.85±5.52 (5.9–63.3)62.66±5.72 (49.3–82.6)
Total RNA quality analysis

A 260 to 280 nm absorbance ratio (260/280)>1.8 is usually considered to be an acceptable indicator of RNA purity for miRNA microarrays and indicates an absence of detectable protein contamination in the RNA sample (15). Following the extraction of total RNA from the samples, the 260/280 ratio of each extract was determined using a spectrophotometer (15,31). The 260/280 ratios ranged from 1.83 to 1.97. Formaldehyde denaturing gel electrophoresis was used to confirm the presence of clear 28S, 18S and 5S bands (Fig. 1) and the absence of marked RNA degradation. This analysis indicated that the purity and integrity of each RNA sample met the requirements of the miRNA microarray and qRT-PCR experiments (15).

miRNA microarray quality control and results analysis

In order to identify miRNAs which are differentially expressed between the abnormal semen of infertile males and the normal semen of healthy males, we prepared a miRNA microarray containing 2844 oligonucleotide probes (1823 human, 648 mouse and 373 rat) complementary to known mammalian miRNAs (23,24,32). All probes were repeated three times in each microarray and each microarray contained 16 controls (Zip5, Zip13, Zip15, Zip21, Zip23, Zip25, Y2, Y3, U6, New-U2-R, tRNA-R, has-let-7a, has-let-7b, has-let-7c, 50% DMSO and Hex). In order to increase the reliability of the results, each miRNA microarray assay was repeated twice (24) and the scatter plots for all spots indicated that a high reproducibility and reliability were achieved (Fig. 2A).

The miRNA expression patterns for abnormal semen from infertile males (B) and normal semen from healthy males (H) were compared. Significance analysis of microarray (SAM) and a fold change criterion (B/H ratio) >1.50 or <0.667 and p<0.001 were used to identify significant differences (32,33). Using these criteria, we identified 52 miRNAs which were differentially expressed between the semen of infertile males and normal males. Analysis of the microarray expression levels confirmed that 21 miRNAs (mi-574-5p, let-7b, miR-297, miR-122, miR-1275, miR-1281, miR-373, miR-185, miR-193b, miR-145, miR-214, miR-574-3p, miR-483-5p, miR-324-3p, miR-372, miR-484, miR-933, miR-663, miR-1268, miR-923 and miR-1234) were significantly overexpressed in the abnormal semen compared with the normal semen. Conversely, 31 miRNAs (miR-1826, miR-493, miR-371-5p, miR-516a-5p, miR-512-5p, miR-498, miR-30a, miR-23a, miR-130a, miR-103, miR-30b, miR-27a, miR-18a, miR-525-3p, miR-517c, miR-199b-3p, miR-517b, miR-107, miR-199a-3p, miR-1323, miR-515-5p, miR-31, miR-455-3p, miR-100, miR-517a, miR-512-3p, miR-16, miR-523, miR-19b, miR-23b and miR-26a) were significantly underexpressed in the abnormal semen compared with the normal semen (Table III).

Table III

Summary of the SAM results for miRNA expression in the abnormal semen of infertile males and the normal semen of healthy adult males.

Table III

Summary of the SAM results for miRNA expression in the abnormal semen of infertile males and the normal semen of healthy adult males.

miRNAFold change (B/H)Mature miRNA sequenceChromosome locationSequence length (nt)
miR-574-5p7.0715 UGAGUGUGUGUGUGUGAGUGUGU423
let-7b5.7958 UGAGGUAGUAGGUUGUGUGGUU2222
miR-2974.8753 AUGUAUGUGUGCAUGUGCAUG421
miR-1222.7916 UGGAGUGUGACAAUGGUGUUUG1822
miR-12752.3772 GUGGGGGAGAGGCUGUC617
miR-12811.9876 UCGCCUCCUCCUCUCCC2217
miR-3731.9799 GAAGUGCUUCGAUUUUGGGGUGU1923
miR-1851.9584 UGGAGAGAAAGGCAGUUCCUGA2222
miR-193b1.9558 AACUGGCCCUCAAAGUCCCGCU1622
miR-1451.9218 GUCCAGUUUUCCCAGGAAUCCCU523
miR-2141.9027 ACAGCAGGCACAGACAGGCAGU122
miR-574-3p1.7689 CACGCUCAUGCACACACCCACA422
miR-483-5p1.7640 AAGACGGGAGGAAAGAAGGGAG1122
miR-324-3p1.7295 ACUGCCCCAGGUGCUGCUGG1720
miR-3721.7001 AAAGUGCUGCGACAUUUGAGCGU1923
miR-4841.6988 UCAGGCUCAGUCCCCUCCCGAU1622
miR-9331.6101 UGUGCGCAGGGAGACCUCUCCC222
miR-6631.6083 AGGCGGGGCGCCGCGGGACCGC2022
miR-12681.6016 CGGGCGUGGUGGUGGGGG1518
miR-9231.5892 GUCAGCGGAGGAAAAGAAACU1721
miR-12341.5736 UCGGCCUGACCACCCACCCCAC822
miR-18260.6548 AUUGAUCAUCGACACUUCGAACGCAAU1627
miR-4930.6536 UGAAGGUCUACUGUGUGCCAGG1422
miR-371-5p0.6517 ACUCAAACUGUGGGGGCACU1920
miR-516a-5p0.6441 UUCUCGAGGAAAGAAGCACUUUC1923
miR-512-5p0.6322 CACUCAGCCUUGAGGGCACUUUC1923
miR-4980.6191 UUUCAAGCCAGGGGGCGUUUUUC1923
miR-30a0.6070 UGUAAACAUCCUCGACUGGAAG622
miR-23a0.6058 AUCACAUUGCCAGGGAUUUCC1921
miR-130a0.5913 CAGUGCAAUGUUAAAAGGGCAU1122
miR-1030.5886 AGCAGCAUUGUACAGGGCUAUGA2023
miR-30b0.5771 UGUAAACAUCCUACACUCAGCU822
miR-27a0.5577 UUCACAGUGGCUAAGUUCCGC1921
miR-18a0.4980 UAAGGUGCAUCUAGUGCAGAUAG1323
miR-525-3p0.4817 GAAGGCGCUUCCCUUUAGAGCG1922
miR-517c0.4783 AUCGUGCAUCCUUUUAGAGUGU1922
miR-199b-3p0.4700 ACAGUAGUCUGCACAUUGGUUA922
miR-517b0.4672 UCGUGCAUCCCUUUAGAGUGUU1922
miR-1070.4641 AGCAGCAUUGUACAGGGCUAUCA1923
miR-199a-3p0.4452 ACAGUAGUCUGCACAUUGGUUA1922
miR-13230.4352 UCAAAACUGAGGGGCAUUUUCU1922
miR-515-5p0.4279 UUCUCCAAAAGAAAGCACUUUCUG1924
miR-310.4137 AGGCAAGAUGCUGGCAUAGCU921
miR-455-3p0.4117 GCAGUCCAUGGGCAUAUACAC921
miR-1000.3938 AACCCGUAGAUCCGAACUUGUG1122
miR-517a0.3889 AUCGUGCAUCCCUUUAGAGUGU1922
miR-512-3p0.3884 AAGUGCUGUCAUAGCUGAGGUC1922
miR-160.3455 UAGCAGCACGUAAAUAUUGGCG1322
miR-5230.3075 GAACGCGCUUCCCUAUAGAGGGU1923
miR-19b0.2670 UGUGCAAAUCCAUGCAAAACUGA1323
miR-23b0.2616 AUCACAUUGCCAGGGAUUACC921
miR-26a0.2221 UUCAAGUAAUCCAGGAUAGGCU1222

[i] SAM, significance analysis of microarray; B/H, ratio of miRNA expression in the abnormal semen of infertile males [B] to that in the normal semen of healthy adult males [H].

qRT-PCR confirmation of the miRNA microarray results

Following common procedures for the confirmation of microarray analysis (23,24,3234), qRT-PCR was used to confirm the results of the miRNA microarray analysis. Of the 11 miRNAs identified by the microarray as being the most overexpressed in the abnormal semen of infertile males compared with normal semen (miR-574-5p, let-7b, miR-297, miR-122, miR-1275, miR-1281, miR-373, miR-185, miR-193b, miR-145 and miR-214), qRT-PCR confirmed that seven (miR-574-5p, miR-297, miR-122, miR-1275, miR-373, miR-185 and miR-193b) were overexpressed. Of the ten miRNAs identified as being underexpressed in abnormal semen by the microarray (miR-31, miR-455-3p, miR-100, miR-517a, miR-512-3p, miR-16, miR-523, miR-19b, miR-23b and miR-26a), the qRT-PCR analysis confirmed that six of these (miR-100, miR-512-3p, miR-16, miR-19b, miR-23b and miR-26a) were underexpressed.

Scatter plot analysis of the qRT-PCR results confirmed that seven miRNAs (miR-574-5p, miR-297, miR-122, miR-1275, miR-373, miR-185 and miR-193b) were overexpressed and six miRNAs (miR-100, miR-512-3p, miR-16, miR-19b, miR-23b and miR-26a) were underexpressed in the semen of infertile males compared with the normal semen (Fig. 2B).

A Venn diagram (Fig. 2C) was used to depict the correlation between the results of the miRNA microarray and the 21 miRNAs tested by qRT-PCR. The differential expression of 13 miRNAs (miR-574-5p, miR-297, miR-122, miR-1275, miR-373, miR-185, miR-193b, miR-100, miR-512-3p, miR-16, miR-19b, miR-23b and miR-26a) in the abnormal semen of the infertile males was confirmed by qRT-PCR (indicated by the overlap in the diagram). The expression levels of the other miRNAs correlated in some or other methods. Overall, the qRT-PCR analysis indicated that the miRNA microarray results had some small errors, however, it confirmed that a significant number of miRNAs are differentially regulated in the abnormal semen of infertile males.

Northern blot validation of miRNA expression

The expression levels of the 13 miRNAs which were confirmed to be differently expressed by qRT-PCR were further investigated by northern blotting of the RNA isolated from the abnormal semen of three infertile males and the normal semen of three healthy adult males. Anti-sense miRNA locked nucleic acid probes were used for each miRNA (Fig. 3). The northern blotting hybridization signals for miR-574-5p, miR-297, miR-122, miR-1275, miR-373, miR-185 and miR-193b were weaker in the semen of healthy adult controls than that of the infertile males, confirming that these miRNAs are upregulated in the abnormal semen. The miR-100, miR-512-3p, miR-16, miR-19b, miR-23b and miR-26a hybridization bands were barely detectable and, therefore, we could not confirm the differential regulation of these miRNAs using northern blotting.

Discussion

Mature miRNAs are an abundant class of 21–23 nt non-coding RNAs which regulate the expression of their target genes and are involved in many biological processes (15,21,23,24,3234). To date, more than 1600 miRNAs have been identified in plants, animals and viruses (16,21,35,36). It is currently estimated that miRNAs account for approximately 1% of all predicted genes and that up to 30% of the genes in higher eukaryotic genomes may be regulated by miRNAs (21); therefore, many miRNAs remain to be identified in mammalian genomes. Little is known concerning the patterns or levels of miRNA expression in the abnormal semen of infertile males (24,33).

The aim of the study was to identify which miRNAs are differentially expressed between abnormal and normal sperm, in order to provide a foundation for future studies on the function and role of miRNAs in semen abnormalities. We profiled the expression of a number of miRNAs using a miRNA microarray and demonstrated that the expression of 52 miRNAs was significantly different in the abnormal semen of infertile males compared with the semen of healthy males. These results suggest that miRNAs are involved in the development of male infertility associated with semen abnormalities.

We used qRT-PCR to confirm the expression levels of 21 of the 52 miRNAs which were differentially expressed in the microarray. In total, 13 of the 21 miRNAs tested were identified as being differentially expressed in abnormal semen by the microarray and qRT-PCR. Although, there were some discrepancies in the results of the microarray and the qRT-PCR analysis, the miRNA microarray provided a rapid method for identifying a large number of differentially expressed miRNAs in abnormal semen which could then be confirmed by qRT-PCR.

This study describes the global expression patterns of miRNAs in the abnormal semen from infertile males and contributes to the growing understanding of the role of miRNAs in the development of semen abnormalities. Moreover, the differential expression patterns of miRNAs between normal and abnormal semen may enable the direct diagnosis of semen abnormalities or provide novel therapeutic targets for infertile males.

Acknowledgements

This study was supported by a grant from the Shanghai Committee Medical Science Foundation of China (No. 10411967100) to Te Liu.

References

1 

Zenzmaier C, Gerth R, Gruschwitz M, Lindner H, Plas E and Berger P: Decreased levels of genuine large free hCG alpha in men presenting with abnormal semen analysis. Reprod Biol Endocrinol. 9:1142011.

2 

Hu W, Yang H, Sun J, et al: Polymorphisms in CYP1B1 modify the risk of idiopathic male infertility with abnormal semen quality. Clin Chim Acta. 412:1778–1782. 2011.

3 

Chatzimeletiou K, Sioga A, Oikonomou L, et al: Semen analysis by electron and fluorescence microscopy in a case of partial hydatidiform mole reveals a high incidence of abnormal morphology, diploidy, and tetraploidy. Fertil Steril. 95:e2431–e2435. 2011.

4 

Moretti E, Castellini C, Mourvaki E, et al: Distribution of α- and δ-tocopherols in seminal plasma and sperm fractions of men with normal and abnormal semen parameters. J Androl. 32:232–239. 2011.

5 

Kowalczuk CI, Saunders RD and Stapleton HR: Sperm count and sperm abnormality in male mice after exposure to 2.45 GHz microwave radiation. Mutat Res. 122:155–161. 1983.

6 

Narayana K, Prashanthi N, Nayanatara A, Kumar HH, Abhilash K and Bairy KL: Effects of methyl parathion (O,O-dimethyl O-4-nitrophenyl phosphorothioate) on rat sperm morphology and sperm count, but not fertility, are associated with decreased ascorbic acid level in the testis. Mutat Res. 588:28–34. 2005.

7 

Padmalatha Rai S and Vijayalaxmi KK: Tamoxifen citrate induced sperm shape abnormalities in the in vivo mouse. Mutat Res. 492:1–6. 2001.

8 

Calogero AE, De Palma A, Grazioso C, et al: Aneuploidy rate in spermatozoa of selected men with abnormal semen parameters. Hum Reprod. 16:1172–1179. 2001.

9 

Jacobsen R, Bostofte E, Engholm G, et al: Risk of testicular cancer in men with abnormal semen characteristics: cohort study. BMJ. 321:789–792. 2000.

10 

Torra R, Sarquella J, Calabia J, et al: Prevalence of cysts in seminal tract and abnormal semen parameters in patients with autosomal dominant polycystic kidney disease. Clin J Am Soc Nephrol. 3:790–793. 2008.

11 

Ravnborg TL, Jensen TK, Andersson AM, Toppari J, Skakkebaek NE and Jørgensen N: Prenatal and adult exposures to smoking are associated with adverse effects on reproductive hormones, semen quality, final height and body mass index. Hum Reprod. 26:1000–1011. 2011.

12 

Barratt CL, Björndahl L, Menkveld R and Mortimer D: ESHRE special interest group for andrology basic semen analysis course: a continued focus on accuracy, quality, efficiency and clinical relevance. Hum Reprod. 26:3207–3212. 2011.

13 

Sumazin P, Yang X, Chiu HS, et al: An extensive microRNA-mediated network of RNA-RNA interactions regulates established oncogenic pathways in glioblastoma. Cell. 147:370–381. 2011.

14 

Poulton JS, Huang YC, Smith L, et al: The microRNA pathway regulates the temporal pattern of Notch signaling in Drosophila follicle cells. Development. 138:1737–1745. 2011.

15 

Lei P, Li Y, Chen X, Yang S and Zhang J: Microarray based analysis of microRNA expression in rat cerebral cortex after traumatic brain injury. Brain Res. 1284:191–201. 2009.

16 

Bartel DP: MicroRNAs: genomics, biogenesis, mechanism, and function (Review). Cell. 116:281–297. 2004.

17 

Yoo AS, Sun AX, Li L, et al: MicroRNA-mediated conversion of human fibroblasts to neurons. Nature. 476:228–231. 2011.

18 

Dai Y, Diao Z, Sun H, Li R, Qiu Z and Hu Y: MicroRNA-155 is involved in the remodelling of human-trophoblast-derived HTR-8/SVneo cells induced by lipopolysaccharides. Hum Reprod. 26:1882–1891. 2011.

19 

He L and Hannon GJ: MicroRNAs: small RNAs with a big role in gene regulation (Review). Nat Rev Genet. 5:522–531. 2004.

20 

El Ouaamari A, Baroukh N, Martens GA, Lebrun P, Pipeleers D and van Obberghen E: miR-375 targets 3′-phosphoinositide-dependent protein kinase-1 and regulates glucose-induced biological responses in pancreatic beta-cells. Diabetes. 57:2708–2717. 2008.

21 

Yang Y, Bai W, Zhang L, et al: Determination of microRNAs in mouse preimplantation embryos by microarray. Dev Dyn. 237:2315–2327. 2008.

22 

Calin GA, Liu CG, Sevignani C, et al: MicroRNA profiling reveals distinct signatures in B cell chronic lymphocytic leukemias. Proc Natl Acad Sci USA. 101:11755–11760. 2004.

23 

Bloomston M, Frankel WL, Petrocca F, et al: MicroRNA expression patterns to differentiate pancreatic adenocarcinoma from normal pancreas and chronic pancreatitis. JAMA. 297:1901–1908. 2007.

24 

Yan N, Lu Y, Sun H, et al: A microarray for microRNA profiling in mouse testis tissues. Reproduction. 134:73–79. 2007.

25 

Wang LL, Zhang Z, Li Q, et al: Ethanol exposure induces differential microRNA and target gene expression and teratogenic effects which can be suppressed by folic acid supplementation. Hum Reprod. 24:562–579. 2009.

26 

Barshack I, Meiri E, Rosenwald S, et al: Differential diagnosis of hepatocellular carcinoma from metastatic tumors in the liver using microRNA expression. Int J Biochem Cell Biol. 42:1355–1362. 2010.

27 

Li W, Xie L, He X, et al: Diagnostic and prognostic implications of microRNAs in human hepatocellular carcinoma. Int J Cancer. 123:1616–1622. 2008.

28 

Cheng W, Liu T, Jiang F, et al: microRNA-155 regulates angiotensin II type 1 receptor expression in umbilical vein endothelial cells from severely pre-eclamptic pregnant women. Int J Mol Med. 27:393–399. 2011.

29 

Zhang L, Liu T, Huang Y and Liu J: microRNA-182 inhibits the proliferation and invasion of human lung adenocarcinoma cells through its effect on human cortical actin-associated protein. Int J Mol Med. 28:381–388. 2011.

30 

Li S, Chen X, Zhang H, et al: Differential expression of microRNAs in mouse liver under aberrant energy metabolic status. J Lipid Res. 50:1756–1765. 2009.

31 

Wang WX, Wilfred BR, Baldwin DA, et al: Focus on RNA isolation: obtaining RNA for microRNA (miRNA) expression profiling analyses of neural tissue. Biochim Biophys Acta. 1779:749–757. 2008.

32 

Liu HH, Tian X, Li YJ, Wu CA and Zheng CC: Microarray-based analysis of stress-regulated microRNAs in Arabidopsis thaliana. RNA. 14:836–843. 2008.

33 

Wu H, Neilson JR, Kumar P, et al: miRNA profiling of naive, effector and memory CD8 T cells. PLoS One. 2:e10202007.

34 

Kuhn DE, Nuovo GJ, Martin MM, et al: Human chromosome 21-derived miRNAs are overexpressed in down syndrome brains and hearts. Biochem Biophys Res Commun. 370:473–477. 2008.

35 

Ambros V: The functions of animal microRNAs (Review). Nature. 431:350–355. 2004.

36 

Du T and Zamore PD: microPrimer: the biogenesis and function of microRNA (Review). Development. 132:4645–4652. 2005.

Journal Cover

September 2012
Volume 6 Issue 3

Print ISSN: 1791-2997
Online ISSN:1791-3004

2013 Impact Factor: 1.484
Ranked #59/122 Medicine Research and Experimental
(total number of cites)

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation