Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
March-2018 Volume 17 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
March-2018 Volume 17 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Integrative analysis of long non-coding RNAs and messenger RNA expression profiles in systemic lupus erythematosus

  • Authors:
    • Qing Luo
    • Xue Li
    • Chuxin Xu
    • Lulu Zeng
    • Jianqing Ye
    • Yang Guo
    • Zikun Huang
    • Junming Li
  • View Affiliations / Copyright

    Affiliations: Department of Clinical Laboratory, The First Affiliated Hospital of Nanchang University, Nanchang, Jiangxi 330006, P.R. China, Medical College, Nanchang University, Nanchang, Jiangxi 330006, P.R. China
    Copyright: © Luo et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 3489-3496
    |
    Published online on: December 22, 2017
       https://doi.org/10.3892/mmr.2017.8344
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Thousands of long noncoding RNAs (lncRNAs) have been reported and represent an important subset of pervasive genes associated with a broad range of biological functions. Abnormal expression levels of lncRNAs have been demonstrated in multiple types of human disease. However, the role of lncRNAs in systemic lupus erythematosus (SLE) remains poorly understood. In the present study, the expression patterns of lncRNAs and messenger RNAs (mRNAs) were investigated in peripheral blood mononuclear cells (PBMCs) in SLE using Human lncRNA Array v3.0 (8x60 K; Arraystar, Inc., Rockville, MD, USA). The microarray results indicated that 8,868 lncRNAs (3,657 upregulated and 5,211 downregulated) and 6,876 mRNAs (2,862 upregulated and 4,014 downregulated) were highly differentially expressed in SLE samples compared with the healthy group. Gene ontology (GO) analysis of lncRNA target prediction indicated the presence of 474 matched lncRNA‑mRNA pairs for 293 differentially expressed lncRNAs (fold change, ≥3.0) and 381 differentially expressed mRNAs (fold change, ≥3.0). The most enriched pathways were ‘Transcriptional misregulation in cancer’ and ‘Valine, leucine and isoleucine degradation’. Furthermore, reverse transcription‑quantitative polymerase chain reaction data verified six abnormal lncRNAs and mRNAs in SLE. The results indicate that the lncRNA expression profile in SLE was significantly changed. In addition, a range of SLE‑associated lncRNAs were identified. Thus, the present results provide important insights regarding lncRNAs in the pathogenesis of SLE.

Introduction

Systemic lupus erythematosus (SLE), a complex autoimmune disease, is characterized by multiple immunologic abnormalities. It has previously been reported that ~7.4–159.4/100,000 people suffer from SLE worldwide, and SLE predominantly affects women of childbearing age (1–3). The presence of high titres of autoantibodies against nuclear components, elevated circulating immune complexes and complement deficiency are the predominant characteristics of the disease. The etiology of SLE is incompletely understood; however, genetic factors are important in the susceptibility to the disease.

Long noncoding RNAs (lncRNAs) are transcript RNA molecules, longer than 200 nucleotides, which do not encode a protein and reside in the nucleus or cytoplasm (4). lncRNAs are classified by their position relative to protein-coding messenger RNAs (mRNAs), and comprise the long intergenic ncRNA (lincRNA), intronic lncRNA, antisense lncRNA, transcribed pseudogene lncRNAs and enhancer RNA (eRNA). Although dysregulation of lncRNA expression has been characterized predominantly in cancer, it has recently been evaluated in autoimmune diseases, such as autoimmune thyroid disease (AITD) and rheumatoid arthritis (RA) (5,6). Specifically, lncRNAs have been proposed as a regulator of immune response (7–9) and contribute to the inflammatory response (10–13). Thus, it is hypothesized that lncRNAs, in combination with mRNAs, are also involved in the germination and development of SLE. However, until now, knowledge regarding the possible association between abnormal lncRNAs and SLE remains limited.

In the present study, integrative lncRNA-mRNA microarray analysis was performed to determine the expression profiles of lncRNAs in SLE samples and normal samples. In addition, three lncRNAs and three mRNAs were confirmed using reverse transcription-quantitative polymerase chain reaction (RT-qPCR). Gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis were used to predict the function and signaling pathways affected by the differentially expressed mRNAs, which were target genes of aberrantly expressed lncRNAs. The results of the present study suggest that lncRNA expression patterns may provide further insight into the pathogenesis of SLE.

Materials and methods

SLE patients and healthy control subjects

Whole blood was collected from 29 SLE patients and 34 age- and sex-matched healthy control subjects (HCs), who were enrolled between July 2015 and May 2016, in the Department of Rheumatology and Immunology, The First Affiliated Hospital of Nanchang University (Nanchang, China). HCs were selected based on no history of autoimmune disease and all SLE patients were diagnosed according to the American College of Rheumatology classification criteria for SLE (14). A total of 10 of the already enrolled 29 patients with SLE and 10 of the already enrolled 34 age- and sex-matched HCs were recruited to isolate the peripheral blood mononuclear cells (PBMCs) and perform microarray analysis. Other samples (19 patients with SLE and 24 HCs) were used to verify the results of microarray by RT-qPCR assay. The study was approved by the Ethics Committee of the First Affiliated Hospital of Nanchang University (approval no. 2014003) and was conducted in accordance with the Declaration of Helsinki. Informed consent was obtained from all the participants before commencing the study.

Blood sample collection and RNA isolation

Venous blood samples were obtained from 29 SLE patients and 34 HCs and stored in EDTA tubes. PBMCs were isolated from the venous blood by Ficoll-Histopaque (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) density gradient centrifugation (1,000 × g, 20 min, 22°C). Total RNA was extracted from PBMCs from each specimen using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) according to the manufacturer's instructions. The concentration and quality of the RNA were assessed by absorbance spectrometry (260 nm/280 nm) using a NanoDrop ND-1000 (Thermo Fisher Scientific, Inc.).

Microarray and data analysis

RNA samples were analyzed using Arraystar Human LncRNA Array v3.0 (Arraystar, Inc., Rockville, MD, USA), according to the manufacturer's instructions, which includes 33,045 lncRNAs and 30,215 coding transcripts. Briefly, rRNA was removed from total RNA and the mRNAs were obtained using an mRNA-ONLY™ Eukaryotic mRNA Isolation kit (Epicentre; Illumina, Inc., San Diego, CA, USA). The random priming method was utilized to amplify each sample and mRNA was transcribed into fluorescent complementary RNAs (cRNAs) without 3′bias. Labeled cRNAs were hybridized to the Human LncRNA Microarray. After washing the slides using Gene Expression Wash Buffer 1 (Agilent Technologies, Inc., Santa Clara, CA, USA), and Gene Expression Wash Buffer 2 (Agilent Technologies, Inc.), the arrays were scanned using an Agilent G2505C Scanner. Raw data were extracted using GeneSpring GX v12.0 software package (Agilent Technologies, Inc.). The microarray work was performed by Kangcheng Biology Engineering Co., Ltd. (Shanghai, China).

Functional group analysis

GO (www.geneontology.org) and KEGG (www.genome.ad.jp/kegg) databases were used to analyze the biological functions and signaling pathways affected by disexpression of mRNAs (the cut-off P-value was 0.05).

RT-qPCR assay

The expression levels of differentially expressed lncRNAs and mRNAs were confirmed by RT-qPCR. Briefly, total RNA was extracted from PBMCs using TRIzol reagent (Sigma-Aldrich; Merck KGaA), and 5 µg samples were used for the synthesis of first strand cDNA using a PrimeScript™ RT Reagent kit (Takara Biotechnology Co., Ltd., Dalian, China) according to the manufacturer's protocol. The RT reaction was performed in a 10 µl reaction containing 5X PrimeScript™ Buffer, 1 µl RT specific primer, 0.5 µl PrimeScript™ RT Enzyme Mix and 5 µg of total RNA. The RT assay was set at an initial denaturation step at 37°C for 15 min, followed by 85°C for 5 sec. Following first strand cDNA synthesis, the PCR reaction was performed in a 10 µl reaction containing 1X SYBR-Green PCR Master mix (Takara Biotechnology Co., Ltd.), 0.4 µM of each specific forward and reverse primer and 0.5 µl of cDNA template. The PCR assay was set at an initial denaturation step at 95°C for 5 min, followed by 40 cycles of 95°C for 15 sec and 60°C for 1 min with an ABI 7500 Real-time PCR System (Applied Biosystems; Thermo Fisher Scientific, Inc.). The primers are detailed in Table I. Gene expression levels were normalized to GAPDH in cDNA samples, and all experiments were performed in triplicate. The relative expression levels of the genes were determined using the ∆Cq method, where ∆Cq=Cq median gene-Cq median GAPDH (15,16).

Table I.

Primer sequence.

Table I.

Primer sequence.

Gene namePrimer sequenceProduct (bp) length
AK130076F: CCAACATGCTGACTCACCCTTCC185
R: ATGGAGTCTCGCTCTGTCACCCA
CTC-471J1.2F: ACAAATCTGAAAATACCACCTTG106
R: TTTCCTAGAAATCATTTAACCCA
RP11-875O11.1F: CCCGATGGAATCTTACTCTGTTG129
R: CATGCCTGTAATCCCAGCTACTC
PGLYRP1F: CACATGAAGACACTGGGCTGGT147
R: CATGAAGCTGATGCCAATGGAC
PDCD4F: GGATGAAAGGGCATTTGAGAAGAC152
R: CCAATGCTAAGGATACTGCCAACA
PTENF: ATCATTTCTTCATAGTGCTCCCC125
R: CAATAGTAGTTGTACTCCGCTTA
GAPDHF: GCACCGTCAAGGCTGAGAAC138
R: TGGTGAAGACGCCAGTGGA

[i] Long none-coding RNAs included AK130076, CTC-471J1.2 and RP11-875O11.1. F, forward; R, reverse; PGLYRP1, peptidoglycan recognition protein 1; PDCD4, programmed cell death 4; PTEN, phosphatase and tensin homolog; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

Statistical analysis

Data are presented as mean ± standard deviation. The Mann-Whitney test or Student's t-test was used to perform statistical analysis. P<0.05 was considered to indicate a statistically significant difference.

Results

Aberrant lncRNA expression in PBMCs of SLE

To investigate the possible biological functions of lncRNAs in SLE, the lncRNA and mRNA expression profiles were estimated in PBMCs of SLE using microarray analysis (Figs. 1 and 2). The expression profiles of 8,868 (28.9%) lncRNAs indicated that they were differentially expressed (more than two-fold) between two groups (data no shown). Among these, 3,657 were upregulated while 5,211 were downregulated in the SLE group, compared with those in the healthy group. The most significantly deregulated lncRNAs were ENST00000523884 (fold change up, 303.1127021) and ENST00000559539 (fold change down, 4868.2903529).

Figure 1.

Box plots and scatter plots demonstrating the variation in lncRNA and mRNA expression levels between the SLE and healthy group arrays. Box plots representing the distribution of the (A) lncRNA and (B) mRNA profiles. Following normalization, the distributions of the log2-ratios among the tested samples were nearly the same. The scatter plots of (C) lncRNA and (D) mRNA assess the variation between the SLE and healthy group arrays. The x- and y-axes in the scatter plot represent the normalized signal values of each group (log2 scale). The lncRNAs and mRNAs above the top green line and below the bottom green line are those with a two-fold change in expression between groups. lncRNA, long none-coding RNA; mRNA, messenger RNA; SLE, systemic lupus erythematosus.

Figure 2.

Hierarchical clustering analysis of lncRNA and mRNA profile comparison between the SLE and healthy groups (n=10 per group). SLE, systemic lupus erythematosus.

Aberrant mRNA expression in PBMCs of SLE

To evaluate the involvement of lncRNAs in transcriptional, epigenetic or posttranscriptional regulation of gene expression, the expression levels of potential target mRNAs of the differentially expressed lncRNA data were predicted. In total, compared with the healthy group, 6,876 mRNAs (2,862 upregulated and 4,014 downregulated) were identified to be differentially expressed (P<0.05). The most markedly deregulated mRNAs were thyroglobulin (fold change up, 329.7330982) and potassium calcium-activated channel subfamily M regulatory beta subunit 3 (fold change down, 5246.5342205).

lncRNA classification and subgroup analysis

According to previous reports, lncRNAs are classified into different subgroups, such as lncRNAs with enhancer-like function (lncRNA-a), antisense lncRNA and lincRNAs (17). Previous studies demonstrated that subgroups, such as lincRNA and enhancer-like lncRNAs are involved in numerous types of disease (18,19). lncRNA-a were identified using GENCODE annotation (16). Further analysis was performed in the current study by classifying and stratifying the lncRNAs into the aforementioned subgroups (17). A total of 847 enhancer-like lncRNAs were identified to be significantly differentially expressed (fold change ≥2.0; P<0.05, data not shown), among which 430 lncRNAs were upregulated and 417 were downregulated in the SLE group, compared with the healthy group. The expression profiles of 1,911 lincRNAs (1,225 of which were upregulated) indicated that they were significantly differentially expressed (fold change ≥2.0; P<0.05, data not shown) between the SLE and healthy groups. Among these, 1,225 were upregulated and 686 were downregulated. It was also identified in antisense lncRNA profiling that 449 antisense lncRNAs (147 upregulated and 302 downregulated) were differentially expressed (fold change ≥2.0; P<0.05, data not shown) between the groups. In addition, certain nearby coding genes may be regulated by these subgroup lncRNAs. Furthermore, 474 matched lncRNA-mRNA pairs were identified for 293 differentially expressed lncRNAs (fold change ≥3.0) and 381 differentially expressed mRNAs (fold change ≥3.0). Among them, 310 pairs were differentially expressed unidirectionally (up or down), while 164 pairs were differentially expressed bidirectionally.

GO and KEGG signaling pathway analysis

Through GO analysis, the downregulated and upregulated transcripts of lncRNAs were identified to be associated with biological processes, cellular components and molecular function. Additionally, the differentially expressed mRNAs between the SLE and healthy groups were significantly enriched in the cellular macromolecule metabolic process, intracellular part, nucleic acid binding, single-multicellular organism process, cell periphery and sequence-specific DNA binding, amongst others (data no shown). Using the latest version of the KEGG database, KEGG pathway analysis was performed to evaluate differentially expressed mRNAs. Pathway analysis determined that these lncRNAs may target 65 gene pathways, including 26 upregulated pathways, for example, ‘Transcriptional misregulation in cancer’ and 39 downregulated pathways, for example, ‘Valine, leucine and isoleucine degradation’ (Fig. 3).

Figure 3.

Pathway analysis of (A) upregulated and (B) downregulated mRNAs in SLE. (A) Twenty-six upregulated pathways were identified, including ‘Transcriptional misregulation in cancer’ and ‘Cytokine-cytokine receptor interaction’. (B) Thirty-nine downregulated pathways were identified, including ‘Valine, leucine and isoleucine degradation’ and ‘Homologous recombination’. mRNA, messenger RNA; SLE, systemic lupus erythematosus; DE, differently expressed.

RT-qPCR validation

In order to verify the reliability of the microarray data, a number of interesting candidate lncRNAs (AK130076.1, CTC-471J1.2 and RP11-875O11.1) and mRNAs [peptidoglycan recognition protein 1 (PGLYRP1), programmed cell death 4 (PDCD4) and phosphatase and tensin homolog (PTEN)] were initially identified for further analysis. The expression levels of these lncRNAs and mRNAs were confirmed by RT-qPCR. The primers are presented in Table I. For the lncRNAs, the results demonstrated that RP11-875O11.1 were upregulated and that CTC-471J1.2 were downregulated in 17 SLE patients relative to the healthy group (all P<0.05; Fig. 4B and C). The expression level of AK130076.1 was not significantly different between SLE patients and healthy control subjects (P>0.05; Fig. 4A). For the mRNAs, the RT-qPCR analysis indicated that the expression levels of PGLYRP1, PDCD4 and PTEN changed significantly between the two groups (P<0.05 for each mRNA; Fig. 4). The results demonstrated that the expression level patterns of RP11-875O11.1, CTC-471J1.2, PGLYRP1, PDCD4 and PTEN were consistent with those obtained by microarray analysis.

Figure 4.

Relative expression levels of lncRNA and mRNA in SLE patients and healthy controls determined by reverse transcription-quantitative polymerase chain reaction. (A) AK130076.1 tends to be downregulated in SLE patients when compared with the healthy group, although the difference was not statistically significant (P=0.23). (B) CTC-471J1.2 was found to be significantly downregulated in SLE patients (P=0.011). (C) RP11-875O11.1 was found to be significantly upregulated in SLE patients (P=0.0014). (D) PGLYRP1 was found to be significantly upregulated in SLE patients (P<0.00010). (E) PDCD4 was found to be significantly downregulated in SLE patients (P=0.0059). (F) PTEN was found to be significantly downregulated in SLE patients (P=0.032). The expression levels of lncRNAs and mRNA were normalized against GAPDH, which served an internal control. The relative expression levels of the genes were calculated using the ΔCq method.

Discussion

SLE, an autoimmune disease, is characterized by aberrant lymphocyte activation. It has a prevalence of 40 cases per 100,000 individuals, with onset typically occurring in women of childbearing age (female:male ratio, 9:1) (20). Current treatment strategies using immunosuppressive drugs and other medications for SLE are effective at reducing morbidity and mortality, but fail to effectively cure the disease (21). However, the pathogenic mechanisms underlying SLE remain largely unknown; therefore, further investigations of SLE are considered to be of great importance.

Evidence from previous research indicated the aberrant expression of lncRNAs in the pathogenesis of SLE (22,23); however, fewer studies have examined the expression profile of lncRNAs in SLE. PBMCs, which include numerous immune cells, are key in host defense, and are used to identify novel disease mediators, disease variants and treatment responses (24–26). PBMCs have been used to discriminate the differences in non-coding RNA (microRNAs) profiles in SLE using microarray technology (27,28). Therefore, in an attempt to obtain the expression pattern of lncRNAs in SLE, lncRNA microarray technology was used to investigate the lncRNA signatures of 10 SLE patients.

In the present study, a number of differentially expressed mRNAs and lncRNAs were detected in PBMCs of SLE patients to investigate the potential functions of lncRNAs in its pathogenesis. A total of 8,868 lncRNAs (3,657 upregulated and 5,211 downregulated) and 6,876 mRNAs (2,862 upregulated and 4,014 downregulated) were significantly expressed in the SLE group compared with the healthy group. lncRNAs include lincRNAs, intronic lncRNAs, antisense lncRNAs, transcribed pseudogene lncRNAs and eRNAs. lncRNAs function via a variety of mechanisms; however, a common and important function of lncRNAs is to alter nearby encoding gene expression by affecting the process of transcription (29) or directly performing an enhancer-like role (17,30). Wu et al (22) demonstrated that lincRNAs were associated with the pathogenesis of SLE. Furthermore, the results demonstrated that enhancer-like lncRNAs (430 upregulated and 417 downregulated), lincRNAs (1,225 upregulated and 686 downregulated) and antisense lncRNAs (147 upregulated and 302 downregulated) were aberrantly expressed. In addition, results from microarray analysis revealed that these subgroup lncRNAs regulate certain nearby coding genes.

To investigate the potential regulatory roles of lncRNAs, GO category and KEGG pathway annotation were used to analyze the target gene pool. GO and KEGG pathway analyses demonstrated that downregulated and upregulated transcripts of lncRNAs were associated with biological process, cellular components and molecular function, which were associated with 65 gene pathways that corresponded to transcripts, for example, ‘Cytokine-cytokine receptor interaction’, ‘TNF signaling pathway’, ‘MAPK signaling pathway’ and ‘NF-κB signaling pathways’, which indicated that the pathology of SLE is predominantly associated with the regulation of multiple genes. Furthermore, these pathways are associated with the initiation and development of SLE (31,32).

Subsequently, six altered lncRNAs and mRNAs were selected, and their expression levels and the microarray results were assessed via RT-qPCR. The change in mRNA expression level was confirmed to be concordant with the microarray data, while the expression tendency of lncRNA demonstrated a similar trend, although it was not exactly the same. This may be due to the heterogeneity of SLE, differing sample sizes and variation in the sensitivity of the methods performed. Generally, the data from microarray analysis requires confirmation by RT-qPCR, which is considered to be more accurate.

In conclusion, lncRNA and mRNA expression levels were analyzed in PBMCs from SLE samples using microarrays, which revealed a novel and interesting foundation for improving the understanding of the association between lncRNA homeostasis in PBMCs and SLE. However, the findings described in the present study represent a starting point for the investigation of lncRNAs in SLE. Further investigations are required to evaluate the signaling pathways identified in the GO and KEGG analyzes with regard to their role in the development and progression of SLE.

Acknowledgements

The present study was supported by the National Natural Science Foundation of China (grant no. 81360459) and the Jiangxi Provincial Natural Science Foundation of China (grant no. 20151BAB215031). The authors would like to thank Dr Rui Wu at the Department of Rheumatology, The First Affiliated Hospital of Nanchang University (Nanchang, China).

References

1 

Bertsias GK, Salmon JE and Boumpas DT: Therapeutic opportunities in systemic lupus erythematosus: State of the art and prospects for the new decade. Ann Rheum Dis. 69:1603–1611. 2010. View Article : Google Scholar : PubMed/NCBI

2 

Kow NY and Mak A: Costimulatory pathways: Physiology and potential therapeutic manipulation in systemic lupus erythematosus. Clin Dev Immunol. 2013:2459282013. View Article : Google Scholar : PubMed/NCBI

3 

Kirou KA and Gkrouzman E: Anti-interferon alpha treatment in SLE. Clin Immunol. 148:303–312. 2013. View Article : Google Scholar : PubMed/NCBI

4 

Kowalczyk MS, Higgs DR and Gingeras TR: Molecular biology: RNA discrimination. Nature. 482:310–311. 2012. View Article : Google Scholar : PubMed/NCBI

5 

Shirasawa S, Harada H, Furugaki K, Akamizu T, Ishikawa N, Ito K, Ito K, Tamai H, Kuma K, Kubota S, et al: SNPs in the promoter of a B cell-specific antisense transcript, SAS-ZFAT, determine susceptibility to autoimmune thyroid disease. Hum Mol Genet. 13:2221–2231. 2004. View Article : Google Scholar : PubMed/NCBI

6 

Song J, Kim D, Han J, Kim Y, Lee M and Jin EJ: PBMC and exosome-derived Hotair is a critical regulator and potent marker for rheumatoid arthritis. Clin Exp Med. 15:121–126. 2015. View Article : Google Scholar : PubMed/NCBI

7 

Heward JA and Lindsay MA: Long non-coding RNAs in the regulation of the immune response. Trends Immunol. 35:408–419. 2014. View Article : Google Scholar : PubMed/NCBI

8 

Willingham AT, Orth AP, Batalov S, Peters EC, Wen BG, Aza-Blanc P, Hogenesch JB and Schultz PG: A strategy for probing the function of noncoding RNAs finds a repressor of NFAT. Science. 309:1570–1573. 2005. View Article : Google Scholar : PubMed/NCBI

9 

Collier SP, Collins PL, Williams CL, Boothby MR and Aune TM: Cutting edge: Influence of Tmevpg1, a long intergenic noncoding RNA, on the expression of Ifng by Th1 cells. J Immunol. 189:2084–2088. 2012. View Article : Google Scholar : PubMed/NCBI

10 

Li Z, Chao TC, Chang KY, Lin N, Patil VS, Shimizu C, Head SR, Burns JC and Rana TM: The long noncoding RNA THRIL regulates TNFα expression through its interaction with hnRNPL. Proc Natl Acad Sci USA. 111:pp. 1002–1007. 2014; View Article : Google Scholar : PubMed/NCBI

11 

Li B, Tsoi LC, Swindell WR, Gudjonsson JE, Tejasvi T, Johnston A, Ding J, Stuart PE, Xing X, Kochkodan JJ, et al: Transcriptome analysis of psoriasis in a large case-control sample: RNA-seq provides insights into disease mechanisms. J Invest Dermatol. 134:1828–1838. 2014. View Article : Google Scholar : PubMed/NCBI

12 

Liu Q, Zhang X, Dai L, Hu X, Zhu J, Li L, Zhou C and Ao Y: Long noncoding RNA related to cartilage injury promotes chondrocyte extracellular matrix degradation in osteoarthritis. Arthritis Rheumatol. 66:969–978. 2014. View Article : Google Scholar : PubMed/NCBI

13 

Müller N, Döring F, Klapper M, Neumann K, Schulte DM, Türk K, Schröder JO, Zeuner RA, Freitag-Wolf S, Schreiber S and Laudes M: Interleukin-6 and tumour necrosis factor-α differentially regulate lincRNA transcripts in cells of the innate immune system in vivo in human subjects with rheumatoid arthritis. Cytokine. 68:65–68. 2014. View Article : Google Scholar : PubMed/NCBI

14 

Tan EM, Cohen AS, Fries JF, Masi AT, McShane DJ, Rothfield NF, Schaller JG, Talal N and Winchester RJ: The 1982 revised criteria for the classification of systemic lupus erythematosus. Arthritis Rheum. 25:1271–1277. 1982. View Article : Google Scholar : PubMed/NCBI

15 

Tian M, Chen R, Li T and Xiao B: Reduced expression of circRNA hsa_circ_0003159 in gastric cancer and its clinical significance. J Clin Lab Anal. Jun 15–2017.(Epub ahead of print). View Article : Google Scholar

16 

Xu G, Chen J, Pan Q, Huang K, Pan J, Zhang W, Chen J, Yu F, Zhou T and Wang Y: Long noncoding RNA expression profiles of lung adenocarcinoma ascertained by microarray analysis. PLoS One. 9:e1040442014. View Article : Google Scholar : PubMed/NCBI

17 

Ørom UA, Derrien T, Beringer M, Gumireddy K, Gardini A, Bussotti G, Lai F, Zytnicki M, Notredame C, Huang Q, et al: Long noncoding RNAs with enhancer-like function in human cells. Cell. 143:46–58. 2010. View Article : Google Scholar : PubMed/NCBI

18 

Shi X, Sun M, Liu H, Yao Y and Song Y: Long non-coding RNAs: A new frontier in the study of human diseases. Cancer Lett. 339:159–166. 2013. View Article : Google Scholar : PubMed/NCBI

19 

Wan ZY, Song F, Sun Z, Chen YF, Zhang WL, Samartzis D, Ma CJ, Che L, Liu X, Ali MA, et al: Aberrantly expressed long noncoding RNAs in human intervertebral disc degeneration: A microarray related study. Arthritis Res Ther. 16:4652014. View Article : Google Scholar : PubMed/NCBI

20 

Gurevitz SL, Snyder JA, Wessel EK, Frey J and Williamson BA: Systemic lupus erythematosus: A review of the disease and treatment options. Consult Pharm. 28:110–121. 2013. View Article : Google Scholar : PubMed/NCBI

21 

Xiong W and Lahita RG: Pragmatic approaches to therapy for systemic lupus erythematosus. Nat Rev Rheumatol. 10:97–107. 2014. View Article : Google Scholar : PubMed/NCBI

22 

Wu Y, Zhang F, Ma J, Zhang X, Wu L, Qu B, Xia S, Chen S, Tang Y and Shen N: Association of large intergenic noncoding RNA expression with disease activity and organ damage in systemic lupus erythematosus. Arthritis Res Ther. 17:1312015. View Article : Google Scholar : PubMed/NCBI

23 

Zhang F, Wu L, Qian J, Qu B, Xia S, La T, Wu Y, Ma J, Zeng J, Guo Q, et al: Identification of the long noncoding RNA NEAT1 as a novel inflammatory regulator acting through MAPK pathway in human lupus. J Autoimmun. 75:96–104. 2016. View Article : Google Scholar : PubMed/NCBI

24 

Toonen EJ, Barrera P, Radstake TR, van Riel PL, Scheffer H, Franke B and Coenen MJ: Gene expression profiling in rheumatoid arthritis: Current concepts and future directions. Ann Rheum Dis. 67:1663–1669. 2008. View Article : Google Scholar : PubMed/NCBI

25 

Shaffer AL, Wright G, Yang L, Powell J, Ngo V, Lamy L, Lam LT, Davis RE and Staudt LM: A library of gene expression signatures to illuminate normal and pathological lymphoid biology. Immunol Rev. 210:67–85. 2006. View Article : Google Scholar : PubMed/NCBI

26 

Yamagata T, Benoist C and Mathis DA: Shared gene-expression signature in innate-like lymphocytes. Immunol Rev. 210:52–66. 2006. View Article : Google Scholar : PubMed/NCBI

27 

Te JL, Dozmorov IM, Guthridge JM, Nguyen KL, Cavett JW, Kelly JA, Bruner GR, Harley JB and Ojwang JO: Identification of unique microRNA signature associated with lupus nephritis. PLoS One. 5:e103442010. View Article : Google Scholar : PubMed/NCBI

28 

Liu D, Zhao H, Zhao S and Wang X: MicroRNA expression profiles of peripheral blood mononuclear cells in patients with systemic lupus erythematosus. Acta Histochem. 116:891–897. 2014. View Article : Google Scholar : PubMed/NCBI

29 

Mattick JS and Gagen MJ: The evolution of controlled multitasked gene networks: The role of introns and other noncoding RNAs in the development of complex organisms. Mol Biol Evol. 18:1611–1630. 2001. View Article : Google Scholar : PubMed/NCBI

30 

Mattick JS: Lincing long noncoding RNAs and enhancer function. Dev Cell. 19:485–486. 2010. View Article : Google Scholar : PubMed/NCBI

31 

Yougbaré I, Boire G, Roy M, Lugnier C and Rouseau E: NCS 613 exhibits anti-inflammatory effects on PBMCs from lupus patients by inhibiting p38 MAPK and NF-κB signalling pathways while reducing proinflammatory cytokine production. Can J Physiol Pharmacol. 91:353–361. 2013. View Article : Google Scholar : PubMed/NCBI

32 

Zhu LJ, Landolt-Marticorena C, Li T, Yang X, Yu XQ, Gladman DD, Urowitz MB, Fortin PR and Wither JE: Altered expression of TNF-alpha signaling pathway proteins in systemic lupus erythematosus. J Rheumatol. 37:1658–1666. 2010. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Luo Q, Li X, Xu C, Zeng L, Ye J, Guo Y, Huang Z and Li J: Integrative analysis of long non-coding RNAs and messenger RNA expression profiles in systemic lupus erythematosus. Mol Med Rep 17: 3489-3496, 2018.
APA
Luo, Q., Li, X., Xu, C., Zeng, L., Ye, J., Guo, Y. ... Li, J. (2018). Integrative analysis of long non-coding RNAs and messenger RNA expression profiles in systemic lupus erythematosus. Molecular Medicine Reports, 17, 3489-3496. https://doi.org/10.3892/mmr.2017.8344
MLA
Luo, Q., Li, X., Xu, C., Zeng, L., Ye, J., Guo, Y., Huang, Z., Li, J."Integrative analysis of long non-coding RNAs and messenger RNA expression profiles in systemic lupus erythematosus". Molecular Medicine Reports 17.3 (2018): 3489-3496.
Chicago
Luo, Q., Li, X., Xu, C., Zeng, L., Ye, J., Guo, Y., Huang, Z., Li, J."Integrative analysis of long non-coding RNAs and messenger RNA expression profiles in systemic lupus erythematosus". Molecular Medicine Reports 17, no. 3 (2018): 3489-3496. https://doi.org/10.3892/mmr.2017.8344
Copy and paste a formatted citation
x
Spandidos Publications style
Luo Q, Li X, Xu C, Zeng L, Ye J, Guo Y, Huang Z and Li J: Integrative analysis of long non-coding RNAs and messenger RNA expression profiles in systemic lupus erythematosus. Mol Med Rep 17: 3489-3496, 2018.
APA
Luo, Q., Li, X., Xu, C., Zeng, L., Ye, J., Guo, Y. ... Li, J. (2018). Integrative analysis of long non-coding RNAs and messenger RNA expression profiles in systemic lupus erythematosus. Molecular Medicine Reports, 17, 3489-3496. https://doi.org/10.3892/mmr.2017.8344
MLA
Luo, Q., Li, X., Xu, C., Zeng, L., Ye, J., Guo, Y., Huang, Z., Li, J."Integrative analysis of long non-coding RNAs and messenger RNA expression profiles in systemic lupus erythematosus". Molecular Medicine Reports 17.3 (2018): 3489-3496.
Chicago
Luo, Q., Li, X., Xu, C., Zeng, L., Ye, J., Guo, Y., Huang, Z., Li, J."Integrative analysis of long non-coding RNAs and messenger RNA expression profiles in systemic lupus erythematosus". Molecular Medicine Reports 17, no. 3 (2018): 3489-3496. https://doi.org/10.3892/mmr.2017.8344
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team