Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
2014-January Volume 9 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
2014-January Volume 9 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Microarray‑based identification of nerve growth‑promoting genes in neurofibromatosis type I

  • Authors:
    • Yufei Liu
    • Dong Kang
    • Chunyan Li
    • Guang Xu
    • Yan Tan
    • Jinhong Wang
  • View Affiliations / Copyright

    Affiliations: Department of Pediatric Intensive Care Unit, The First Affiliated Hospital of Jilin University, Changchun, Jilin 130000, P.R. China, Huiqiao Department, South Hospital of Southern Medical University, Guangdong 510630, P.R. China, Department of Pediatric Respiratory Diseases, The First Affiliated Hospital of Jilin University, Changchun, Jilin 130000, P.R. China, Department of Infectious Diseases, The First Affiliated Hospital of Jilin University, Changchun, Jilin 130000, P.R. China, Cancer Biotherapy Center, People's Hospital of Jilin Province, Changchun, Jilin 130000, P.R. China, Department of Respiratory, The Third Affiliated Hospital of Southern Medical University, Guangzhou, Guangdong 510630, P.R. China
  • Pages: 192-196
    |
    Published online on: November 8, 2013
       https://doi.org/10.3892/mmr.2013.1785
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

As a genetic disease, neurofibromatosis type 1 (NF1) is characterized by abnormalities in multiple tissues derived from the neural crest, including neoplasms in the ends of the limbs. The exact mechanism of nerve growth in NF1 is unclear. In the present study, the gene expression profile of nerves in healthy controls and NF1 patients with macrodactylia of the fingers or toes were analyzed in order to identify possible genes associated with nerve growth. The Whole Human Genome Microarray was selected to screen for different gene expression profiles, and the result was analyzed with Feature Extraction software. The target genes were verified at the transcriptional and translational levels by reverse transcription‑polymerase chain reaction and western blotting, respectively. A common set of 28 genes were identified to be changed >5‑fold in the NF1 patients compared with the healthy controls. Among them, the metastasis‑associated genes, lymphocyte function‑associated antigen 1, C‑X‑C chemokine receptor type 4 and intracellular adhesion molecule 1, and the inflammatory cytokines, interleukin (IL) 1β, IL‑6 and IL‑8, were downregulated significantly. Mainly genes that changed >10‑fold were analyzed in this study, and HOXC8 demonstrated activity in promoting nerve growth. Through the analysis of the mRNA expression of the nerves in the NF1 patients, target molecules contributing to nerve growth during NF1 development were investigated, which aided in improving our understanding of this disease, and may provide a novel direction for nerve repair and regeneration.

Introduction

Neurofibromatosis is characterized by café-au-lait spots, iris Lisch nodules and cutaneous or subcutaneous skin tumors termedneurofibromas (1). This disease may cause tissue along the nerves to grow uncontrollably, inducing serious damage by compressing the nerves. Two types of neurofibromatosis, type 1 (NF1) and type 2 (NF2), have been distinguished and genetically mapped to different loci, namely chromosomes 17q11.2 and 22q112 (2). NF1 predominates in neurofibromatosis patients (~98%), while NF2 comprises 2% of this population and is reported as a more rare disease (1:35,000) (3).

NF1 occurs in ~1 out of 3,500 births (4) and is defined as an autosomal dominant genetic disorder correlated with point mutations or gross deletions of the NF1 gene (5). Neoplasms in the ends of the limbs are one symptom of NF1. Although uncommon, NF1 patients may exhibit macrodactylia of the fingers or toes accompanied by the proliferation of the vessels, phalanges and subcutaneous fat (6). The exact cellular genes that participate in nerve growth in NF1 patients remain unclear.

In the present study, abnormal bulky terminal nerves were obtained from three diagnosed NF1 patients, and the expression profiles of nerves in the NF1 patients and normal controls were analyzed by microarray analysis. The genes likely to be involved in promoting nerve growth were also identified.

Materials and methods

Patients and tissues

Three confirmed NF1 patients (male; age, 20–30 years), with macrodactylia of the fingers or toes, and five healthy controls were recruited from the Department of General Surgery at The Third Affiliated Hospital of Southern Medical University (Guangzhou, China) between 2009 and 2011. The healthy controls all underwent amputations due to car accidents or fires. None of the patients and healthy controls were suffering from systemic disorders or viral infections. The nerve tissues of the two groups were separated during surgery. Subsequent to splitting them into small sections, the tissues were powdered in liquid nitrogen and the samples were kept refrigerated at −80°C. All study participants provided written informed consent and the study was approved by the Ethics Committee of Jilin University (Changchun, China).

Microarray analysis

RNA was extracted using the RNeasy mini kit (Qiagen, Hilden, Germany). Aliquots of the RNA were analyzed by a Bioanalyser 2100 (Agilent Technologies, Santa Clara, CA, USA) and quantified by a Nano Drop ND-1000 (Labtech International, Uckfield, UK). The Whole Human Genome Microarray (Agilent Technologies) was selected to screen for the expression profiles of the different genes in the NF1 patients and healthy controls. Following hybridization, the microarrays were scanned in the Agilent Microarray Scanner, analyzed with the Feature Extraction software and the raw data were normalized by the Quantile Algorithm. To control the false discovery rate, the Q-value of all genes used in this analysis was assessed using Q<0.05.

Cell culture

PC12 rat pheochromocytoma cells were initially obtained from the American Type Culture Collection (Manassas, VA, USA) and cultured in RPMI-1640 supplemented with 10% (v/v) fetal calf serum, cultivated at 37°C in a 5% CO2 incubator. At 70–90% confluency, the cells (2.5×105) were seeded onto 12-well plates (Iwaki, Tokyo, Japan). Following a 24-h incubation, differentiation was induced by adding 50 ng/ml nerve growth factor (NGF; Chemicon, Temecula, CA, USA) (7). The medium was changed every two days. Following a 96-h incubation, the PC12 cells were transformed into neuronal-like cells.

RNA extraction and RT-PCR

The PC12 cells were harvested following differentiation and the total RNA was isolated using TRIzol (Invitrogen Life Technologies, Carlsbad, CA, USA) according to the manufacturer’s instructions. The RNA pellets were stored in sterile ribonuclease-free water. Reverse transcription was conducted using 1 μg total RNA, 0.5 μg oligo(dT) and Superscript II enzyme (Gibco, Carlsbad, CA, USA). To check the relative mRNA levels, the primers shown in Table I were used.

Table I

Primers for checking relative mRNA levels.

Table I

Primers for checking relative mRNA levels.

PrimerSequenceLength, bp
ACSBG1Forward: ACGCCATCATTGACACCC
Reverse: CGTAGCCCGCATACAAGC
630
ADAMTS4Forward: AGGTCCCATGTGCAACG
Reverse: TGGAGCCTCTGGTTTGTCT
724
DGKBForward: GGACCATATTTTACCACC
Reverse: AACTTCCACCTGTCCAAC
600
FPR1Forward: TCTCCCCACGAACATCTC
Reverse: TTGTGGATCTTGGTGGC
672
HIF3αForward: CAGTAGCAGCCACTCCCAG
Reverse: CAGGGGCTCATTCAGGTT
635
HOXC8Forward: CTGTTCTCCAAATACAAAGCCG
Reverse: CTTCTTCCTCCACCTTCTCCTC
652
IL1βForward: GCTTATTACAGTGGCAATGAGG
Reverse: GGATCTACACTCTCCAGCTGTAGAG
572
MMP9Forward: CTCCAGAAGCAACTGTCCC
Reverse: CCATCAGCATTGCCGTC
635
RCAN1Forward: GTGGCCGGTCCCCAG
Reverse: TTGGCTTAGGTCTCCTCATTCT
697
SLC11A1Forward: CCACGACTACGCCAAGAT
Reverse: AAGGAGCCCATACAGGAAG
640

[i] ACSBG1, acyl-CoA synthetase bubblegum family member 1; ADAMTS4, a disinterin and metalloproteinase with thrombospondin motifs 4; DGKB, diacylglycerol kinase; FPR1, formyl peptide receptor 1; HIF3α, hypoxia inducible factor 3α; IL1β, interleukin 1β; MMP9, matrix metallopeptidase 9; RCAN1, regulator of calcineurin 1; SLC11A1, solute family carrier 11.

Western blotting

The cells were harvested by trypsinization, lysed in RIPA buffer (Aidlab, Beijing, China) on ice for 30 mins and then centrifuged (Eppendorf, Hamburg, Germany) at 4°C and 12,000 × g for 10 mins. The whole cell lysate was subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred onto polyvinylidene difluoride membranes (Amersham Life Sciences, Arlington Heights, IL, USA). The membranes were incubated with 5% skimmed dry milk and then with polyclonal goat anti-human primary antibodies [GAPDH, acyl-CoA synthetase bubblegum family member 1 (ACSBG1), hypoxia inducible factor 3α (HIF3α) and HOXC8; Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA]. Following washing with phosphate-buffered saline with Tween 20 (PBST), the membranes were incubated with horseradish peroxidase-conjugated mouse anti-goat IgG (Santa Cruz Biotechnology Inc.). The immunoreactivity was visualized with the enhanced chemiluminescence system (ECL; Amersham Life Sciences).

Statistical analysis

Statistical analyses were performed using the Stat View software (SAS Institute, Inc., Cary, NC, USA). P<0.05 was considered to indicate a statistically significant difference. Microarray analyses were analyzed with Feature Extraction software 10.7 and the raw data were normalized by the Quantile Algorithm, Gene Spring Software 11.0 (Agilent Technologies). Student’s t-tests were used to identify the differentially-expressed genes.

Results

Differential gene expression profiles in three NF1 patients

To investigate the etiology of nerve growth in the NF1 patients, the genes that shared the same change trends in the NF1 patients were analyzed to try to explain their similar phenotypes, particularly nerve hyperplasia, vessel overgrowth and subcutaneous fat generation. Various genes were compared between each NF1 patient and the healthy controls. From nearly 30,000 genes, 132, 144 and 158 genes were identified to have significant changes (P<0.01) in the three NF1 patients, respectively. A common set of 61 genes exhibited the same trend in the three patients, and among these, 28 genes changed markedly >5-fold. Gene ontology (GO) analysis revealed that genes associated with DNA/protein binding represented the largest proportion (48%) of the total number of different genes (Fig. 1), while others involved in regulating molecular transduction (23%) and catalysis (18%) also represented a high percentage.

Figure 1

Gene expression profile analysis of patients with NF1. (A) Hierarchical clustering analysis of genes associated with NF1. The red color represents the upregulated genes and the green color represents the downregulated genes. (B) Gene ontology enrichment analysis of differentially expressed genes between the NF1 patients and controls. NF1; neurofibromatosis type 1.

Confirmation of possible genes in regulating nerve overgrowth of NF1
Transcriptional level

Of the 28 evidently changed genes, the metastasis-associated genes, lymphocyte function-associated antigen 1 (LFA1), C-X-C chemokine receptor type 4 (CXCR4) and intracellular adhesion molecule 1 (ICAM1), and the inflammatory cytokines, interleukin (IL)1β, IL6 and IL8, were generally expressed at a low level, and the genes involved in the cell cycle, cyclin-dependent kinase 4 inhibitor, cyclin dependent kinase 4 and Serine/threonine-protein kinase 1, and apoptosis, LMNB1, BIRC3 and FOSL1, were also significantly downregulated. It is noteworthy that >75% of these genes were downregulated, and that the majority of them were confirmed to be significant in promoting tumor proliferation and metastasis. Thus, the mechanism of the abnormal overgrowth of the nerves, including the vessels, phalanges and subcutaneous fat around the vessels, in NF1 patients varied from that of cancer tissues. To identify the main factors that affect nerve growth, genes that were up- or downregulated >10-fold change were investigated. The screened genes are listed in Table II. The levels of mRNA expression of these genes are shown in Fig. 2.

Figure 2

mRNA expression levels of possible genes related with NF1 development. PC12 cells were induced to differentiate using NGF. Following 96 h of induction, the cells were harvested and the total RNA isolated. The 10 genes that changed >10-fold were analyzed, including the calcium ions channel-related factors, FPR1, RCAN1 and DGKB, the inflammatory-related cytokines, IL1β and SLC11A1, the matrix-degrading genes, ADAMTS4 and MMP9, the transcription modulators, HIF3α and HOXC8, and the metabolism-related factor, ACSBG1. The expression levels were determined with GAPDH as a reference. ACSBG1, HIF3α and HOXC8 genes showed evident upregulation within the differentiation of the PC12 cells (*P<0.05). NF1; neurofibromatosis type 1, NGF; nerve growth factor; ADAMTS4, a disinterin and metalloproteinase with thrombospondin motifs 4; ACSBG1, acyl-CoA synthetase bubblegum family member 1; HIF3α, hypoxia inducible factor 3α; DGKB, diacylglycerol kinase; MMP9, matrix metallopeptidase 9; FPR1, formyl peptide receptor 1; RCAN1, regulator of calcineurin 1; SLC11A1, solute family carrier 11; IL1β, interleukin 1β.

Table II

Genes upregulated >10-fold and their corresponding functions.

Table II

Genes upregulated >10-fold and their corresponding functions.

Probe IDGeneChromosome No.Fold change in NF1Gene function
1660497ADAMTS410.052Metalloproteases; inflammation-related
1030270FPR1190.0674Inflammation-related; interacting with calcium ions
620239RCAN1210.0685Inhibit calcineurin-dependent pathways
840685IL1β20.074Inflamatory cytokine
5390220MMP9160.0825Degradation of the extracellular matrix
780465SLC11A120.0828Divalent transition metal transporter; immunological response-related
4640059HOXC81210.531Modulates the frequency of transcription
4540192DGKB710.4188Interacting with calcium ions; associated with glucose metabolism
1110520HIF3α1912.637Modulate transcription; responsor of lowered oxygen tension
2480730ACSBG11514.536Related to metabolic processes of fatty acids

[i] ADAMTS4, a disinterin and metalloproteinase with thrombospondin motifs 4; FPR1, formyl peptide receptor 1; RCAN1, regulator of calcineurin 1; IL1β, interleukin 1β; MMP9, matrix metallopeptidase 9; SLC11A1, solute family carrier 11; DGKB, diacylglycerol kinase; HIF3α, hypoxia inducible factor 3α; ACSBG1, acyl-CoA synthetase bubblegum family member 1.

Protein level

To determine whether the screened genes that changed at the transcriptional level were also altered at the protein level, the expression of ACSBG1, hHIF3α and HOXC8, which possessed statistical significant changes in mRNA expression was analyzed. By inducing PC12 cells to differentiate into neuron-like cells that were characterized by axon growth, HOXC8 was identified to be upregulated during the process of PC12 differentiation (Fig. 3). This implies that HOXC8 may be involved in promoting nerve growth in NF1.

Figure 3

Chromosomal localization of genes that changed >5-fold in the NF1 patients. The data showed that the majority of the various genes were located on chromosome 1, 2, 12, 17 and 19, and were particularly focused on chromosome 1 and 19, which affected the development of the nerve system and genetic disease. NF1; neurofibromatosis type 1; ACSBG1, acyl-CoA synthetase bubblegum family member 1; HIF3α, hypoxia inducible factor 3α; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.

Location analysis of altered genes

The common locations of genes that shared the same change trend in the three patients were clarified in this study. The results revealed that genes located on chromosomes 1, 2, 12, 17 and 19 possessed the most marked changes in the NF1 patients. The genes on chromosomes 1 and 19 in particular indicated potential gene clusters associated with the nerve growth abnormalities. The chromosomal localization was displayed as shown in Fig. 4.

Figure 4

Confirmation of the target protein expression in the PC12 cells. The cells were harvested 96 h after the PC12 cells were induced by NGF. The protein expression of ACSBG1, HIF3α and HOXC8 was determined, and the expression of HOXC8 was shown to be upregulated following differentiation. This result indicated that HOXC8 may participate in promoting nerve growth in NF1 patients. NF1; neurofibromatosis type 1; ACSBG1, acyl-CoA synthetase bubblegum family member 1; HIF3α, hypoxia inducible factor 3α.

Discussion

Although NF1 has attracted attention for a long period of time, the pathogenetic mechanism and intracellular factors involved in nerve growth during NF1 development remain unclear. In the present study, comparisons of gene expression profiles between NF1 and healthy controls were investigated by microarray analysis. A total of 132, 144 and 158 genes from the nerve tissues of the three NF1 patients showed statistically significant changes, respectively, and among these genes, downregulated genes accounted for >70% in each patient. A total of 28 genes that changed >5-fold showed the same trend in all the NF1 patients, including the intracellular protein binding mediators, CXCR4, ICAM1, integrin αX, LFA1 and major facilitator superfamily domain containing 6, involved in matrix degradation and metastasis (8), and the inflammatory related factors, IL1β, IL6 and IL8, involved in regulating the extracellular microenvironment, angiogenesis and tumorigenesis (9). The general downregulation of the tumor-stimulating factors indicated negative regulation of the immune system and of tumor spreading, which may explain why NF1 has always been considered to be a benign tumor that is less likely to become malignant.

To confirm the most likely genes contributing to the effects on nerve growth in NF1 patients, genes that changed up to 10-fold, including the calcium related factors, formyl peptide receptor 1 (FPR1), regulator of calcineurin 1 (RCAN1) and diacylglycerol kinase, the inflammatory cytokines, IL1β and solute family carrier 11, the matrix-degrading genes, a disinterin and metalloproteinase with thrombospondin motifs 4 and matrix metallopeptidase, the transcription modulators, HIF3α and HOXC8, and the metabolism-related factor, ACSBG1, were investigated. With the exception of the inflammatory cytokines and the matrix-degrading genes, which have been reported to be involved in tumor proliferation and metastasis, FPR1 and RCAN1 are expressed in malignant cancers (10–12). The marked downregulation of these genes once again provided evidence that inflammation and basement membrane degradation are suppressed in NF1 patients, which may reduce the risk of tumor metastasis. HIF3α acts as a negative regulator of hypoxia, so it may induce the tolerance of the extracellular environment (13). Whether HIF3α is involved in promoting nerve growth remains to be verified. HOXC8 is an essential factor in oncogenesis and tumor metastasis. HOXC8 is downregulated in esophageal and prostate cancers (14), but significantly elevated in metastatic breast cancer cells (15). The complex function of HOXC8 may indicate a temporal role for HOXC8 in tumor progression. To confirm the screened genes that regulate nerve overgrowth, the ACSBG1, HIF3α and HOXC8 genes that changed markedly at the transcriptional level were checked. The results indicated that HOXC8 exhibited a positive correlation with the differentiation of the PC12 cells, thus it may be a potential stimulating factor involved in nerve axon growth.

The chromosomal localization of genes exhibiting a >5-fold change was also analyzed. This confirmed that genes located on chromosome 1, which affect nerve system development (16), and on chromosome 19, which usually associate with genetic diseases (17), were mainly correlated with the development of NF1. The key cluster of genes that stimulate nerve growth on chromosomes 1 and 19 require identification in future studies.

In conclusion, the etiology of NF1 is complicated and results from changes in multiple genes. Therefore, the identification of such genes is essential in order to explain NF1 formation, metastasis and recurrence. Through large-scale microarray analysis of NF1 patients, possible genes that contribute to the promotion of nerve growth during NF1 development were investigated, which may deepen our understanding of NF1 and provide a novel direction for the research into nerve repair and regeneration.

Acknowledgements

The authors are grateful to the staff of the Department of General Surgery of The Third Affiliated Hospital of Southern Medical University. This study was supported by a grant from the Key Supporting Project of the Jilin Provincial Science and Technology Department (grant no. 20110456).

References

1 

Lammert M, Friedman JM, Kluwe L and Mautner VF: Prevalence of neurofibromatosis 1 in German children at elementary school enrollment. Arch Dermatol. 141:71–74. 2005. View Article : Google Scholar : PubMed/NCBI

2 

Bausch B, Borozdin W, Mautner VF, et al; European-American Phaeochromocytoma Registry Study Group. Germline NF1 mutational spectra and loss-of-heterozygosity analyses in patients with pheochromocytoma and neurofibromatosis type 1. J Clin Endocrinol Metab. 92:2784–2792. 2007. View Article : Google Scholar : PubMed/NCBI

3 

Evans DG, Huson SM, Donnai D, et al: A genetic study of type 2 neurofibromatosis in the United Kingdom. I Prevalence, mutation rate, fitness, and confirmation of maternal transmission effect on severity. J Med Genet. 29:841–846. 1992. View Article : Google Scholar : PubMed/NCBI

4 

Rasmussen SA and Friedman JM: NF1 gene and neurofibromatosis 1. Am J Epidemiol. 151:33–40. 2000. View Article : Google Scholar : PubMed/NCBI

5 

Bottillo I, Ahlquist T, Brekke H, et al: Germline and somatic NF1 mutations in sporadic and NF1-associated malignant peripheral nerve sheath tumours. J Pathol. 217:693–701. 2009. View Article : Google Scholar : PubMed/NCBI

6 

Jouhilahti EM, Peltonen S, Heape AM and Peltonen J: The pathoetiology of neurofibromatosis 1. Am J Pathol. 178:1932–1939. 2011. View Article : Google Scholar : PubMed/NCBI

7 

Nishimura T, Ishima T, Iyo M and Hashimoto K: Potentiation of nerve growth factor-induced neurite outgrowth by fluvoxamine: role of sigma-1 receptors, IP3 receptors and cellular signaling pathways. PLoS One. 3:e25582008. View Article : Google Scholar

8 

Albini A and Sporn MB: The tumour microenvironment as a target for chemoprevention. Nat Rev Cancer. 7:139–147. 2007. View Article : Google Scholar : PubMed/NCBI

9 

de Visser KE, Eichten A and Coussens LM: Paradoxical roles of the immune system during cancer development. Nat Rev Cancer. 6:24–37. 2006.

10 

Rescher U, Danielczyk A, Markoff A and Gerke V: Functional activation of the formyl peptide receptor by a new endogenous ligand in human lung A549 cells. J Immunol. 169:1500–1504. 2002. View Article : Google Scholar : PubMed/NCBI

11 

Kim SS and Seo SR: The regulator of calcineurin 1 (RCAN1/DSCR1) activates the cAMP response element-binding protein (CREB) pathway. J Biol Chem. 286:37841–37848. 2011. View Article : Google Scholar : PubMed/NCBI

12 

Blanco-Mezquita T, Martinez-Garcia C, Proença R, et al: Nerve growth factor promotes corneal epithelial migration by enhancing expression of matrix metalloprotease-9. Invest Ophthalmol Vis Sci. 54:3880–3890. 2013. View Article : Google Scholar : PubMed/NCBI

13 

Augstein A, Poitz DM, Braun-Dullaeus RC, Strasser RH and Schmeisser A: Cell-specific and hypoxia-dependent regulation of human HIF-3α: inhibition of the expression of HIF target genes in vascular cells. Cell Mol Life Sci. 68:2627–2642. 2011.PubMed/NCBI

14 

Miller GJ, Miller HL, van Bokhoven A, Lambert JR, Werahera PN, Schirripa O, et al: Aberrant HOXC expression accompanies the malignant phenotype in human prostate. Cancer Res. 63:5879–5888. 2003.PubMed/NCBI

15 

Li Y, Zhang M, Chen H, Dong Z, Ganapathy V, Thangaraju M and Huang S: Ratio of miR-196s to HOXC8 messenger RNA correlates with breast cancer cell migration and metastasis. Cancer Res. 70:7894–904. 2010. View Article : Google Scholar : PubMed/NCBI

16 

Garlow SJ, Boone E, Kinkead B and Nemeroff CB: Genetic analysis of the hypothalamic neurotensin system. Neuropsychopharmacology. 31:535–543. 2006. View Article : Google Scholar : PubMed/NCBI

17 

Grimwood J, Gordon LA, Olsen A, et al: The DNA sequence and biology of human chromosome 19. Nature. 428:529–535. 2004. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Liu Y, Kang D, Li C, Xu G, Tan Y and Wang J: Microarray‑based identification of nerve growth‑promoting genes in neurofibromatosis type I. Mol Med Rep 9: 192-196, 2014.
APA
Liu, Y., Kang, D., Li, C., Xu, G., Tan, Y., & Wang, J. (2014). Microarray‑based identification of nerve growth‑promoting genes in neurofibromatosis type I. Molecular Medicine Reports, 9, 192-196. https://doi.org/10.3892/mmr.2013.1785
MLA
Liu, Y., Kang, D., Li, C., Xu, G., Tan, Y., Wang, J."Microarray‑based identification of nerve growth‑promoting genes in neurofibromatosis type I". Molecular Medicine Reports 9.1 (2014): 192-196.
Chicago
Liu, Y., Kang, D., Li, C., Xu, G., Tan, Y., Wang, J."Microarray‑based identification of nerve growth‑promoting genes in neurofibromatosis type I". Molecular Medicine Reports 9, no. 1 (2014): 192-196. https://doi.org/10.3892/mmr.2013.1785
Copy and paste a formatted citation
x
Spandidos Publications style
Liu Y, Kang D, Li C, Xu G, Tan Y and Wang J: Microarray‑based identification of nerve growth‑promoting genes in neurofibromatosis type I. Mol Med Rep 9: 192-196, 2014.
APA
Liu, Y., Kang, D., Li, C., Xu, G., Tan, Y., & Wang, J. (2014). Microarray‑based identification of nerve growth‑promoting genes in neurofibromatosis type I. Molecular Medicine Reports, 9, 192-196. https://doi.org/10.3892/mmr.2013.1785
MLA
Liu, Y., Kang, D., Li, C., Xu, G., Tan, Y., Wang, J."Microarray‑based identification of nerve growth‑promoting genes in neurofibromatosis type I". Molecular Medicine Reports 9.1 (2014): 192-196.
Chicago
Liu, Y., Kang, D., Li, C., Xu, G., Tan, Y., Wang, J."Microarray‑based identification of nerve growth‑promoting genes in neurofibromatosis type I". Molecular Medicine Reports 9, no. 1 (2014): 192-196. https://doi.org/10.3892/mmr.2013.1785
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team