Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
May-2014 Volume 9 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
May-2014 Volume 9 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Human heat shock protein 27 exacerbates ischemia reperfusion injury in rats by reducing the number of T regulatory cells

  • Authors:
    • Sunyi Ye
    • Chenxi Zhang
    • Jie Zhou
    • Jun Cheng
    • Zhen Lv
    • Lin Zhou
    • Haiyang Xie
    • Jian Wu
    • Shusen Zheng
  • View Affiliations / Copyright

    Affiliations: Division of Hepatobiliary and Pancreatic Surgery, Department of Surgery, First Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou, Zhejiang 310003, P.R. China, Key Laboratory of Combined Multi‑Organ Transplantation, Ministry of Public Health, Hangzhou, Zhejiang 310003, P.R. China
  • Pages: 1998-2002
    |
    Published online on: March 10, 2014
       https://doi.org/10.3892/mmr.2014.2032
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Ischemia reperfusion injury (IRI) occurs in almost every liver surgery and is associated with the reduction of the liver blood flow. Ischemia impairs liver function and can even cause liver failure following surgery. The present study aimed to identify a new molecular target allowing the reduction of IRI and explore the related cellular mechanism. Adenovirus (~2.5x1012 viral particles) bearing the human heat shock protein 27 (HSP27) gene was injected into rat liver through the ileocecal vein. Five days following the injection, ischemia was induced by clamping the median and left portal veins, hepatic arteries and bile ducts. The levels of alanine transaminase (ALT), aspartate aminotransferase (AST), glutathione (GSH) and superoxide dismutase (SOD) were measured. The infiltration of inflammatory cells and the expression of pro‑inflammatory factors were investigated. The number of regulatory T cells (Tregs) was measured by flow cytometry. At 2 h following reperfusion, the group injected with HSP27 had the highest level of ALT and AST, followed by the group injected with HSP27 and treated with gadolinium trichloride (GdCl3), the empty vector-injected and the vector+GdCl3 groups. The HSP27 group also had the lowest levels of the oxidative stress‑protective factors SOD and GSH, and the highest levels of pro‑inflammatory factors. The number of Tregs was reduced in the groups injected with HSP27. In conclusion, the human HSP27 protein can effectively accelerate liver damage at the early stages of IRI in rats. Tregs might play a critical role in HSP27‑induced liver injury.

Introduction

Ischemia reperfusion injury (IRI) is a common complication observed in patients who undergo liver resection or transplantation, or suffer from toxic liver injury and veno-occlusive diseases (1,2). It is the major cause of the increasing mortality reported after liver injury, as it is linked with kidney, lung and other organs (3). Previous studies proposed that the excessive inflammatory response potentiated by the immune system is responsible for IRI (4,5). Free radicals, interleukins and other inflammatory factors are released and cause damage to the local tissue. Therefore, inhibition of the inflammatory response may reduce IRI damage (6,7). Numerous protective strategies against IRI have been adopted, including therapeutic hypothermia and ischemic preconditioning (8). However, few of them focus on the role of regulatory T cells (Tregs) during the process of liver IRI.

Tregs are a subpopulation of T cells that plays a critical role in the modulation of the immune system and of self-tolerance (9). Specifically, Tregs suppress immune responses mediated by other cell types, and in order to increase the immune response, they are downregulated during infection. It was shown that Tregs ameliorate kidney injury caused by IRI (10), an effect that may result from their immunosuppressive ability. Heat shock proteins (HSPs) are involved in numerous physiological processes, particularly stress. HSP27, a member of the HSP family, is able to mediate cytoskeletal stability and prevent cell apoptosis (11). Although in a recent study, the use of HSP27 proved to be helpful for tumor detection and diagnosis (12), our understanding of the roles of human HSP27 on reperfusion injury, particularly with regards to cell and tissue protection, is limited. A few studies on animal models showed that HSP27 confers protection from reperfusion injury (13,14). Chen et al (15) reported that mice overexpressing human HSP27 are protected from IRI. However, how the immune system affects IRI remains unclear. This study aimed to explore the interaction of HSP27 with Tregs and its effect on IRI.

Materials and methods

Animal procedures

Male Wistar rats (body weight, 200–230 g) were purchased from the Shanghai Animal Center (Chinese Academy of Science, Shanghai, China). The rats were kept in standard animal care conditions and bred with rat chow and water. These procedures were approved by the Animal Care Committee of the Zhejiang University, in accordance with the Principles of Laboratory Animal Care (NIH publication 85-23, revised 1985).

To clone the human HSP27 full length gene (NCBI Reference Sequence: NM_001540.3; open reading frame), HSP27 cDNA were amplified from a HCC cDNA library using the following primers: Forward, ACTGCTCGAGGCCACCATGACCGAGCGCCGCG and reverse, TACTGAATTCTTACTTGGCGGCAGTCTCAT). The PCR product was inserted into the XhoI/EcoRI site of the pIRES2-EGFP vector (Catalog #6029-1; Clontech Laboratories, Inc., Mountain View, CA, USA) and sequenced. Subsequently, HSP27 as well as the vector were packed with adenovirus vector-pAD/CMV/V5-DEST (Shanghai R&S Biotechnology Co., Ltd., Shanghai, China). The human HSP27 gene was synthesized and inserted into the genome of the inactivated adenovirus. The adenovirus was amplified within human embryonic kidney 293 (HEK 293) cells and dissolved in phosphate-buffered saline. Rats received anesthetic (4% chloral hydrate, 0.7 ml/100 g) intraperitoneally, and a midline laparotomy was performed. The ileocecal vein (a branch of the portal vein) was exposed, and 0.5 ml of liquid containing 2.5×1012 viral particles (VP) were injected into the rats via the ileocecal vein. The abdominal cavity was closed with 3-0 silk sutures. Five days later, the abdominal cavity was opened again and the median, left portal vein, hepatic artery and bile ducts were clamped in order to induce partial hepatic ischemia. The right vessels and bile ducts were not impeded, and intestinal congestion was thus avoided. A sixty-minute blockage was considered safe for the animals, since it did not cause severe liver failure or death. One hour later, the clip was removed to initiate hepatic reperfusion. The abdominal cavity was then closed with 3-0 silk sutures.

Animals were placed into 4 groups, all of which shared in common the induction of partial hepatic ischemia/ischemia reperfusion (IR) during the second surgery 5 days later: i) HSP27 group, where adenovirus bearing the HSP27 gene was injected; ii) HSP27+gadolinium trichloride (GdCl3) group, where adenovirus bearing the HSP27 gene was injected along with GdCl3 (Sigma-Aldrich, St. Louis, MO, USA) through the ileocecal vein; iii) vector group, where adenovirus without the HSP27 gene (empty vector) was injected; and iv) vector+GdCl3 group, where GdCl3 was injected along with the empty vector.

All animals were sacrificed at different times after reperfusion (0.5, 2, 4, 12 and 24 h; n=6 in each group per time point).Blood samples were collected from the inferior vena cava of the rats for biochemical examination and flow cytometry. The liver of each rat was harvested, and one part was immediately frozen in liquid nitrogen and stored at −80°C to be further analyzed by quantitative polymerase chain reaction (qPCR), and another part was fixed in formalin for hematoxylin-eosin staining.

Alanine transaminase (ALT), aspartate aminotransferase (AST), glutathione (GSH) and superoxide dismutase (SOD) assays

Blood samples were immediately centrifuged, and serum was collected and stored at −80°C for the ALT and AST assays. A total of 100 μl of each sample was diluted in 500 μl double-distilled water. These dilutions were used to assess ALT and AST using an automated clinical analyzer (7600; Hitachi, Tokyo, Japan). Liver damage was evaluated by measuring the GSH and SOD levels in the liver tissue homogenate using the corresponding commercial kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) according to the manufacturer’s instructions.

Hematoxylin-eosin staining

Explanted rat livers were fixed in 10% formalin for 5 days. After automated dehydration, the samples were embedded in paraffin, sectioned (4 μm) and stained with hematoxylin-eosin. Sections were examined under a light microscope (BX41; Olympus Optical Co., GmbH, Hamburg, Germany).

Flow cytometry

Rat blood was harvested at various time points following reperfusion. Peripheral blood mononuclear cells were isolated using rat lymphocyte separation medium (Borunlaite Science and Technology Co., Ltd., Beijing, China). Following cell surface staining with fluorescein isothiocyanate (FITC)-conjugated anti-rat anti-CD4 and allophycocyanin (APC)-conjugated anti-rat anti-CD25 primary antibodies (eBioscience, San Diego, CA, USA), cells were fixed and permeabilized using Fix & Perm reagents (Caltag Medsystems, Buckingham, UK) according to the manufacturer’s instructions. Cells were then incubated with phycoerythrin (PE)-conjugated anti-mouse/rat anti-forkhead box protein P3 (Foxp3) as the secondary antibody (eBioscience). Stained cells were analyzed using a flow cytometer (FC500; Beckman Coulter, Inc., Brea, CA, USA) and the CellQuest software (BD Biosciences, Franklin Lakes, NJ, USA).

qPCR

We extracted total RNA from each frozen sample using the TRIzol® reagent (Invitrogen Life Technologies, Carlsbad, CA, USA) according to a standard protocol. Complementary DNA (cDNA) was synthesized from the extracted RNAs using Moloney murine leukemia virus reverse transcriptase (Promega Corp., Madison, WI, USA). The following qPCR primers were designed based on the reported DNA sequences: GAPDH (Gene ID: 24383) forward, 5′-GGGCTCTCTGCTCCTCCCTGTTCT and reverse, 5′-GCCGCCTGCTTCACCACCTTC; macrophage inflammatory protein-2 (MIP-2) (Gene ID: 114105) forward, 5′-CCTCCAGCAAGCTCCCTCCTGT and reverse, 5′-GTGGGGTCCTGGAGGGGTCAC; monocyte chemotactic protein-1 (MCP-1) (Gene ID: 24770) forward, 5′-ACAGAGGCCAGCCCAGAAACCA and reverse, 5′-ACAGGCCCAGAAGCGTGACAGA. The PCR reaction was performed in a final volume of 10 μl, containing SYBR-Green PCR Master mix (containing SYBR® Green I dye, AmpliTaq Gold® DNA Polymerase, dNTPs with dUTP, Passive Reference 1 and optimized buffer; Applied Biosystems). The amplifications were conducted in an ABI 7500 Real-Time PCR system (Applied Biosystems, Foster City, CA, USA) with the following thermal cycling conditions: 95°C for 10 min, followed by 40 cycles of 95°C for 15 sec and 60°C for 1 min. GADPH was used as an internal control. Samples were assayed in triplicate. Quantification of the mRNAs from the amplified products was performed using the comparative threshold cycle method as described in the manufacturer’s manual.

Results

Inflammatory infiltration

All rats in this study survived ischemia and reperfusion. Fig. 1 shows hematoxylin-eosin stained liver sections following liver ischemia and reperfusion of the liver for 2 h. Inflammatory cell infiltrations were more severe in the HSP27 group. In the control group, where rats were injected with an empty vector, reduced leukocyte infiltration was observed around the blood vessels. In the vector treated group, there were also fewer inflammatory cells compared to the HSP27 group. The vector+GdCl3 group was the least infiltrated with inflammatory cells.

Figure 1

Inflammatory cells infiltrated the liver 2 h after ischemia and reperfusion. The HSP27 group showed the highest number of inflammatory cells. HSP27, heat shock protein 27; GdCl3, gadolinium trichloride.

Liver injury following IR

We found that the AST level was consistent with the inflammation levels in the different groups. The highest level was observed in the HSP27 group (data not shown). The combination of HSP27 and GdCl3 appeared to protect from IRI compared to the HSP27 group. The liver injury was more severe in the HSP27-injected groups (HSP27 and HSP27+GdCl3) compared to groups injected with the empty vector (vector and vector+GdCl3). HSP27 appeared thus to exacerbate IRI at 2 h following reperfusion. The liver function was best in the vectors+GdCl3 treated group. Twenty four hours after ischemia, AST was still detected at a relatively high level in the vector group, while its level returned to normal in the other three groups. These results indicate that HSP27 might have a certain protective effect at later stages of ischemia.

Assessment of oxidative stress

The antioxidant enzyme SOD, as well as GSH, play an important role in protecting cells from oxidative stress and attenuating the effects of injury. They are crucial for maintaining the balance between reactive oxygen species and antioxidants, which also help prevent damages caused by oxidative stress (16). The depletion of SOD and GSH occurs at the initial phase of liver necrosis (17). The levels of the stress-related markers SOD and GSH were significantly decreased in the HPS27 group compared to the vector+GdCl3 group, indicating that HSP27 may exacerbate reperfusion injury in rats. Overall, the SOD and GSH levels were consistent with the AST level, i.e. the more damaged the liver was, the lower were the SOD and GSH levels.

Amplification of inflammatory factor genes

Fig. 2 shows the changes in expression of pro-inflammatory factors in the four groups of rats following reperfusion. The mRNA levels of genes encoding the vascular cell adhesion protein-1 (VCAM-1), MCP-1 and MIP-2 were increased in rats of the HSP27 group compared with the other groups. These results suggested that HSP27 enhances the inflammatory response in the rat liver following IR.

Figure 2

Expression of inflammation-related factors in the liver 2 h following reperfusion. (A) Macrophage inflammatory protein-2 (MIP-2), (B) vascular cell adhesion protein-1 (VCAM-1) and (C) monocyte chemotactic protein-1 (MCP-1) levels were significantly increased in the heat shock protein 27 (HSP27) group. *P<0.05 vs. HSP27; #P<0.05 vs. HSP27+gadolinium trichloride (GdCl3).

Treg levels in the serum

Fig. 3 shows the levels of Tregs in the different groups after 2 h of IR. Tregs were fewer in number in the HSP27 groups, which might be the cause of the more severe inflammation in these groups. The percentage of Tregs in the serum of rats from the HSP27 group was much lower compared to that observed in the vector and vector+GdCl3 groups. Therefore, HSP27 may suppress Tregs. By contrast, in the groups that were not injected with HSP27, the percentage of Tregs was higher compared to the groups injected with HSP27.

Figure 3

The percentage of regulatory T cells (Tregs) in the peripheral blood of rats from different groups. The number of Tregs was decreased in the groups injected with the heat shock protein 27 (HSP27) gene. *P<0.05 vs. the HSP27 group. GdCl3, gadolinium trichloride.

Discussion

The major finding of our study was that rats overexpressing the HSP27 gene can exacerbate liver injury following IR. This might be partly due to the downregulation of Tregs (Fig. 4). In addition to the regular function of HSP in folding and unfolding proteins, induction of its expression in response to stress has been suggested to be protective for the cells (18,19). A proteomic analysis showed that the blockage of chaperones such as HSP may contribute to increased rates of apoptosis and necrosis (20). Hence, we investigated the roles of HSP in response to hepatocyte injury.

Figure 4

Regulatory T cells (Tregs) play a central role during the period following ischemia and reperfusion. In our study, Tregs were associated with decreased superoxide dismutase (SOD) and glutathione (GSH) levels, increased levels of pro-inflammatory factors and aspartate aminotransferase (AST), as well as with enhanced liver injury.

In this study, we transfected rat hepatocytes with an adenovirus bearing the human HSP27 gene, so that its expression would increase when IRI occurs. We chose to use the human instead of the rat HSP27 gene for two reasons: first, Chen et al (15) showed that overexpressed HSP27 in mice can protect liver from IRI, and we thus aimed to investigate whether the human gene may have a certain protective function in rats as well. Second, in case this proved to be true, we may assume that the human HSP27 protein has a universal protective function in liver IRI, which is very promising for clinical patients who undergo liver surgery.

Although the detailed mechanism leading to IRI has not been fully explored yet, it is widely accepted that several factors contribute to IRI, including free radicals, cytokines and numerous pro-inflammatory factors (21). From this perspective, liver injury following ischemia is initiated by inflammatory infiltration and correlates with the severity of inflammation, and the degree of liver function can be determined by the inflammatory response following reperfusion (4). In the present study, the increase of inflammatory infiltration was corroborated by hematoxylin-eosin staining. We found that inflammation was more severe in the HSP27 group, followed by that observed in the HSP27+GdCl3, vector and vector+GdCl3 groups.

We further investigated liver function following IRI in the different groups. A lower AST level was observed in both groups treated with the empty vector. As inflammatory cells were recruited, the increase in necrosis, apoptosis and other processes of cell death resulted in severe damage of liver cells. Therefore, we conclude that the human HSP27 protein induces inflammation in the rat liver at the early stage of IRI. Nevertheless, the observation that AST remained at a relatively high level in the empty vector group at later stages of IRI, while it was decreased in the other three groups after 24 h, is surprising. This might be due to the fact that the human HSP27 protein contributes to tissue repair at later stages of IRI. HSP27 apart from its role in attacking inflammatory cells at the early stage, might contribute in maintaining the liver structure at later stages; inflammation represents indeed a defense mechanism, protecting the cells from further damage.

Oxygen, free radicals, cytokines and other pro-inflammatory factors are involved in the processes of liver ischemia and reperfusion (22). In the present study, SOD and GSH levels in rat liver tissues of the HSP27 group were lower compared to the vector+GdCl3 group, indicating that HSP27 has an unfavorable antioxidant activity.

Treatment with HPS27 has been associated with decreased expression of transforming growth factor-β (TGF-β). The cytokine TGF-β is important for the assembly of liver cells and promotes growth of hepatocytes (23,24). In our study, overexpression of the human HSP27 gene in rat liver was associated with a decrease in the level of the TGF-β mRNA, suggesting that HSP27 has a negative role in liver protection at the early stage of IRI. The increased mRNA expression of pro-inflammatory factors such as VCAM-1, MCP-1 and MIP-2 further revealed that reperfusion injury is associated with the upregulation of signaling pathways involved in inflammatory responses. It was previously demonstrated that T cells are key mediators of inflammatory responses in the liver following IR (25), and that depletion of T cells confers protection from IRI (26). Compared to other subgroups of T cells, Tregs can directly suppress the activation of monocytes/macrophages, and can also produce inhibitory cytokines (27). The deprivation or downregulation of Tregs may lead to inflammatory response and cause liver damage. In our study, we demonstrated that Tregs are reduced in the HSP27 group, which led to reduced protection of the liver from IRI.

In conclusion, numerous factors are related to liver IRI. For example, hepatic stellate cells may also play a crucial role in the progression of IRI (28). The human HSP27 gene does not protect rat liver from IRI at the early stages, however, it might exert protective effects at a later stage.

Acknowledgements

This study was supported by grants from the Zhejiang Provincial Natural Science Foundation for Young Distinguished Scholars (no. R2110125), the National Natural Science Foundation of China (no. 81272281) and the National High Technology Research and Development Program 863 of China (no. 2012AA021002). The funding institutes had no role in the study design, collection, analysis and interpretation of data, preparation or submission of the manuscript.

References

1 

Teoh NC and Farrell GC: Hepatic ischemia reperfusion injury: pathogenic mechanisms and basis for hepatoprotection. J Gastroenterol Hepatol. 18:891–902. 2003. View Article : Google Scholar : PubMed/NCBI

2 

Fondevila C, Busuttil RW and Kupiec-Weglinski JW: Hepatic ischemia/reperfusion injury - a fresh look. Exp Mol Pathol. 74:86–93. 2003. View Article : Google Scholar : PubMed/NCBI

3 

Wobbes T, Bemelmans BL, Kuypers JH, Beerthuizen GI and Theeuwes AG: Risk of postoperative septic complications after abdominal surgical treatment in relation to perioperative blood transfusion. Surg Gynecol Obstet. 171:59–62. 1990.

4 

Daemen MA, de Vries B and Buurman WA: Apoptosis and inflammation in renal reperfusion injury. Transplantation. 73:1693–1700. 2002. View Article : Google Scholar : PubMed/NCBI

5 

Serracino-Inglott F, Habib NA and Mathie RT: Hepatic ischemia-reperfusion injury. Am J Surg. 181:160–166. 2001. View Article : Google Scholar : PubMed/NCBI

6 

Pundik S, Xu K and Sundararajan S: Reperfusion brain injury: focus on cellular bioenergetics. Neurology. 79:S44–S51. 2012. View Article : Google Scholar : PubMed/NCBI

7 

Song X, Zhang N, Xu H, Cao L and Zhang H: Combined preconditioning and postconditioning provides synergistic protection against liver ischemic reperfusion injury. Int J Biol Sci. 8:707–718. 2012. View Article : Google Scholar

8 

Gurusamy KS, Gonzalez HD and Davidson BR: Current protective strategies in liver surgery. World J Gastroenterol. 16:6098–6103. 2010. View Article : Google Scholar : PubMed/NCBI

9 

Hori S, Nomura T and Sakaguchi S: Control of regulatory T cell development by the transcription factor Foxp3. Science. 299:1057–1061. 2003. View Article : Google Scholar : PubMed/NCBI

10 

Lai LW, Yong KC and Lien YH: Pharmacologic recruitment of regulatory T cells as a therapy for ischemic acute kidney injury. Kidney Int. 81:983–992. 2012. View Article : Google Scholar : PubMed/NCBI

11 

Rane MJ, Pan Y, Singh S, et al: Heat shock protein 27 controls apoptosis by regulating Akt activation. J Biol Chem. 278:27828–27835. 2003. View Article : Google Scholar : PubMed/NCBI

12 

Nagata Y, Kudo M, Nagai T, et al: Heat shock protein 27 expression is inversely correlated with atrophic gastritis and intraepithelial neoplasia. Dig Dis Sci. 58:381–388. 2013. View Article : Google Scholar : PubMed/NCBI

13 

Park SW, Chen SW, Kim M, D’Agati VD and Lee HT: Human heat shock protein 27-overexpressing mice are protected against acute kidney injury after hepatic ischemia and reperfusion. Am J Physiol Renal Physiol. 297:F885–F894. 2009. View Article : Google Scholar : PubMed/NCBI

14 

Kim M, Park SW, Kim M, Chen SW, Gerthoffer WT, D’Agati VD and Lee HT: Selective renal overexpression of human heat shock protein 27 reduces renal ischemia-reperfusion injury in mice. Am J Physiol Renal Physiol. 299:F347–F358. 2010. View Article : Google Scholar : PubMed/NCBI

15 

Chen SW, Park SW, Kim M, Brown KM, D’Agati VD and Lee HT: Human heat shock protein 27 overexpressing mice are protected against hepatic ischemia and reperfusion injury. Transplantation. 87:1478–1487. 2009. View Article : Google Scholar

16 

Taniguchi M, Takeuchi T, Nakatsuka R, Watanabe T and Sato K: Molecular process in acute liver injury and regeneration induced by carbon tetrachloride. Life Sci. 75:1539–1549. 2004. View Article : Google Scholar : PubMed/NCBI

17 

Williams AT and Burk RF: Carbon tetrachloride hepatotoxicity: an example of free radical-mediated injury. Semin Liver Dis. 10:279–284. 1990. View Article : Google Scholar : PubMed/NCBI

18 

Sharma A, Upadhyay AK and Bhat MK: Inhibition of Hsp27 and Hsp40 potentiates 5-fluorouracil and carboplatin mediated cell killing in hepatoma cells. Cancer Biol Ther. 8:2106–2113. 2009. View Article : Google Scholar : PubMed/NCBI

19 

O’Neill S, Ross JA, Wigmore SJ and Harrison EM: The role of heat shock protein 90 in modulating ischemia-reperfusion injury in the kidney. Expert Opin Investig Drugs. 21:1535–1548. 2012.PubMed/NCBI

20 

Tiriveedhi V, Conzen KD, Liaw-Conlin J, et al: The role of molecular chaperonins in warm ischemia and reperfusion injury in the steatotic liver: a proteomic study. BMC Biochem. 13:172012. View Article : Google Scholar : PubMed/NCBI

21 

Montalvo-Jave EE, Escalante-Tattersfield T, Ortega-Salgado JA, Pina E and Geller DA: Factors in the pathophysiology of the liver ischemia-reperfusion injury. J Surg Res. 147:153–159. 2008. View Article : Google Scholar : PubMed/NCBI

22 

Weerachayaphorn J, Chuncharunee A, Jariyawat S, et al: Protection of centrilobular necrosis by Curcuma comosa Roxb. in carbon tetrachloride-induced mice liver injury. J Ethnopharmacol. 129:254–260. 2010.PubMed/NCBI

23 

Breitkopf K, Godoy P, Ciuclan L, Singer MV and Dooley S: TGF-beta/Smad signaling in the injured liver. Z Gastroenterol. 44:57–66. 2006. View Article : Google Scholar : PubMed/NCBI

24 

Michalopoulos GK: Liver regeneration. J Cell Physiol. 213:286–300. 2007. View Article : Google Scholar : PubMed/NCBI

25 

Zwacka RM, Zhang Y, Halldorson J, Schlossberg H, Dudus L and Engelhardt JF: CD4(+) T-lymphocytes mediate ischemia/reperfusion-induced inflammatory responses in mouse liver. J Clin Invest. 100:279–289. 1997.

26 

Yokota N, Daniels F, Crosson J and Rabb H: Protective effect of T cell depletion in murine renal ischemia-reperfusion injury. Transplantation. 74:759–763. 2002. View Article : Google Scholar : PubMed/NCBI

27 

Taams LS, van Amelsfort JM, Tiemessen MM, et al: Modulation of monocyte/macrophage function by human CD4+CD25+ regulatory T cells. Hum Immunol. 66:222–230. 2005.

28 

Jameel NM, Thirunavukkarasu C, Murase N, et al: Constitutive release of powerful antioxidant-scavenging activity by hepatic stellate cells: protection of hepatocytes from ischemia/reperfusion injury. Liver Transpl. 16:1400–1409. 2010. View Article : Google Scholar

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Ye S, Zhang C, Zhou J, Cheng J, Lv Z, Zhou L, Xie H, Wu J and Zheng S: Human heat shock protein 27 exacerbates ischemia reperfusion injury in rats by reducing the number of T regulatory cells. Mol Med Rep 9: 1998-2002, 2014.
APA
Ye, S., Zhang, C., Zhou, J., Cheng, J., Lv, Z., Zhou, L. ... Zheng, S. (2014). Human heat shock protein 27 exacerbates ischemia reperfusion injury in rats by reducing the number of T regulatory cells. Molecular Medicine Reports, 9, 1998-2002. https://doi.org/10.3892/mmr.2014.2032
MLA
Ye, S., Zhang, C., Zhou, J., Cheng, J., Lv, Z., Zhou, L., Xie, H., Wu, J., Zheng, S."Human heat shock protein 27 exacerbates ischemia reperfusion injury in rats by reducing the number of T regulatory cells". Molecular Medicine Reports 9.5 (2014): 1998-2002.
Chicago
Ye, S., Zhang, C., Zhou, J., Cheng, J., Lv, Z., Zhou, L., Xie, H., Wu, J., Zheng, S."Human heat shock protein 27 exacerbates ischemia reperfusion injury in rats by reducing the number of T regulatory cells". Molecular Medicine Reports 9, no. 5 (2014): 1998-2002. https://doi.org/10.3892/mmr.2014.2032
Copy and paste a formatted citation
x
Spandidos Publications style
Ye S, Zhang C, Zhou J, Cheng J, Lv Z, Zhou L, Xie H, Wu J and Zheng S: Human heat shock protein 27 exacerbates ischemia reperfusion injury in rats by reducing the number of T regulatory cells. Mol Med Rep 9: 1998-2002, 2014.
APA
Ye, S., Zhang, C., Zhou, J., Cheng, J., Lv, Z., Zhou, L. ... Zheng, S. (2014). Human heat shock protein 27 exacerbates ischemia reperfusion injury in rats by reducing the number of T regulatory cells. Molecular Medicine Reports, 9, 1998-2002. https://doi.org/10.3892/mmr.2014.2032
MLA
Ye, S., Zhang, C., Zhou, J., Cheng, J., Lv, Z., Zhou, L., Xie, H., Wu, J., Zheng, S."Human heat shock protein 27 exacerbates ischemia reperfusion injury in rats by reducing the number of T regulatory cells". Molecular Medicine Reports 9.5 (2014): 1998-2002.
Chicago
Ye, S., Zhang, C., Zhou, J., Cheng, J., Lv, Z., Zhou, L., Xie, H., Wu, J., Zheng, S."Human heat shock protein 27 exacerbates ischemia reperfusion injury in rats by reducing the number of T regulatory cells". Molecular Medicine Reports 9, no. 5 (2014): 1998-2002. https://doi.org/10.3892/mmr.2014.2032
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team