Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
October-2015 Volume 12 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
October-2015 Volume 12 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Mutation analysis of CACNA1S and SCN4A in patients with hypokalemic periodic paralysis

  • Authors:
    • Xiao‑Ying Wang
    • Bing‑Wen Ren
    • Zeng‑Hua Yong
    • Hong‑Yan Xu
    • Qiu‑Xia Fu
    • He‑Bin Yao
  • View Affiliations / Copyright

    Affiliations: Department of Endocrinology, Chinese People's Liberation Army Navy General Hospital, Beijing 100048, P.R. China, Department of Cadres Medical Care, Chinese People's Liberation Army Navy General Hospital, Beijing 100048, P.R. China
  • Pages: 6267-6274
    |
    Published online on: August 7, 2015
       https://doi.org/10.3892/mmr.2015.4201
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Mutations in CACNA1S (calcium channel, voltage‑dependent, L type, alpha 1S subunit) and SCN4A (sodium channel, voltage‑gated, type IV, alpha subunit) are associated with hypokalemic periodic paralysis (HPP). The aim of the current study was to investigate CACNA1S and SCN4A mutations in patients with HPP. Mutations in CACNA1S and SCN4A were detected in three familial hypokalemic periodic paralysis (FHPP) pedigrees and in two thyrotoxic hypokalemic periodic paralysis (THPP) pedigrees using polymerase chain reaction, DNA sequencing and sequence alignment with GenBank data. A single base mutation from cytosine to guanine at site 1582 was identified in exon 11 of CACNA1S in one FHPP pedigree, resulting in an arginine to glycine (R528G) substitution. A single base mutation from thymine to cytosine at site 2012 was identified in exon 12 of SCN4A in one THPP pedigree, resulting in a phenylalanine to serine (F671S) substitution. No mutations in CACNA1S or SCN4A were identified in the remaining three pedigrees. The present study indicated that CACNA1S and SCN4A mutations are relatively rare in patients with HPP, and further studies are required to determine whether these mutation‑associated substitutions are representative of patients with HPP.

Introduction

Hypokalemic periodic paralysis (HPP) is characterized by recurrent attacks of hypokalemia and muscle weakness and is widely recognized as a typical skeletal muscle channelopathy. Primary HPP is categorized into either familial HPP (FHPP) or sporadic HPP (SHPP). Thyrotoxic HPP (THPP) is representative of all secondary HPP conditions and although familial cases have been reported, the majority cases of THPP are sporadic.

According to pedigree analysis, FHPP is an autosomal dominant disease with lower penetrance in females (1). The pathogenesis of FHPP is attributed to mutations in genes encoding ion channels in skeletal muscle, although the underlying mechanism remains unclear. Associated mutations have been most commonly reported in the genes encoding the voltage-dependent L type calcium channel subunit alpha 1S (CACNA1S) and the voltage-gated sodium channel type IV alpha subunit (SCN4A) (2,3). Several point mutations (4,5) in CACNA1S and SCN4A have been identified to have associations with FHPP, including Arg1239His/Gly and Arg528His in CACNA1S, and Arg669His, Arg672His/Gly and Arg672Ser in SCN4A. Additional rare substitutions have also been reported (6). Some overlap in the mutations in FHPP, SHPP (7), and THPP (8) has been reported.

To date, the majority of genetic studies of HPP have been conducted in Western populations (2,6). Fewer HPP cases have been reported in China compared with Western countries, and information on HPP in Chinese populations remains limited (2,6). The aim of the current study was to screen for mutations in CACNA1S and SCN4A in Chinese patients with HPP. The present study aimed to determine whether mutations associated with HPP in Chinese cases are the same as those in Western populations, and to provide further epidemiological evidence for HPP.

Materials and methods

Study subjects

Informed consent was obtained from all participating patients and the study was approved by the medical ethics committee of the Chinese People's Liberation Army Navy General Hospital (Beijing, China). In total, three FHPP and two THPP pedigrees were investigated and all patients involved were free from any other inherited systemic diseases or congenital disorders and presented with typical periodic attacks of limb paralysis with severe hypokalemia. The pedigree analysis is presented in Fig. 1.

Figure 1

HPP pedigrees. (A) Chinese HPP pedigree A. (B) Chinese HPP pedigree B. (C) Chinese HPP pedigree C. (D) Chinese THPP pedigree D. (E) Chinese THPP pedigree E. Open square, healthy male; open circle, healthy female; filled square, male patient; filled circle, female patient; arrow, proband; crossed out symbol, deceased individual. HPP, hypokalemic periodic paralysis; THPP, thyrotoxic hypokalemic periodic paralysis.

Reagents and materials

High fidelity Pyrobest DNA polymerase and dNTPs were purchased from Takara Bio, Inc. (Otsu, Japan), and Wizard™ Genomic DNA Purification kits, T4 DNA ligase, plasmid pGEM-T and bacteria JM109 were all purchased from Promega Corporation (Madison, WI, USA).

Mutation analysis

Blood samples from confirmed HPP patients were obtained, and genomic DNA was isolated from white blood cells using a Genomic DNA Purification kit according to the manufacturers instructions. Sequence analysis was conducted to identify previously reported common and infrequent mutation sites in CACNA1S and SCN4A. CACNA1S fragments containing the sequences encoding Arg528 and Arg1239 and a SCN4A fragment containing the sequence encoding Arg669 and Arg672 were amplified by polymerase chain reaction (PCR) with the primers presented in Table I. For the pedigrees free from mutations in the above common sites, alternative PCR primers, presented in Table II, were designed to specifically amplify other fragments in CACNA1S and SCN4A. All primers were synthesized by AuGCT Biotechnology Co., Ltd. (Beijing, China). The PCR products were separated by 2% agarose gel electrophoresis (Beijing Huahai Henghui Technology Co., Ltd.) and collected using a gel extraction kit (Promega Corporation). The PCR products were used as templates for subsequent PCR expansion, following which the products were collected again. PCR was performed using a reaction solution containing 50 µl PCR buffer containing 100 µmol/l dNTPs, 0.2 µmol/l primers, 2 units Taq DNA polymerases and 50 ng DNA template. The cycling conditions consisted of one cycle of denaturation at a temperature of 94°C for 5 min, followed by denaturation at a temperature of 94°C for 30 sec, and annealing at a temperature of 55°C for 30 sec and extension at a temperature of 72°C for 30 sec, for a total of 30 cycles. A final extension step was performed at a temperature of 72°C for 5 min. All amplified products were sequenced using an ABI PRISM® 377 DNA Sequencer (Thermo Fisher Scientific, Inc., Waltham, MA, USA). Sequencing results were BLAST searched (blast.ncbi.nlm.nih.gov/) against sequences in GenBank.

Table I

Polymerase chain reaction primers designed for analysis of common mutation sites.

Table I

Polymerase chain reaction primers designed for analysis of common mutation sites.

GenePrimers (5′-3′)Amplified sitesFragment length
CACNA1S L:CACTGAGATGCTGATGAAGATGTA528192 bp
R:GCACTCACTTGGTGATCTTGAA
L:ATGAGAGTGCCCGCATCTCC1239181 bp
R:CTGTTGCACCTGGAAGGACTTG
SCN4A L:CTCTGTGACAGGGCCTCATG669, 672250 bp
R:TCCTCACCCCACCCCCATCC

[i] L, left primer; R, right primer; bp, base pairs.

Table II

Polymerase chain reaction primers for amplification of CACNA1S and SCN4A exons.

Table II

Polymerase chain reaction primers for amplification of CACNA1S and SCN4A exons.

Exon numberLeft primerRight primer
CACNA1S
 11 GGGAGTCAGGAGAATGG GGGAAGTCTGGGCAAGG
 20 CCAGGCTGCTGCCTCTT CCTTGCCGCTGCTCACT
 21 ACAGGCCTGTTCTCCAC TCCTTGTGCTTGAGAGT
 22 ACAGGCCTGTTCTCCAG TCCTTGTGCTTGAGAGT
 26 CTGTGATAACTCAATGG AATAAACCATAAGTGCC
 30 GCCCCTTACCCCTCTGT CCAGGTACGTGCAGTTT
SCN4A
 5 GACCCTGTGGTACCCCT GCTGCCTCTCAAACGCC
 12 CTACGCTCCTTCAGTCT GAAGACCCGCAGCAGAC
 18 ACGCACTGATCCCCTCG CCAGAGGCCCCTTCAGC
 19 GCCCTCCTAGGCGCCAT GTAGAGGTTCACCTCGT

Results

Clinical features

The patients selected for the current study all displayed clinical symptoms in accordance with the diagnostic criteria of HPP. All patients were suffering from irregular muscle weakness with hypokalemia and muscle weakness predominantly in the limbs. Potassium supplements had been effective for all the probands of these pedigrees. Patients in pedigree D and pedigree E also exhibited symptoms of hyperthyroidism, with the hyperthyroidism confirmed by thyroid function analysis. The probands were IV8 of pedigree A, II3 of pedigree B, V18 of pedigree C, III9 of pedigree D and III7 of pedigree E, and their ages of onset were 22, 40, 15, 45 and 43 years old, respectively. As presented in Fig. 1, the ratio of male to female patients in these pedigrees was 2:0, 3:1, 14:13, 6:6 and 1:1, respectively, and atavism was observed in all five pedigrees.

Results of DNA sequencing

Mutation analysis was first conducted in probands and healthy controls from each pedigree. Gene fragments of CACNA1S, containing the 528 and 1239 mutation sites, and of SCN4A, containing the 669 and 672 mutation sites were sequenced. In pedigree C (Fig. 2A), a cytosine to guanine mutation was identified at site 195 in the 192 base pair amplified fragment containing amino acid site 528 of CACNA1S. Following sequence alignment, the mutation was identified as a missense mutation at nucleotide 1582 in exon 11 of CACNA1S, resulting in a substitution of glycine for arginine at site 528 in CACNA1S (Fig. 2B and C). Two additional mutations observed in the same fragment were confirmed as same-sense mutations (Fig. 2B). In pedigree D (Fig. 3A), a substitution mutation of thymine to cytosine was identified in the 250 base pair SCN4A fragment containing amino acid sites 669 and 672. Following sequence alignment, the mutation was confirmed as a missense mutation at nucleotide 2012 in exon 12 of SCN4A, resulting in a substitution of serine for phenylalanine at site 671 (Fig. 3B and C). Two additional mutations observed in the CACNA1S fragment containing nucleotide 1239 were confirmed as same-sense mutations. No mutations in these fragments containing the common mutation sites were identified in the probands of the other three pedigrees.

Figure 2

Sequence analysis of the CACNA1S region encoding amino acid site 528 in pedigree C. (A) Sequencing maps of the amplified fragment in the proband and one healthy member of pedigree C. (B) Sequence alignment. The sequence of the healthy control from GenBank. (C) The change in amino acid sequence resulting from the missense mutation of cytosine to guanine at nucleotide 1582 in CACNA1S. CACNA1S, voltage-dependent L type calcium channel subunit alpha 1S.

Figure 3

Sequence analysis of SCN4A region encoding amino acid sites 669 and 672 in pedigree D. (A) Sequencing maps of the amplified fragment in the proband and one healthy member of pedigree D. (B) Sequence alignment. The sequence of the healthy control from GenBank. (C) The change in the amino acid sequence resulting from the missense mutation of thymine to cytosine at nucleotide 2012 in SCN4A. SCN4A, voltage-gated sodium channel type IV alpha subunit.

Gene fragments encompassing the sites of alternative reported mutations in CACNA1S and SCN4A were then sequenced in the remaining three pedigrees. In pedigree A, among 43 family members in four generations, mutations in 33 subjects, including two patients (IV8 and II3), were detected. In pedigree B, among 26 family members in three generations, mutations in 20 subjects, including four patients (II1, II3, II5 and II7), were detected. In pedigree E, among 18 family members in four generations, mutations in 12 subjects, including one confirmed patient (III7) and one suspected patient (III5), were detected. No mutations previously identified in exons 11, 20, 21, 22, 26 and 30 of CACNA1S, and in exons 5, 12, 18 and 19 of SCN4A were identified in these three pedigrees. Sequencing maps, ranging from nucleotide 1567–1596 in exon 11 of CACNA1S, and from nucleotide 1999–2028 in exon 12 of SCN4A, are presented in Figs. 4 and 5, respectively.

Figure 4

Sequence maps of bases from sites 1567–1596 in exon 11 of CACNA1S in a healthy control, probands and other patients of pedigrees A, B and E. CACNA1S, voltage-dependent L type calcium channel subunit alpha 1S.

Figure 5

Sequence maps of bases from sites 1999–2028 in exon 12 of SCN4A in a healthy control, probands and other patients of pedigrees A, B and E. SCN4A, voltage-gated sodium channel type IV alpha subunit.

Discussion

HPP is a disease detrimental to the quality of life of the patients and can lead to death resulting from unexpected respiratory paralysis or arrhythmia (9,10). Due to variation in the age of onset, duration, frequency and severity of attacks, the diagnosis of HPP is predominantly made according to clinical history, attack characteristics and serum potassium levels during attacks (16). Although the specific mechanism of HPP remains unclear, mutations in genes encoding ion channels in skeletal muscle have been suggested to be involved (17), and genetic analysis may aid in elucidating the pathogenesis of the disease. The inheritance pattern of HPP is known to be autosomal dominant, however it has incomplete penetrance, particularly in females (16). With several family members in the same pedigree suffering HPP, the incomplete penetrance of pathogenic genes is considered to be involved in the atavism of the pedigrees in the current study.

Previous studies have indicated the familial transmission of HPP-associated mutations (2,18). Although SCN4A mutations are also involved (19,20), mutations in CACNA1S occur primarily in patients with HPP. In a study involving 58 HPP pedigrees (2), the rate of mutation detection was 77.6%, including 40 pedigrees with CACNA1S mutations (69.0%) and five pedigrees with SCN4A mutations (8.6%) (no mutations were observed in the remaining 13 pedigrees). The two most common mutations in CACNA1S were R528H and R1239H, which account for 45.0 and 24.0% of mutations detected, respectively. In an additional study involving 83 cases of HPP (6), the rate of mutation was 87.9%, including 65 cases with CACNA1S mutations, accounting for 78.3%, and eight cases with SCN4A mutations, accounting for 9.6%.

Compared with Western populations, mutations observed in Eastern populations are very similar, however the rate of mutation detection is markedly lower. In a study of Chinese patients (21), one case with the R1239H mutation and two cases with the R672H mutation were identified in the probands of 14 pedigrees, the mutation rate of which was 21.4%, and only one case with the R672C mutation was observed in 71 sporadic patients. Mutation screening in Taiwanese patients with HPP detected one case with R528H in 12 sporadic patients, accounting for 8.3%, with no cases detected in 36 patients with THPP (7). An additional study in Taiwanese patients reported four cases with mutations among 60 sporadic patients with HPP, including one case with R1239H, two cases with R669H and one case with R1135H, with the mutation rate in the current study at 6.6% (22). Mutations have been rarely reported in populations from China (23,24). Accordingly, the present study additionally demonstrated a lower rate of HPP-associated gene mutations.

The known mutations in CACNA1S and SCN4A are presented in Table III. The majority of mutation sites in the table have been identified in Western populations, excluding R528G, R900G, R916Q and R1239G. In studies of Asian populations, mutations in CACNA1S were predominantly reported in case studies (9,13,25–31) and pedigree studies (7,14,32–34). In the current study, a rare R528G mutation in CACNA1S in a Chinese HPP pedigree was observed, and this mutation has been previously reported in another Chinese pedigree with HPP (27). THPP shares certain common characteristics with HPP, however, the identification of pathogenic genes between them are not similar (35–37). In contrast with HPP, mutations in CACNA1S are not associated with THPP (35). To date, gene mutations have been confirmed in three THPP pedigrees, including a pedigree with an R83H mutation in KCNE3 (38), a pedigree with an M58V mutation in KCNE4 (36), and a Chinese pedigree with an F671S mutation in SCN4A (the current study). R83H and M58V have not been identified in Chinese patients with THPP, however it remains controversial whether R83H is a causative mutation in THPP, due to the fact that it is additionally present in ~2% of healthy individuals (39).

Table III

Verified mutation sites in CACNA1S and SCN4A in patients with hypokalemic periodic paralysis.

Table III

Verified mutation sites in CACNA1S and SCN4A in patients with hypokalemic periodic paralysis.

GeneExon numberMutation sites
CACNA1S11R528H (6), R528G (6)
20V876E (11), R897S (12)
21R900G (13), R900S (6)
22H916Q (14)
26R1086C (6)
30R1239H (6), R1239G (6)
SCN4A5R222W (6), R669H (6)
12F671S (6), R672H (6), R672G (6),
R672C (6), R672S (6)
18R1132Q (6), R1135H (6)
19P1158S (15)

[i] CACNA1S, voltage-dependent L type calcium channel subunit alpha 1S; SCN4A, voltage-gated sodium channel type IV alpha subunit; R, arginine; G, glycine; H, histidine; S, serine; C, cysteine; Q, glutamine; P, proline; V, valine; E, glutamic acid; W, tryptophan; F, phenylalanine.

In conclusion, mutations in CACNA1S and SCN4A are relatively rare in Chinese HPP cases compared with cases in Western individuals. This indicates a racial difference and the possibility of other pathogenic genes or factors in Chinese patients. Due to the fact that the sample sizes in Asian pedigree studies have been relatively small, and the newly identified mutations in Chinese cases are often identified in case studies (13,14), further research is required to investigate whether R528G in HPP and F671S in THPP are common in Chinese populations. Future studies should aim to identify novel mutations in Chinese patients in CACNA1S and SCN4A in addition in other genes, and to establish animal models with known mutations to further clarify the pathophysiological mechanisms of HPP.

Acknowledgments

The current study was supported by the National Natural Science Foundation of China (grant nos. 30671006 and 81170800). The authors would like to thank Edanz China for the English Language Service.

References

1 

Kawamura S, Ikeda Y, Tomita K, Watanabe N and Seki K: A family of hypokalemic periodic paralysis with CACNA1S gene mutation showing incomplete penetrance in women. Intern Med. 43:218–222. 2004. View Article : Google Scholar : PubMed/NCBI

2 

Sternberg D, Maisonobe T, Jurkat-Rott K, Nicole S, Launay E, Chauveau D, Tabti N, Lehmann-Horn F, Hainque B and Fontaine B: Hypokalaemic periodic paralysis type 2 caused by mutations at codon 672 in the muscle sodium channel gene SCN4A. Brain. 124:1091–1099. 2001. View Article : Google Scholar : PubMed/NCBI

3 

Links TP, Ginjaar HB and van der Hoeven JH: From gene to diseases; hypokalemic periodic paralysis. Ned Tijdschr Geneeskd. 148:1035–1038. 2004.In Dutch. PubMed/NCBI

4 

Kuzmenkin A, Muncan V, Jurkat-Rott K, Hang C, Lerche H, Lehmann-Horn F and Mitrovic N: Enhanced inactivation and pH sensitivity of Na(+) channel mutations causing hypokalaemic periodic paralysis type II. Brain. 125:835–843. 2002. View Article : Google Scholar : PubMed/NCBI

5 

Ng WY, Lui KF, Thai AC and Cheah JS: Absence of ion channels CACN1AS and SCN4A mutations in thyrotoxic hypokalemic periodic paralysis. Thyroid. 14:187–190. 2004. View Article : Google Scholar : PubMed/NCBI

6 

Matthews E, Labrum R, Sweeney MG, Sud R, Haworth A, Chinnery PF, Meola G, Schorge S, Kullmann DM, Davis MB, et al: Voltage sensor charge loss accounts for most cases of hypokalemic periodic paralysis. Neurology. 72:1544–1547. 2009. View Article : Google Scholar : PubMed/NCBI

7 

Lin SH, Hsu YD, Cheng NL and Kao MC: Skeletal muscle dihydropyridine-sensitive calcium channel (CACNA1S) gene mutations in chinese patients with hypokalemic periodic paralysis. Am J Med Sci. 329:66–70. 2005. View Article : Google Scholar : PubMed/NCBI

8 

Lane AH, Markarian K and Braziunene I: Thyrotoxic periodic paralysis associated with a mutation in the sodium channel gene SCN4A. J Pediatr Endocrinol Metab. 17:1679–1682. 2004. View Article : Google Scholar

9 

Kil TH and Kim JB: Severe respiratory phenotype caused by a de novo Arg528Gly mutation in the CACNA1S gene in a patient with hypokalemic periodic paralysis. Eur J Paediatr Neurol. 14:278–281. 2010. View Article : Google Scholar

10 

Stunnenberg BC, Deinum J, Links TP, Wilde AA and Franssen H: Hypokalemia as only cause? Muscle Nerve. 50:327–332. 2014. View Article : Google Scholar : PubMed/NCBI

11 

Ke T, Gomez CR, Mateus HE, et al: Novel CACNA1S mutation causes autosomal dominant hypokalemic periodic paralysis in a South American family. J Hum Genet. 54:660–664. 2009. View Article : Google Scholar : PubMed/NCBI

12 

Chabrier S, Monnier N and Lunardi J: Early onset of hypokalaemic periodic paralysis caused by a novel mutation of the CACNA1S gene. J Med Genet. 45:686–688. 2008. View Article : Google Scholar : PubMed/NCBI

13 

Hirano M, Kokunai Y, Nagai A, Nakamura Y, Saigoh K, Kusunoki S and Takahashi MP: A novel mutation in the calcium channel gene in a family with hypokalemic periodic paralysis. J Neurol Sci. 309:9–11. 2011. View Article : Google Scholar : PubMed/NCBI

14 

Li FF, Li QQ, Tan ZX, Zhang SY, Liu J, Zhao EY, Yu GC, Zhou J, Zhang LM and Liu SL: A novel mutation in CACNA1S gene associated with hypokalemic periodic paralysis which has a gender difference in the penetrance. J Mol Neurosci. 46:378–383. 2012. View Article : Google Scholar

15 

Webb J and Cannon SC: Cold-induced defects of sodium channel gating in atypical periodic paralysis plus myotonia. Neurology. 70:755–761. 2008. View Article : Google Scholar

16 

Vicart S, Sternberg D, Arzel-Hézode M, Franques J, Bendahhou S, Lory P, Hainque B, Fournier E, Nicole S and Fontaine B: Hypokalemic Periodic Paralysis. GeneReviews® [Internet]. Pagon RA, Adam MP, Ardinger HH, Wallace SE, Amemiya A, Bean LJH, Bird TD, Dolan CR, Fong CT, Smith RJH and Stephens K: University of Washington; Seattle, WI: 2002, updated 2014.

17 

Matthews E and Hanna MG: Muscle channelopathies: Does the predicted channel gating pore offer new treatment insights for hypokalaemic periodic paralysis? J Physiol. 588:1879–1886. 2010. View Article : Google Scholar : PubMed/NCBI

18 

Surtees R: Inherited ion channel disorders. Eur J Pediatr. 159:S199–S203. 2000. View Article : Google Scholar

19 

Incecik F, Hergüner MO, Altunbaşak S and Lehman-Horn F: Hypokalemic periodic paralysis due to the SCN4A R672H mutation in a Turkish family. Turk J Pediatr. 52:409–410. 2010.PubMed/NCBI

20 

Park YH and Kim JB: An atypical phenotype of hypokalemic periodic paralysis caused by a mutation in the sodium channel gene SCN4A. Korean J Pediatr. 53:909–912. 2010. View Article : Google Scholar : PubMed/NCBI

21 

Ke QWW, Xu QG, Huang DH, Yu SY and Huang XS: Correlating phenotype and genotype in the familial hypokalemic periodic paralysis. Chin J Neurol. 39:323–327. 2006.

22 

Sung CC, Cheng CJ, Lo YF, Lin MS, Yang SS, Hsu YC and Lin SH: Genotype and phenotype analysis of patients with sporadic periodic paralysis. Am J Med Sci. 343:281–285. 2012. View Article : Google Scholar

23 

Kung AW, Lau KS, Fong GC and Chan V: Association of novel single nucleotide polymorphisms in the calcium channel alpha 1 subunit gene (Ca(v)1.1) and thyrotoxic periodic paralysis. J Clin Endocrinol Metab. 89:1340–1345. 2004. View Article : Google Scholar : PubMed/NCBI

24 

Kung AW, Lau KS, Cheung WM and Chan V: Thyrotoxic periodic paralysis and polymorphisms of sodium-potassium ATPase genes. Clin Endocrinol (Oxf). 64:158–161. 2006. View Article : Google Scholar

25 

Kusumi M, Kumada H, Adachi Y and Nakashima K: Muscle weakness in a Japanese family of Arg1239His mutation hypokalemic periodic paralysis. Psychiatry Clin Neurosci. 55:539–541. 2001. View Article : Google Scholar : PubMed/NCBI

26 

Kim JB, Lee KY and Hur JK: A Korean family of hypokalemic periodic paralysis with mutation in a voltage-gated calcium channel (R1239G). J Korean Med Sci. 20:162–165. 2005. View Article : Google Scholar : PubMed/NCBI

27 

Wang Q, Liu M, Xu C, Tang Z, Liao Y, Du R, Li W, Wu X, Wang X, Liu P, et al: Novel CACNA1S mutation causes autosomal dominant hypokalemic periodic paralysis in a Chinese family. J Mol Med Berl. 83:203–208. 2005. View Article : Google Scholar : PubMed/NCBI

28 

Ke Q, Wu WP, Guo XH, Xu QG, Huang DH, Mao YL and Huo CN: R1239H mutation of CACNA1S gene in a Chinese family with hypokalaemic periodic paralysis. Zhonghua Yi Xue Yi Chuan Xue Za Zhi. 23:272–274. 2006.In Chinese. PubMed/NCBI

29 

Kageyama K, Terui K, Tsutaya S, Matsuda E, Shoji M, Sakihara S, Nigawara T, Takayasu S, Moriyama T, Yasujima M, et al: Gene analysis of the calcium channel 1 subunit and clinical studies for two patients with hypokalemic periodic paralysis. J Endocrinol Invest. 29:928–933. 2006. View Article : Google Scholar : PubMed/NCBI

30 

Ke Q, Xu QG, Huang DH, Yuan HJ, Zhao YL and Wu WP: The mutation R672H in SCN4A gene exists in Chinese patients with hypokalaemic periodic paralysis. Zhonghua Yi Xue Za Zhi. 86:724–727. 2006.In Chinese. PubMed/NCBI

31 

Kim H, Hwang H, Cheong HI and Park HW: Hypokalemic periodic paralysis; two different genes responsible for similar clinical manifestations. Korean J Pediatr. 54:473–476. 2011. View Article : Google Scholar

32 

Kim JB, Kim MH, Lee SJ, Kim DJ and Lee BC: The genotype and clinical phenotype of Korean patients with familial hypokalemic periodic paralysis. J Korean Med Sci. 22:946–951. 2007. View Article : Google Scholar : PubMed/NCBI

33 

Wang W, Jiang L, Ye L, Zhu N, Su T, Guan L, Li X and Ning G: Mutation screening in Chinese hypokalemic periodic paralysis patients. Mol Genet Metab. 87:359–363. 2006. View Article : Google Scholar : PubMed/NCBI

34 

Kim SH, Kim UK, Chae JJ, Kim DJ, Oh HY, Kim BJ and Lee CC: Identification of mutations including de novo mutations in Korean patients with hypokalaemic periodic paralysis. Nephrol Dial Transplant. 16:939–944. 2001. View Article : Google Scholar : PubMed/NCBI

35 

Dias da Silva MR, Cerutti JM, Tengan CH, Furuzawa GK, Vieira TC, Gabbai AA and Maciel RM: Mutations linked to familial hypokalaemic periodic paralysis in the calcium channel alpha1 subunit gene (Cav1.1) are not associated with thyrotoxic hypokalaemic periodic paralysis. Clin Endocrinol (Oxf). 56:367–375. 2002. View Article : Google Scholar

36 

Silva MR, Chiamolera MI, Kasamatsu TS, Cerutti JM and Maciel RM: Thyrotoxic hypokalemic periodic paralysis, an endocrine emergency: Clinical and genetic features in 25 patients. Arq Bras Endocrinol Metabol. 48:196–215. 2004.In Portuguese. PubMed/NCBI

37 

Lin SH and Huang CL: Mechanism of thyrotoxic periodic paralysis. J Am Soc Nephrol. 23:985–988. 2012. View Article : Google Scholar : PubMed/NCBI

38 

Dias Da Silva MR, Cerutti JM, Arnaldi LA and Maciel RM: A mutation in the KCNE3 potassium channel gene is associated with susceptibility to thyrotoxic hypokalemic periodic paralysis. J Clin Endocrinol Metab. 87:4881–4884. 2002. View Article : Google Scholar : PubMed/NCBI

39 

Sternberg D, Tabti N, Fournier E, Hainque B and Fontaine B: Lack of association of the potassium channel-associated peptide MiRP2-R83H variant with periodic paralysis. Neurology. 61:857–859. 2003. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Wang XY, Ren BW, Yong ZH, Xu HY, Fu QX and Yao HB: Mutation analysis of CACNA1S and SCN4A in patients with hypokalemic periodic paralysis. Mol Med Rep 12: 6267-6274, 2015.
APA
Wang, X., Ren, B., Yong, Z., Xu, H., Fu, Q., & Yao, H. (2015). Mutation analysis of CACNA1S and SCN4A in patients with hypokalemic periodic paralysis. Molecular Medicine Reports, 12, 6267-6274. https://doi.org/10.3892/mmr.2015.4201
MLA
Wang, X., Ren, B., Yong, Z., Xu, H., Fu, Q., Yao, H."Mutation analysis of CACNA1S and SCN4A in patients with hypokalemic periodic paralysis". Molecular Medicine Reports 12.4 (2015): 6267-6274.
Chicago
Wang, X., Ren, B., Yong, Z., Xu, H., Fu, Q., Yao, H."Mutation analysis of CACNA1S and SCN4A in patients with hypokalemic periodic paralysis". Molecular Medicine Reports 12, no. 4 (2015): 6267-6274. https://doi.org/10.3892/mmr.2015.4201
Copy and paste a formatted citation
x
Spandidos Publications style
Wang XY, Ren BW, Yong ZH, Xu HY, Fu QX and Yao HB: Mutation analysis of CACNA1S and SCN4A in patients with hypokalemic periodic paralysis. Mol Med Rep 12: 6267-6274, 2015.
APA
Wang, X., Ren, B., Yong, Z., Xu, H., Fu, Q., & Yao, H. (2015). Mutation analysis of CACNA1S and SCN4A in patients with hypokalemic periodic paralysis. Molecular Medicine Reports, 12, 6267-6274. https://doi.org/10.3892/mmr.2015.4201
MLA
Wang, X., Ren, B., Yong, Z., Xu, H., Fu, Q., Yao, H."Mutation analysis of CACNA1S and SCN4A in patients with hypokalemic periodic paralysis". Molecular Medicine Reports 12.4 (2015): 6267-6274.
Chicago
Wang, X., Ren, B., Yong, Z., Xu, H., Fu, Q., Yao, H."Mutation analysis of CACNA1S and SCN4A in patients with hypokalemic periodic paralysis". Molecular Medicine Reports 12, no. 4 (2015): 6267-6274. https://doi.org/10.3892/mmr.2015.4201
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team