Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Biomedical Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 2049-9434 Online ISSN: 2049-9442
Journal Cover
November-December 2013 Volume 1 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
November-December 2013 Volume 1 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Dysregulation of miRNAs and their potential as biomarkers for the diagnosis of gastric cancer

  • Authors:
    • Bo Guo
    • Jie Li
    • Liying Liu
    • Ni Hou
    • Dongmin Chang
    • Lingyu Zhao
    • Zongfang Li
    • Tusheng Song
    • Chen Huang
  • View Affiliations / Copyright

    Affiliations: Department of Genetics and Molecular Biology, Key Laboratory of Environment and Genes Related to Diseases, Ministry of Education, Medical College, Xi'an Jiaotong University, Xi'an, P.R. China, The Second Affiliated Hospital of Shaanxi University of Traditional Chinese Medicine, Xianyang, P.R. China, Department of Tumor Surgery, the First Affiliated Hospital of Medical College, Xi'an Jiaotong University, Engineering Research Center of Biotherapy and Translational Medicine of Shaanxi, Xi'an, Shaanxi, P.R. China
  • Pages: 907-912
    |
    Published online on: September 25, 2013
       https://doi.org/10.3892/br.2013.175
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Recent studies demonstrated that microRNA (miRNA) expression is dysregulated in numerous human cancers. In this study, we investigated the expression patterns of 8 miRNAs in gastric cancer and evaluated their clinical significance in order to identify potential biomarkers for gastric cancer diagnosis. Total RNA was extracted from gastric cancer and normal tissues from 20 pairs of paraffin‑embedded specimens. The expression levels of the miRNAs were detected by quantitative reverse transcriptase polymerase chain reaction using specific stem‑loop primers, with U6 as the internal reference gene. the association between miRNA expression level and clinicopathological factors was investigated. The expression of miR‑21, ‑103, ‑106a, ‑221 and ‑222 in gastric cancer samples was significantly higher compared to that in the paired normal samples. Conversely, the expression of miR‑143 and ‑195 in cancer tissues was significantly lower compared to that in normal tissues. However, miR‑126 exhibited no difference between gastric cancer and normal tissues. A multivariate analysis demonstrated that the expression of miR‑143 and ‑195 were associated with clinicopathological parameters, including depth of invasion and lymph node metastasis. This association may be applicable to future decisions regarding treatment or as a diagnostic biomarker.

Introduction

Gastric cancer is the fourth most common human malignant disease and the second most frequent cause of cancer-related mortality worldwide, causing ~800,000 deaths annually. Approximately two-thirds of gastric cancer cases occur in developing countries, with 42% occurring in China alone (1). Although the optimal combination of surgical and non-surgical approaches has been used to treat gastric cancer, a considerable number of patients develop metastases to other sites due to the lack of reliable diagnostic techniques for early-stage detection (2). Therefore, diagnosis in the early stages is crucial for the selection of the most effective treatment for gastric cancer patients.

MicroRNAs (miRNAs) are small, non-coding RNAs, 19–24 nucleotides in length, which were first described by Lee et al(3). The mature single-stranded microRNAs bind to the 3′ untranslated region of potentially hundreds of target genes of imperfect complementarity, resulting in degradation of target mRNAs and inhibition of translation (4). Over the past 10 years, accumulating evidence strongly supports the role of miRNAs in crucial cellular processes, including development, differentiation, stress response, apoptosis and proliferation (5). Particularly in tumors, miRNAs may function as oncogenes and/or tumor suppressor genes (6).

Thus far, apart from traditional methods, the molecular technique is considered the optimal method for early diagnosis and prognosis prediction in cancer. Recent studies demonstrated that miRNAs are frequently dysregulated in human malignancies (7), including increased expression [i.e., miR-221 (8), -223 (9) and -135a (10)] and decreased expression [i.e., miRNA-200c (11), -451 (12) and -34b (13)]. This altered miRNA expression pattern provided novel opportunities for the use of biomarkers in cancer diagnosis (14). Several miRNA analyses were reported in human malignancies and the differences in expression between tumor tissues and their benign counterparts may be useful for cancer diagnosis (15). However, more ideal biomarkers or co-markers for gastric cancer are required for optimizing treatment selection for patients.

In this study, we compared the expression of 8 miRNAs (miR-21, -103, -106a, -126, -143, -195, -221 and -222) between gastric cancer and normal gastric tissue and investigated the association between their expression and clinical significance in order to identify potential diagnostic markers for gastric cancer.

Materials and methods

Sample collection

Gastrectomy samples were obtained from gastric cancer patients who underwent total gastrectomy at the Shaanxi Provincial People’s Hospital and the First Affiliated Hospital of Xi’an Jiaotong University between 2009 and 2011. A total of 20 paired samples (gastric cancer and normal tissues, at a distance >5 cm from the tumor) were randomly selected and independently examined. The pathological characteristics of the patients are summarized in Table I.

Table I

Summary of pathological characteristics of samples.

Table I

Summary of pathological characteristics of samples.

Pathological characteristicsPatient no. (n=20)
Age (years)
 <607
 >6013
Depth of invasion (T)
 T12
 T24
 T33
 T411
Lymph node metastasis (N)
 Negative (N0)2
 Positive (N1–N3)18
Haematogenous metastasis (M)
 Negative (M0)17
 Positive (M1)3
Stage
 I2
 II5
 III7
 IV6
Differentiation
 Poor12
 Moderate6
 High2
Isolation of total RNA from formaldenhyde-fixed, paraffin-embedded (FFPE) tissue

Total RNA was isolated from FFPE tissue sections with RecoverAll™ Total Nucleic Acid Isolation kit (Ambion, Austin, TX, USA) according to the manufacturer’s instructions. Briefly, the sections were deparaffinized with xylene. Following addition of digestion buffer and protease, the samples were incubated at 50°C for 15 min and at 80°C for 15 min. Subsequently, isolation additive and 100% ethanol were added. After washing 3 times, RNA was eluted in 60 μl of elution solution and stored at −80°C.

Reverse transcription and quantitative polymerase chain reaction (qPCR)

RNA was reverse-transcribed to cDNA by priming with a mixture of looped primers and preamplified according to the manufacturer’s instructions. The primers for miRNA were designed by our team (Table II) and commercially obtained from AuGCT Biotechnology Corporation (AuGCT, Beijing, China). The PrimeScript® RT reagent kit (Perfect Real Time; Takara Bio Inc., Shiga, Japan) was used. The reverse transcriptase reactions contained 20 ng of RNA samples, 2 μl of 5X PrimeScript® Buffer (for Real Time), 0.5 μl of PrimeScript® RT Enzyme Mix I, 4.5 μl of RNase-free water and 1 μl of stem-loop RT primers. The 10-μl reactions were incubated for 15 min at 37°C and for 5 sec at 85°C and maintained at 4°C.

Table II

Primers for reverse transcription (RT) quantitative polymerase chain reaction of 8 microRNAs and U6.

Table II

Primers for reverse transcription (RT) quantitative polymerase chain reaction of 8 microRNAs and U6.

miRNAsPrimer sequences
miR-103
 Forward: ATCCAGTGCGTGTCGTG
 Reverse: TGCTAGCAGCATTGTACAGG
 RT: GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACTCATAGC
miR-106a
 Forward: ATCCAGTGCGTGTCGTG
 Reverse: TGCTAAAAGTGCTTACAGTG
 RT: GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACCTACCTG
miR-143
 Forward: CAGTGCGTGTCGTGGAG
 Reverse: GCGGTGAGATGAAGCACT
 RT: GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACGAGCTAC
miR-145
 Forward: CAGTGCGTGTCGTGGAGT
 Reverse: AGGTCCAGTTTTCCCAGG
 RT: GGAGTCGGCAATTGCACTGGATACGACAGGGATT
miR-195
 Forward: CAGTGCGTGTCGTGGAGT
 Reverse: ACGGTAGCAGCACAGAAATA
 RT: GGAGTCGGCAATTGCACTGGATACGACGCCAATA
miR-21
 Forward: ATCCAGTGCGTGTCGTG
 Reverse: TGCTTAGCTTATCAGACTG
 RT: TGGAGTCGGCAATTGCACTGGATACGACTCAACAT
miR-221
 Forward: ATCCAGTGCGTGTCGTG
 Reverse: TGCTAGCTACATTGTCTGCT
 RT: GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACGAAACCC
miR-222
 Forward: ATCCAGTGCGTGTCGTG
 Reverse: TGCTAGCTACATCTGGCT
 RT: GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACACCCAGT
U6
 Forward: GCTTCGGCAGCACATATACTAAAAT
 Reverse: CGCTTCACGAATTTGCGTGTCAT
 RT: CGCTTCACGAATTTGCGTGTCAT

qPCR was performed using SYBR®-Green I with the SYBR® Premix Ex Taq™ II (Perfect Real Time). The qPCR reactions included 1 μl of RT product dilution (100 ng), 10 μl of 2X SYBR Premix Ex Taq II, 7 μl of RNase-free water, 1 μl of forward primer and 1 μl of reverse primer. U6 was used as an internal control to normalize the expression levels of the target genes. The qPCR was initiated with an initial denaturation step at 95°C for 30 sec, 40 cycles of 5 sec at 95°C and 30 sec at 60°C. All the reactions were run in triplicate using the IQ-5 Real-Time PCR system (Bio-Rad Laboratories, Inc., Hercules, CA, USA).

The ΔCt and 2−ΔΔCt methods were used for analysis. The ΔCt value was calculated by the difference between the Ct values of the specific miRNA and U6: ΔCt = CtmiRNA − CtU6.ΔΔCt = ΔCtcancer tissues − ΔCtnormal tissues. The value of 2−ΔCt represented the miRNA expression of each sample and the value of 2−ΔΔCt represented the relative quotient (RQ) of the expression of the target gene to that of the control. In the present study, RQ represented the value of the ratio of miRNA expression in cancer tissue to that in normal tissue. An RQ<1 indicated that the miRNA expression levels in cancer tissue were lower compared to those in normal tissue. Conversely, an RQ>1 indicated higher miRNA expression in cancer compared to normal tissues.

Statistical analysis

Data were analyzed with SPSS software, version 12.0 (SPSS Inc., Chicago, IL, USA) and Excel software (Microsoft, Redmond, USA). The paired samples t-test was used to compare the expression of miRNAs between cancer and normal tissues. One-way ANOVA was used to investigate the association between cancer and normal tissues. P<0.05 was considered to indicate a statistically significant difference.

Results

Dysregulated miRNAs in cancer and normal tissues of gastric cancer patients

Among the 20 paired samples, 19 cases (95%) exhibited a higher expression of miR-21, 15 cases (75%) exhibited a higher expression of miR-103 and -106a and 13 cases (65%) exhibited a higher expression of miR-221 and -222 in gastric cancer tissues compared to that in normal tissues (Fig. 1), whereas miR-126 exhibited no identical or significant differences between gastric cancer and normal tissues (higher in 10 and lower in the remaining 10 cases). Furthermore, miR-143 was shown to be decreased in 15 of the 20 pairs (75%) (Fig. 2A). The average fold change of miR-143 between gastric cancer and normal tissues was 1.121 (±1.589). miR-195 was also decreased in 16 of the 20 pairs (80%) (Fig. 2B). The average fold change of miR-195 between gastric cancer and normal tissues was 0.799 (±0814).

Figure 1

Dysregulated expression of 8 miRNAs in gastric cancer compared to normal gastric tissues. Each dot represents a result of 2−ΔΔCt in one patient. Each experiment was performed in triplicate.

Figure 2

Underexpression of miR-143 and -195 in gastric cancer compared to normal tissues. (A) miR-143 was decreased in 15 of the 20 pairs (75%) and (B) miR-195 was decreased in 16 of the 20 pairs (80%). *P<0.05. Each experiment was performed in triplicate.

Association between miRNA level and clinicopathological factors in patients with gastric cancer

To further investigate the roles of miR-143 and -195 expression in gastric cancer progression, the association between the expression of miR-143 (Fig. 3A) and -195 (Fig. 3B) was analyzed by one-way ANOVA. A decreased expression of miR-143 and -195 in gastric cancer was not associated with age (>60 vs. <60 years), lymph node metastasis (negative vs. positive), stage and differentiation (poor vs. moderate vs. high). However, miR-143 and -195 underexpression was found to be significantly associated with depth of invasion (P=0.000 and P=0.012, respectively) and haematogenous metastasis (P=0.023 and P=0.016, respectively).

Figure 3

Association of expression levels of miR-143 and -195 with clinicopathological factors. (A) miR-143 underexpression as well as (B) miR-195 underexpression were significantly associated with depth of invasion and haematogenous metastasis. *P<0.05.

Discussion

Alterations in miRNA expression have been described in various cancer types and shown to be significantly correlated with cancer progression (16). miRNAs may function as oncogenes in human cancer. Our data demonstrated that miR-21, -103, -106a, -221 and -222 exhibited a higher expression in gastric cancer compared to normal gastric tissues (Fig. 1). The expression level of miR-21 was reported to be significantly higher in breast cancer compared to normal breast tissues in 109 patients who underwent surgery between 2002 and 2004; its overexpression was associated with mastectomy, larger tumor size, advanced stage, higher grade, estrogen receptor-negative status, human epidermal growth factor receptor 2-positive status, higher Ki-67 expression and mortality and it was significantly associated with lower overall survival (17). miR-103 expression was shown to be increased in patients with colorectal cancer (CRC) and was associated with poor prognosis; its actions are mediated through targeting the known metastasis suppressors death-associated protein kinase and Kruppel-like factor 4 in CRC cells, resulting in increased cell motility and cell-matrix adhesion and decreased cell-cell adhesion and epithelial marker expression (18). The expression analysis of miR-106a in the patient samples demonstrated its overexpression in CRC, leading to downregulation of the retinoblastoma protein activity, which plays an important role in cell cycle progression and, therefore, may be involved in malignant transformation of colonic cells (19). miR-221 and -222 were found to be overexpressed in several human cancers, including breast (20), prostate (21), lung (22) and liver cancer (23). Although the expression levels of miR-126 in CRC tissues were significantly lower compared to those in normal tissues and miR-126 overexpression may inhibit the growth of cancer cells (24), it was also found to be overexpressed in acute myeloid leukemia (25). Although the precise mechanisms underlying the biological functions of miRNAs have not been fully elucidated, our data demonstrated that miR-21, -103, -106a, -221 and -222 were overexpressed in gastric cancer, which may indicate their role as oncogenes in cancerous processes.

Furthermore, previous studies reported the expression alterations and potential target sites of miR-143 and -195. Motoyama et al(26) used a miRNA microarray containing 455 human miRNA probes to determine the miRNA pattern in human CRC and the results demonstrated that the expression of miR-143 in cancer tissues was significantly lower compared to that in normal tissues. In addition, miRNA microarray analysis demonstrated that miR-143 was significantly downregulated, which may promote apoptosis and inhibit tumor formation by targeting Bcl-2 in cervical cancer (27). Ozata et al(28) reported that miR-195 was underexpressed in adrenocortical carcinoma (ACC) compared to normal adrenal cortices and benign adenomas. The overexpression of miR-195 may reduce cell proliferation and lead to significant induction of cell death in human NCI-H295R ACC cells. miR-195 was also found to be downregulated in CRC compared to normal colorectal tissue samples, with this downregulation being observed more frequently among patients with lymph node metastasis and advanced tumor stage (29). As regards the potential for a miRNA-based therapy, several target genes of miR-143 and -195 have already been proven experimentally, such as hexokinase 2 isoform and extracellular signal-regulated kinase-5 (30,31) and WEE1 (32), respectively. Our data also demonstrated that miR-143 and -195 were downregulated in gastric cancer and were associated with depth of invasion (T) and haematogenous metastasis (M), providing a potential target for research of human cancer.

The potential usefulness of miRNA-based biomarkers for the diagnosis of numerous human cancers has been established by several studies. miR-222 expression in the urine was verified by in situ hybridization, which provided a high-accuracy method for bladder cancer diagnosis (33). As regards breast cancer, the differential expression of systemic miRNA-195 provides a possibility for detecting non-invasive and early-stage disease as a sensitive, specific, non-invasive cancer biomarker (34). However, the combination of markers is more reliable compared to a single marker for cancer diagnosis (35). The expression level of miR-126 in the patient serum was found to be associated with soluble mesothelin-related peptides, which are a specific marker of malignant pleural mesothelioma (MPM). miR-126 expression was correlated with a high risk of developing MPM and may be used as a marker for the early detection of MPM (36). This study identified miR-143 and -195 as potentially useful biomarkers in human gastric cancer, due to their similar performance in the clinicopathological factor analysis. We also suggest a potential diagnostic biomarker combination of miR-143 and -195 (co-markers) to improve their diagnostic sensitivity and specificity.

To validate the performance of biomarkers for the detection of cancer, further studies are required to verify whether the miRNAs we selected bear a full potential as either biomarkers or therapeutic targets in gastric cancer. However, we demonstrated that miR-143 and -195, alone or in combination, may play a critical role in cancer progress and may constitute optimal biomarkers for the diagnosis of gastric cancer.

Acknowledgements

This study was supported by a grant from the Key Science and Technology Program of Shaanxi (no. 2010ZDKG-50), and the Program for Changjiang Scholars and Innovative Research Team in University (PCSIRT: 1171).

References

1 

Parkin DM, Bray F, Ferlay J and Pisani P: Global cancer statistics, 2002. CA Cancer J Clin. 55:74–108. 2005. View Article : Google Scholar

2 

Hohenberger P and Gretschel S: Gastric cancer. Lancet. 362:305–315. 2003. View Article : Google Scholar

3 

Lee RC, Feinbaum RL and Ambros V: The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell. 75:843–854. 1993.

4 

Wang XJ, Reyes JL, Chua NH and Gaasterland T: Prediction and identification of Arabidopsis thaliana microRNAs and their mRNA targets. Genome Biol. 5:R652004. View Article : Google Scholar : PubMed/NCBI

5 

Karp X and Ambros V: Developmental biology. Encountering microRNAs in cell fate signaling. Science. 310:1288–1289. 2005. View Article : Google Scholar : PubMed/NCBI

6 

Mraz M, Pospisilova S, Malinova K, Slapak I and Mayer J: MicroRNAs in chronic lymphocytic leukemia pathogenesis and disease subtypes. Leuk Lymphoma. 50:506–509. 2009. View Article : Google Scholar : PubMed/NCBI

7 

Jiang Q, Wang Y, Hao Y, et al: miR2Disease: a manually curated database for microRNA deregulation in human disease. Nucleic Acids Res. 37:D98–D104. 2009. View Article : Google Scholar : PubMed/NCBI

8 

Dahiya N, Sherman-Baust CA, Wang TL, et al: MicroRNA expression and identification of putative miRNA targets in ovarian cancer. PLoS One. 3:e24362008. View Article : Google Scholar : PubMed/NCBI

9 

Li X, Zhang Y, Zhang H, et al: miRNA-223 promotes gastric cancer invasion and metastasis by targeting tumor suppressor EPB41L3. Mol Cancer Res. 9:824–833. 2011. View Article : Google Scholar : PubMed/NCBI

10 

Chen Y, Zhang J, Wang H, et al: miRNA-135a promotes breast cancer cell migration and invasion by targeting HOXA10. BMC Cancer. 12:1112012. View Article : Google Scholar : PubMed/NCBI

11 

Shimono Y, Zabala M, Cho RW, et al: Downregulation of miRNA-200c links breast cancer stem cells with normal stem cells. Cell. 138:592–603. 2009. View Article : Google Scholar : PubMed/NCBI

12 

Wang XC, Tian LL, Jiang XY, et al: The expression and function of miRNA-451 in non-small cell lung cancer. Cancer Lett. 311:203–209. 2011. View Article : Google Scholar : PubMed/NCBI

13 

Lee YM, Lee JY, Ho CC, et al: miRNA-34b as a tumor suppressor in estrogen-dependent growth of breast cancer cells. Breast Cancer Res. 13:R1162011. View Article : Google Scholar : PubMed/NCBI

14 

Wang J, Chen J, Chang P, et al: MicroRNAs in plasma of pancreatic ductal adenocarcinoma patients as novel blood-based biomarkers of disease. Cancer Prev Res (Phila). 2:807–813. 2009. View Article : Google Scholar : PubMed/NCBI

15 

Paranjape T, Slack FJ and Weidhaas JB: MicroRNAs: tools for cancer diagnostics. Gut. 58:1546–1554. 2009. View Article : Google Scholar : PubMed/NCBI

16 

He L, Thomson JM, Hemann MT, et al: A microRNA polycistron as a potential human oncogene. Nature. 435:828–833. 2005. View Article : Google Scholar : PubMed/NCBI

17 

Lee JA, Lee HY, Lee ES, Kim I and Bae JW: Prognostic implications of microRNA-21 overexpression in invasive ductal carcinomas of the breast. J Breast Cancer. 14:269–275. 2011. View Article : Google Scholar : PubMed/NCBI

18 

Chen HY, Lin YM, Chung HC, et al: miR-103/107 promote metastasis of colorectal cancer by targeting the metastasis suppressors DAPK and KLF4. Cancer Res. 72:3631–3641. 2012. View Article : Google Scholar : PubMed/NCBI

19 

Catela Ivkovic T, Aralica G, Cacev T, Loncar B and Kapitanovic S: miR-106a overexpression and pRB downregulation in sporadic colorectal cancer. Exp Mol Pathol. 94:148–154. 2013.PubMed/NCBI

20 

Stinson S, Lackner MR, Adai AT, et al: TRPS1 targeting by miR-221/222 promotes the epithelial-to-mesenchymal transition in breast cancer. Sci Signal. 4:ra412011.PubMed/NCBI

21 

Sun T, Yang M, Chen S, et al: The altered expression of MiR-221/-222 and MiR-23b/-27b is associated with the development of human castration resistant prostate cancer. Prostate. 72:1093–1103. 2012. View Article : Google Scholar : PubMed/NCBI

22 

Zhang Y, Ma T, Yang S, et al: High-mobility group A1 proteins enhance the expression of the oncogenic miR-222 in lung cancer cells. Mol Cell Biochem. 357:363–371. 2011. View Article : Google Scholar : PubMed/NCBI

23 

Yoo BK, Santhekadur PK, Gredler R, et al: Increased RNA-induced silencing complex (RISC) activity contributes to hepatocellular carcinoma. Hepatology. 53:1538–1548. 2011. View Article : Google Scholar : PubMed/NCBI

24 

Li XM, Wang AM, Zhang J and Yi H: Down-regulation of miR-126 expression in colorectal cancer and its clinical significance. Med Oncol. 28:1054–1057. 2011. View Article : Google Scholar : PubMed/NCBI

25 

Li Z and Chen J: In vitro functional study of miR-126 in leukemia. Methods Mol Biol. 676:185–195. 2011. View Article : Google Scholar : PubMed/NCBI

26 

Motoyama K, Inoue H, Takatsuno Y, et al: Over- and under-expressed microRNAs in human colorectal cancer. Int J Oncol. 34:1069–1075. 2009.PubMed/NCBI

27 

Liu L, Yu X, Guo X, et al: miR-143 is downregulated in cervical cancer and promotes apoptosis and inhibits tumor formation by targeting Bcl-2. Mol Med Report. 5:753–760. 2012.PubMed/NCBI

28 

Ozata DM, Caramuta S, Velazquez-Fernandez D, et al: The role of microRNA deregulation in the pathogenesis of adrenocortical carcinoma. Endocr Relat Cancer. 18:643–655. 2011. View Article : Google Scholar : PubMed/NCBI

29 

Wang X, Wang J, Ma H, Zhang J and Zhou X: Downregulation of miR-195 correlates with lymph node metastasis and poor prognosis in colorectal cancer. Med Oncol. 29:919–927. 2012. View Article : Google Scholar : PubMed/NCBI

30 

Peschiaroli A, Giacobbe A, Formosa A, et al: miR-143 regulates hexokinase 2 expression in cancer cells. Oncogene. 32:797–802. 2013. View Article : Google Scholar : PubMed/NCBI

31 

Clape C, Fritz V, Henriquet C, et al: miR-143 interferes with ERK5 signaling, and abrogates prostate cancer progression in mice. PLoS One. 4:e75422009. View Article : Google Scholar : PubMed/NCBI

32 

Bhattacharya A, Schmitz U, Wolkenhauer O, Schonherr M, Raatz Y and Kunz M: Regulation of cell cycle checkpoint kinase WEE1 by miR-195 in malignant melanoma. Oncogene. 32:3175–3183. 2012. View Article : Google Scholar : PubMed/NCBI

33 

Puerta-Gil P, Garcia-Baquero R, Jia AY, et al: miR-143, miR-222, and miR-452 are useful as tumor stratification and noninvasive diagnostic biomarkers for bladder cancer. Am J Pathol. 180:1808–1815. 2012. View Article : Google Scholar : PubMed/NCBI

34 

Heneghan HM, Miller N, Kelly R, Newell J and Kerin MJ: Systemic miRNA-195 differentiates breast cancer from other malignancies and is a potential biomarker for detecting noninvasive and early stage disease. Oncologist. 15:673–682. 2010. View Article : Google Scholar

35 

Liang QL, Shi HZ, Qin XJ, Liang XD, Jiang J and Yang HB: Diagnostic accuracy of tumour markers for malignant pleural effusion: a meta-analysis. Thorax. 63:35–41. 2008. View Article : Google Scholar : PubMed/NCBI

36 

Santarelli L, Strafella E, Staffolani S, et al: Association of MiR-126 with soluble mesothelin-related peptides, a marker for malignant mesothelioma. PLoS One. 6:e182322011. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Guo B, Li J, Liu L, Hou N, Chang D, Zhao L, Li Z, Song T and Huang C: Dysregulation of miRNAs and their potential as biomarkers for the diagnosis of gastric cancer. Biomed Rep 1: 907-912, 2013.
APA
Guo, B., Li, J., Liu, L., Hou, N., Chang, D., Zhao, L. ... Huang, C. (2013). Dysregulation of miRNAs and their potential as biomarkers for the diagnosis of gastric cancer. Biomedical Reports, 1, 907-912. https://doi.org/10.3892/br.2013.175
MLA
Guo, B., Li, J., Liu, L., Hou, N., Chang, D., Zhao, L., Li, Z., Song, T., Huang, C."Dysregulation of miRNAs and their potential as biomarkers for the diagnosis of gastric cancer". Biomedical Reports 1.6 (2013): 907-912.
Chicago
Guo, B., Li, J., Liu, L., Hou, N., Chang, D., Zhao, L., Li, Z., Song, T., Huang, C."Dysregulation of miRNAs and their potential as biomarkers for the diagnosis of gastric cancer". Biomedical Reports 1, no. 6 (2013): 907-912. https://doi.org/10.3892/br.2013.175
Copy and paste a formatted citation
x
Spandidos Publications style
Guo B, Li J, Liu L, Hou N, Chang D, Zhao L, Li Z, Song T and Huang C: Dysregulation of miRNAs and their potential as biomarkers for the diagnosis of gastric cancer. Biomed Rep 1: 907-912, 2013.
APA
Guo, B., Li, J., Liu, L., Hou, N., Chang, D., Zhao, L. ... Huang, C. (2013). Dysregulation of miRNAs and their potential as biomarkers for the diagnosis of gastric cancer. Biomedical Reports, 1, 907-912. https://doi.org/10.3892/br.2013.175
MLA
Guo, B., Li, J., Liu, L., Hou, N., Chang, D., Zhao, L., Li, Z., Song, T., Huang, C."Dysregulation of miRNAs and their potential as biomarkers for the diagnosis of gastric cancer". Biomedical Reports 1.6 (2013): 907-912.
Chicago
Guo, B., Li, J., Liu, L., Hou, N., Chang, D., Zhao, L., Li, Z., Song, T., Huang, C."Dysregulation of miRNAs and their potential as biomarkers for the diagnosis of gastric cancer". Biomedical Reports 1, no. 6 (2013): 907-912. https://doi.org/10.3892/br.2013.175
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team