Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Biomedical Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 2049-9434 Online ISSN: 2049-9442
Journal Cover
January-February 2014 Volume 2 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
January-February 2014 Volume 2 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Risk of prostate cancer and thrombosis‑related factor polymorphisms

  • Authors:
    • Somayehsadat Ghasemi
    • Aydin Tavakoli
    • Mohamad Moghadam
    • Mohamad Ali Zargar
    • Maryam Abbaspour
    • Nasim Hatamnejadian
    • Ahmad Ebrahimi
  • View Affiliations / Copyright

    Affiliations: Parseh Medical Genetics Counseling Center, Tehran, Islamic Republic of Iran, Hematology Research Center, Shiraz University of Medical Science, Shiraz, Islamic Republic of Iran, Hasheminejad Kidney Center, Tehran, Islamic Republic of Iran, Cellular and Molecular Research Center, Research Institute for Endocrine Sciences, Shahid Beheshti University of Medical Sciences, Tehran, Islamic Republic of Iran
  • Pages: 53-56
    |
    Published online on: October 4, 2013
       https://doi.org/10.3892/br.2013.180
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Venous thromboembolism (VTE) is a complication commonly encountered in cancer patients and is considered to be a major cause of morbidity and mortality. The genetic polymorphisms of thrombophilic factors in cancer patients have been focused on during the last few years. However, the number of available studies on the association between prostate cancer and thromboembolic diseases is limited. Prostate cancer is one of the four major types of cancer and its development is affected by a variety of environmental and genetic factors. In the present study we aimed to focus on the effects of thromboembolic factor gene variations on the risk of prostate cancer. In order to conduct our prospective study, we used amplification‑refractory mutation system‑polymerase chain reaction to investigate three polymorphisms [factor V Leiden (FVL) G1691A, factor II (prothrombin, PTH) G20210A and methylenetetrahydrofolate reductase (MTHFR) C677T] in prostate cancer patients, via comparison with normal individuals. The results demonstrated no significant differences in FvL and PTH gene variations between cases and controls (P>0.05). Although some cases with the T allele of MTHFR 677 were identified, no significant solidarity was established by statistical analysis (P>0.05). Therefore, non‑genetic factors that may disturb homeostatic balance should also be considered in future studies, in order to determine the exact association between VTE and prostate cancer.

Introduction

Cancer and thrombosis are closely interwined, as the coagulation system may affect tumor angiogenesis (1) and cancer may constitute a risk factor for thromboembolic diseases (2). Several factors mediate this interaction, although the most extensively investigated mediators between these two disorders are the platelets, which play a double-edged role in the interplay between thrombosis and cancer. First, platelets are optimal carriers of growth factors to tumor cells. In addition, platelets may coat circulating tumor cells, protecting them from the immune system and assisting their invasion. Second, the prothrombotic properties of platelets may be stimulated through a cascade triggered by tumor cells (3).

Prostate cancer is the second most common cancer among men worldwide and the sixth most common cause of cancer-related mortality. As it is common in developed countries and its incidence is on the increase in developing countries (4), there is a pressing need for novel treatments and prediagnostic strategies for prostate cancer. Phylogenetic studies demonstrated a strong genetic basis for the incidence of this type of cancer (5), which may divert our studies to the genetic field. There have been several genetic studies on prostate cancer, particularly in the field of genetic variation research (6).

Thrombosis-related factor genetic variations have been recently focused on due to their effect on cancer (7). Although the interactions between thrombosis and prostate cancer is well established (1,2), the number of available studies on the variations of thrombosis-related factors in patients with prostate cancer is limited (2). In this study, we focused on this area by evaluating the most common genetic variations of three factors: factor V Leiden (FVL), factor II (prothrombin, PTH) and methylenetetrahydrofolate reductase (MTHFR) enzyme.

The MTHFR enzyme, which is encoded by the MTHFR gene, is one of the factors of the coagulation system. A C-T polymorphism at nucleotide 677 in the MTHFR gene leads to increased levels of homocysteine, which is a risk factor for thrombosis (8). The other most extensively investigated thrombosis-related factors are FVL and PTH. FVL and PTH gene variations have been associated with protein C resistance, which is also a significant risk factor for venous thromboembolism (VTE) (7). MTHFR, FVL and PTH gene polymorphisms have been associated with different types of cancers (1,9); however, there is a relative lack of studies on the association of these polymorphisms with prostate cancer. Our study aimed to evaluate the presence of FVL G1691A, PTH G20210A and MTHFR C677T polymorphisms among Iranian prostate cancer patients.

Materials and methods

Subjects

A total of 30 patients and 40 controls were recruited from Hashemnejad Hospital, Tehran, Iran. The patients enrolled in the study had prostate-specific antigen (PSA) levels >20 ng/ml, Gleason scores >7 and a median age of 64 years (range, 49–78 years). The selected controls had PSA levels of <4 ng/ml and were of the same median age.

All the clinical procedures were approved by the local Ethics Committee of Hashemnejad Hospital and the participants provided informed consent prior to their inclusion in the study.

Methods

Genomic DNA was extracted from peripheral blood samples obtained from the cases and controls using standard protocols. The amplification-refractory mutation system (ARMS) was used to determine the single-nucleotide polymorphisms (SNPs) in each sample. In addition to designing the ARMS-polymerase chain reaction (PCR) primer sets for each gene polymorphism, we used the primer pairs for amplifying the hemoglobin subunit β gene in each sample to provide an internal control (Table I). The PCR cycles were conducted using Flexigene (Techne Corporation, Minneapolis, MN, USA). The amplification programs for each primer pair are described below.

Table I

Primer set sequences.

Table I

Primer set sequences.

GeneSequence of forward primerSequence of reverse primerAmplicon size (bp)
Prothrombin 5′GCACTGGGAGCATTGAGGATc3′a 5′TCTAGAAACAGTTGCCTGGCAG3′34
Factor V Leiden 5′GCAGATCCCTGGACAGACg3′a 5′GGACTACTTGACAATTACTGTTCTCTTG3′152
MTHFR 5′AAGCTGCGTGATGATGAACTt3′a 5′TTGGAAGGTGCAAGATCAGAG3′226
Hemoglobin subunit β 5′GTGCACCTGACTCCTGAGGAGA3′ 5′CCTTGATACCAACCTGCCCAG3′102

a Lowercase nucleotides are showing the position of a variable nucleotide in each primer set, which distinguishes between normal and mutant primers.

{ label (or @symbol) needed for fn[@id='tfn2-br-02-01-0053'] } MTHFR, methylenetetrahydrofolate reductase.

All the PCR procedures were performed in a total volume of 25 μl. The PCR reaction for MTHFR consisted of an initial denaturation step for 5 min at 94°C, followed by 35 cycles of denaturation for 40 sec at 94°C, 50 sec of annealing at 62°C and an extension step at 72°C for 45 sec. To amplify FVL, PCR was performed under the following conditions: initial denaturation at 94°C for 5 min and 35 cycles with 3 segments of denaturation at 94°C for 1 min, annealing at 60°C for 1 min and extension at 72°C for 30 sec. For SNP analysis of the PTH gene, PCR consisted of an initial denaturation at 94°C for 5 min and 35 cycles with 3 segments of denaturation at 94°C for 1 min, annealing at 60°C for 1 min and extension at 72°C for 1 min. All the PCR reactions terminated with a final elongation for 5 min at 72°C.

The PCR products were separated using electrophoresis on 2% agarose gel supplemented with SYBR-Green for DNA product visualization under UV light.

Statistical analysis

The statistical analysis was performed using SPSS software, version 19.0 (SPSS Inc., Chicago, IL, USA). Allelic and genotypic associations were evaluated by the Chi-square and Fisher’s exact tests.

Results

SNP detection

We successfully detected the three previously described SNPs (rs1801133, rs6025 and rs1799963) in 30 prostate cancer patients and 40 healthy individuals that were used as controls. The distribution of the genotype frequencies of FVL G1691A, PTH G20210A and MTHFR C677T are presented in Table II.

Table II

Genotype frequency among cases and controls.

Table II

Genotype frequency among cases and controls.

MTHFR C677TProthrombin G20210AFVL G1691A



GroupsCC (%)TC (%)GG (%)AG (%)GG (%)
Cases27 (90.0)3 (10.0)29 (96.7)1 (3.3)30 (100.0)
Controls34 (85.0)6 (15.0)40 (100.0)0 (0.0)40 (100.0)

[i] MTHFR, methylenetetrahydrofolate reductase; FVL, factor V Leiden.

FVL mutations

FVL mutations of the homozygous or heterozygous genotype were not detected in any of the cases or the controls. All the subjects were found to be normal homozygous.

PTH mutations

There were no statistical differences between the two groups with regard to PTH G20210A mutation (P=0.429). However, the heterozygous form was detected in one patient (3.3%).

MTHFR mutations

The MTHFR C677T genotype heterozygous mutation was detected in 3 cases (10%) and 6 controls (15%). However, there was no statistically significant association between this mutation and the risk of prostate cancer (P=0.404).

Discussion

Prostate cancer is the most common type of cancer among men (10). Therefore, there is a need for novel prevention and treatment strategies for this disease. Although there are certain clinical prostate cancer diagnostic tests available, such as the measurement of PSA or early prostate cancer antigen-3 levels (11,12), a prediagnostic genetic test is required to screen unsuspected cancers. Accordingly, over the last few decades, scientists have focused on linking SNPs to prostate cancer and several SNPs that substantially affect the risk of prostate cancer were identified (6).

In addition, the interactions between different types of cancer and VTE factor gene variations have been established (1,9,13).

The association of the MTHFR 677TT genotype with certain types of cancer, such as an elevated risk for thyroid carcinoma (14), bladder cancer in a Turkish population (15) and a reduced risk of colorectal cancer (13), was previously demonstrated. However, Jakubowska et al(16) reported no association between MTHFR 677 polymorphisms and breast cancer and Kang et al(17) observed no differences in the distribution of this variant in colorectal cancer patients compared to normal individuals. Our results also demonstrated no interaction between prostate cancer and the MTHFR variant in the Iranian population. Although the higher frequency of the TT genotype of MTHFR 677 in the control group did not reach a statistical significance, it may complicate the interactions between thrombosis and prostate cancer. The substitution of T in nucleotide 677 of the MTHFR gene produces an enzyme with reduced activity and results in an increase in the levels of homocysteine (18). Hyperhomocysteinemia is also a significant risk factor for thrombosis (8). The presence of an allele which leads to thrombosis in our control group rather than the case group was an interesting issue and our data should be extended to address this issue more confidently. In addition, this polymorphism should be evaluated in prostate cancer under different conditions, such as surveying the variant in patients with and without VTE. Another example is the study of Ozkan et al(9) that acclaimed a significant difference between cancer patients with and without thrombosis in terms of the presence of the MTHFR mutation.

An increased risk for colorectal cancer was previously demonstrated for homozygous carriers of the FVL polymorphism compared to non-carriers (19). In addition, the contribution of FVL mutations in the oncogenesis of oral cancer was demonstrated by Vairaktaris et al(1). Our study did not identify such an interaction with prostate cancer. The direct outcome of this finding was that the FVL G1691A polymorphism does not affect the risk of prostate cancer. However, two points should be considered. First, this polymorphism has been a subject of controversy. Although no association was reported between FVL mutations and cancer patients by Ozkan et al(9), a significant effect of FVL on thrombosis in patients with malignant diseases was established by Pihusch et al(20). Second, the SNP allele frequencies vary significantly between human populations. This controversy may result from the differences between the studied populations. In the Iranian population assessed by the present study, there was no observed association between FVL mutations and prostate cancer; however, data collection from other populations is required to verify this null association.

PTH G20210A carriers were shown to be at reduced risk for colorectal cancer in a German population (19). However, Ozkan et al(9) reported no significant association between PTH mutations and cancer, there was no association with lung cancer (21) and we did not observe any significant interaction in Iranian prostate cancer patients. These data indicate that PTH G20210A is not significantly associated with cancer. However, similar to FVL, allele frequencies from different population must be assessed to verify our conclusions.

In conclusion, this study revealed no association between the risk of prostate cancer and the most significant thrombosis-related factor gene polymorphisms in an Iranian population. However, although we were unable to demonstrate such an association, a large and prospective study may yield different results.

Acknowledgements

We would like to thank the Hashemnejad Hospital of Tehran for kindly providing the blood samples used in this study.

References

1 

Vairaktaris E, Yapijakis C, Wiltfang J, et al: Are factor V and prothrombin mutations associated with increased risk of oral cancer? Anticancer Res. 25:2561–2565. 2005.PubMed/NCBI

2 

Van Hemelrijck M, Adolfsson J, Garmo H, et al: Risk of thromboembolic diseases in men with prostate cancer: results from the population-based PCBaSe Sweden. Lancet Oncol. 11:450–458. 2010.

3 

Trikha M and Nakada MT: Platelets and cancer: implications for antiangiogenic therapy. Semin Thromb Hemost. 28:39–44. 2002. View Article : Google Scholar : PubMed/NCBI

4 

Baade PD, Youlden DR and Krnjacki LJ: International epidemiology of prostate cancer: geographical distribution and secular trends. Mol Nutr Food Res. 53:171–184. 2009. View Article : Google Scholar : PubMed/NCBI

5 

Zeegers MP, Jellema A and Ostrer H: Empiric risk of prostate carcinoma for relatives of patients with prostate carcinoma: a meta-analysis. Cancer. 97:1894–1903. 2003. View Article : Google Scholar : PubMed/NCBI

6 

Eeles RA, Kote-Jarai Z, Giles GG, et al: Multiple newly identified loci associated with prostate cancer susceptibility. Nat Genet. 40:316–321. 2008. View Article : Google Scholar : PubMed/NCBI

7 

Ramacciotti E, Wolosker N, Puech-Leao P, et al: Prevalence of factor V Leiden, FII G20210A, FXIII Val34Leu and MTHFR C677T polymorphisms in cancer patients with and without venous thrombosis. Thromb Res. 109:171–174. 2003. View Article : Google Scholar : PubMed/NCBI

8 

Eroglu A, Egin Y, Cam R and Akar N: The 19-bp deletion of dihydrofolate reductase (DHFR), methylenetetrahydrofolate reductase (MTHFR) C677T, factor V Leiden, prothrombin G20210A polymorphisms in cancer patients with and without thrombosis. Ann Hematol. 88:73–76. 2009. View Article : Google Scholar

9 

Ozkan M, Sivgin S, Kocyigit I, et al: Do thrombophilic gene mutations have a role on thromboembolic events in cancer patients? Asia Pac J Clin Oncol. 8:e34–e41. 2012. View Article : Google Scholar : PubMed/NCBI

10 

Pectasides D, Pectasides E, Papaxoinis G, et al: Combination chemotherapy with docetaxel, vinorelbine and estramustine phosphate in metastatic androgen-resistant prostate cancer: a single institution experience. Anticancer Res. 29:769–775. 2009.

11 

Bourdoumis A, Papatsoris AG, Chrisofos M, Efstathiou E, Skolarikos A and Deliveliotis C: The novel prostate cancer antigen 3 (PCA3) biomarker. Int Braz J Urol. 36:665–669. 2010. View Article : Google Scholar : PubMed/NCBI

12 

Hansel DE, DeMarzo AM, Platz EA, et al: Early prostate cancer antigen expression in predicting presence of prostate cancer in men with histologically negative biopsies. J Urol. 177:1736–1740. 2007. View Article : Google Scholar : PubMed/NCBI

13 

Kennedy DA, Stern SJ, Matok I, et al: Folate intake, MTHFR polymorphisms, and the risk of colorectal cancer: a systematic review and meta-analysis. J Cancer Epidemiol. 2012:9525082012.PubMed/NCBI

14 

Ozdemir S, Silan F, Hasbek Z, et al: Increased T-allele frequency of 677 C>T polymorphism in the methylenetetrahydrofolate reductase gene in differentiated thyroid carcinoma. Genet Test Mol Biomarkers. 16:780–784. 2012.

15 

Izmirli M, Inandiklioglu N, Abat D, et al: MTHFR gene polymorphisms in bladder cancer in the Turkish population. Asian Pac J Cancer Prev. 12:1833–1835. 2011.PubMed/NCBI

16 

Jakubowska A, Rozkrut D, Antoniou A, et al: Association of PHB 1630 C>T and MTHFR 677 C>T polymorphisms with breast and ovarian cancer risk in BRCA1/2 mutation carriers: results from a multicenter study. Br J Cancer. 106:2016–2024. 2012.

17 

Kang BS, Ahn DH, Kim NK and Kim JW: Relationship between metabolic syndrome and MTHFR polymorphism in colorectal cancer. J Korean Soc Coloproctol. 27:78–82. 2011. View Article : Google Scholar : PubMed/NCBI

18 

Shannon B, Gnanasampanthan S, Beilby J and Iacopetta B: A polymorphism in the methylenetetrahydrofolate reductase gene predisposes to colorectal cancers with microsatellite instability. Gut. 50:520–524. 2002. View Article : Google Scholar : PubMed/NCBI

19 

Vossen CY, Hoffmeister M, Chang-Claude JC, Rosendaal FR and Brenner H: Clotting factor gene polymorphisms and colorectal cancer risk. J Clin Oncol. 29:1722–1727. 2011. View Article : Google Scholar : PubMed/NCBI

20 

Pihusch R, Danzl G, Scholz M, et al: Impact of thrombophilic gene mutations on thrombosis risk in patients with gastrointestinal carcinoma. Cancer. 94:3120–3126. 2002. View Article : Google Scholar : PubMed/NCBI

21 

Arslan S, Manduz S, Epozturk K, Karahan O and Akkurt I: Association of deep venous thrombosis with prothrombotic gene polymorphism identified in lung cancer cases. Mol Biol Rep. 38:2395–2400. 2011. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Ghasemi S, Tavakoli A, Moghadam M, Zargar MA, Abbaspour M, Hatamnejadian N and Ebrahimi A: Risk of prostate cancer and thrombosis‑related factor polymorphisms. Biomed Rep 2: 53-56, 2014.
APA
Ghasemi, S., Tavakoli, A., Moghadam, M., Zargar, M.A., Abbaspour, M., Hatamnejadian, N., & Ebrahimi, A. (2014). Risk of prostate cancer and thrombosis‑related factor polymorphisms. Biomedical Reports, 2, 53-56. https://doi.org/10.3892/br.2013.180
MLA
Ghasemi, S., Tavakoli, A., Moghadam, M., Zargar, M. A., Abbaspour, M., Hatamnejadian, N., Ebrahimi, A."Risk of prostate cancer and thrombosis‑related factor polymorphisms". Biomedical Reports 2.1 (2014): 53-56.
Chicago
Ghasemi, S., Tavakoli, A., Moghadam, M., Zargar, M. A., Abbaspour, M., Hatamnejadian, N., Ebrahimi, A."Risk of prostate cancer and thrombosis‑related factor polymorphisms". Biomedical Reports 2, no. 1 (2014): 53-56. https://doi.org/10.3892/br.2013.180
Copy and paste a formatted citation
x
Spandidos Publications style
Ghasemi S, Tavakoli A, Moghadam M, Zargar MA, Abbaspour M, Hatamnejadian N and Ebrahimi A: Risk of prostate cancer and thrombosis‑related factor polymorphisms. Biomed Rep 2: 53-56, 2014.
APA
Ghasemi, S., Tavakoli, A., Moghadam, M., Zargar, M.A., Abbaspour, M., Hatamnejadian, N., & Ebrahimi, A. (2014). Risk of prostate cancer and thrombosis‑related factor polymorphisms. Biomedical Reports, 2, 53-56. https://doi.org/10.3892/br.2013.180
MLA
Ghasemi, S., Tavakoli, A., Moghadam, M., Zargar, M. A., Abbaspour, M., Hatamnejadian, N., Ebrahimi, A."Risk of prostate cancer and thrombosis‑related factor polymorphisms". Biomedical Reports 2.1 (2014): 53-56.
Chicago
Ghasemi, S., Tavakoli, A., Moghadam, M., Zargar, M. A., Abbaspour, M., Hatamnejadian, N., Ebrahimi, A."Risk of prostate cancer and thrombosis‑related factor polymorphisms". Biomedical Reports 2, no. 1 (2014): 53-56. https://doi.org/10.3892/br.2013.180
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team