Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Biomedical Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 2049-9434 Online ISSN: 2049-9442
Journal Cover
November-December 2014 Volume 2 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
November-December 2014 Volume 2 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

β‑catenin knockdown enhances the effects of fluorouracil in the breast cancer cell line MDA‑MB‑468

  • Authors:
    • Xinquan Lv
    • Xia Pang
    • Xiangdong Jin
    • Yimin Song
    • Huixiang Li
  • View Affiliations / Copyright

    Affiliations: Department of Pathology, The First Affiliated Hospital of Zhengzhou University, Zhengzhou, Henan 450052, P.R. China
  • Pages: 910-914
    |
    Published online on: August 26, 2014
       https://doi.org/10.3892/br.2014.353
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Tumor proliferation, drug resistance and cell stemness are major difficulties that are encountered during breast cancer therapy and are often responsible for disease progression and cancer‑related mortality. β‑catenin is considered to be an invasion gene in breast cancer. However, how β‑catenin regulates breast cancer cell proliferation and stemness remains unclear. In the present study, β‑catenin knockdown by small interfering RNA in MDA‑MB‑468, a highly metastatic breast cancer cell line, inhibited the expression of β‑catenin, Oct3/4 (stemness), survivin (anti‑apoptosis) and BCRP (drug resistance). Knockdown of β‑catenin enhanced the effects of fluorouracil (5‑FU) chemotherapy on the proliferation of MDA‑MB‑468 cells. Thus, these preliminary results indicate that β‑catenin knockdown enhanced 5‑FU‑induced proliferation inhibition in the breast cancer cell line MDA‑MB‑468, and indicate that combining 5‑FU with gene silencing could be an advantageous option for enhancing the curative effect of chemotherapy in breast cancer and other malignancies.

Introduction

Tumor invasion, metastasis and drug-resistance of cancer cells are considered to play a vital role in cancer-related mortality (1–5). In addition, cancer cell stemness is a new challenge for cancer therapy as conventional chemotherapy is inefficient in killing the stem/progenitor cells. Signaling pathways, including the Hedgehog, Wnt/β-catenin, Notch, epidermal growth factor receptor (EGFR), phosphorylated EGFR and KIT pathways, are involved in this process.

The Wnt/β-catenin signal transduction pathway is a major pathway regulating cancer cell fate. As indicated in certain studies (6–8), the activity of this pathway is necessary for the maintenance of stem cell self-renewal and non-differentiation in normal tissues, and promotes the amplification of stem cells in tumors. β-catenin, as the only component in the third section of the pathway, may be an ideal therapeutic target. However, the role of β-catenin signaling in breast cancer is unclear.

The present study aimed to investigate whether impairing β-catenin expression could decrease proliferation and drug-resistance of tumor stem cells. β-catenin expression in a highly metastatic breast cancer cell line (MDA-MB-468) was repressed using small interfering RNA (siRNA). The subsequent changes in stem/progenitor cells-related factors and in the inhibition rates were monitored using siRNA and chemotherapy, alone or in combination.

Materials and methods

Cell culture

The breast cancer cell line, MDA-MB-468, was obtained from the Chinese-United Kingdom Medical Laboratory (Basic Medical College, Zhengzhou University, Zhengzhou, China). The cells were cultured at 37°C with 5% CO2 in Dulbecco’s modified Eagle’s medium (HyClone, Thermo Fisher Scientific, Inc., Waltham, MA, USA) supplemented with 10% fetal calf serum (Hyclone, Thermo Fisher Scientific, Inc.), 100 U/ml of penicillin G and 100 μg/ml of streptomycin (Gibco-Invitrogen, Carlsbad, CA, USA).

RNA interference

Cell cultures were randomly assigned to the scramble RNA or the siRNA groups. The scramble RNA group was transfected with scramble siRNA and the siRNA group was transfected with β-catenin siRNA. The siRNAs were obtained from Shanghai GenePharma Co., Ltd., (Shanghai, China) and Lipofectamine™ 2000 was obtained from Invitrogen. Interference was performed in 6- and 96-well culture plates, according to the manufacturer’s instructions. Protein and total RNA 24, 48 and 72 h after interference were extracted from 6 plates to perform western blotting and semi-quantitative reverse transcription-polymerase chain reaction (RT-qPCR).

Western blotting

Cells were lyzed in Western and immunoprecipitation cell lysis solution (Beyotime Institute of Biotechnology, Haimen, China). Protein concentrations were determined using the Lowry method (9) in duplicate and the results were averaged. Aliquots of the tissue samples corresponding to 50 μg of total protein were heated at 100°C for 10 min with an equivalent volume of 2X sample buffer (containing 4% SDS and 10% mercaptoethanol) and loaded onto 10% polyacrylamide gels. The proteins were electrotransferred to polyvinylidene difluoride membranes (Bio-Rad, Hercules, CA, USA) in Tris-glycine-methanol buffer. The membranes were blocked for 1 h at room temperature in a blocking solution containing 5% skimmed milk. The membranes were subsequently incubated overnight at 4°C with mouse monoclonal anti-human β-catenin antibodies (Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA), followed by incubation with horseradish peroxidase-conjugated goat anti-mouse immunoglobulin G. The proteins of interest were visualized using the enhanced DAB western blotting detection reagents and analyzed using the Quantity One software (Bio-Rad).

Semi-RT-qPCR

Total RNA was extracted from cultured cells using TRIzol (Qiagen, Venlo, Netherlands), according to the manufacturer’s instructions. Total RNA (1–5 μg) was reverse-transcribed using the TIANScript RT kit [Tiangen Biotech (Beijing) Co., Ltd., Beijing, China] and the provided oligo(dT)18 primers. The amount of cDNA was normalized to the internal control, β-actin. All the primers and the annealing temperature are listed in Table I. PCR analysis was performed with the Golden Easy PCR system [Tiangen Biotech (Beijing) Co., Ltd.].

Table I

Polymerase chain reaction primers.

Table I

Polymerase chain reaction primers.

PrimerNCBI IDPrimers sequence (5′-3′)Product size, bpMelting temperature, °C
β-cateninNM_001098209.1Forward: CCCACTAATGTCCAGCGTTT
Reverse: AACCAAGCATTTTCACCAGG
38254.0
Oct3/4NM_002701.4Forward: TTCAGCCAAACGACCATC
Reverse: GGAAAGGGACCGAGGAGTA
48454.9
BCRPNM_004827.2Forward: GCCATTCTCCCAGTCA
Reverse: GGGCGTCTATACACCAT
49449.7
SurvivinNM_001012271.1Forward: CTTGCCAGAGCCACGAA
Reverse: GGAACCTCACCCATAGCC
63255.4
β-actinNM_001101.3Forward: GCCCTGAGGCACTCTTC
Reverse: GGCCGGACTCGTCATAC
33054.9

[i] NCBI, National Center for Biotechnology Information.

Chemotherapy

In the fluorouracil (5-FU) group, the cells were treated with 5-FU alone (1 μg/ml final concentration). In the 5-FU/siRNA group, the cells were treated with β-catenin siRNA and subsequently with 5-FU (1 μg/ml final concentration) 24 h after siRNA.

Cell growth inhibition rate

The cells were inoculated in 96-well culture plates at 5,000 cells/well and treated according to their specific group. The Cell Counting kit-8 (CCK-8) solution (Beyotime Institute of Biotechnology) was added at 24, 48 and 72 h in the siRNA group and at 24 h in the 5-FU and 5-FU/siRNA groups, prior to incubation for 2 h. Following incubation, the absorbance (ABS) of each sample was measured at 450 nm. Inhibition Rate (IR) = (ABS of experimental group - ABS of scramble group)/ABS of scramble group × 100%.

Statistical analysis

All the experiments were repeated five times and the mean values were used for statistical analyses. Statistical analysis was performed using SPSS 13.0 (SPSS, Inc., Chicago, IL, USA). Comparisons between the groups at each time interval were performed using one-way analysis of variance. The associations between the factors were determined by two-sided Pearson correlation analysis. P<0.05 was considered to indicate a statistically significant difference.

Results

Effect of β-catenin interference on mRNA expression of β-catenin, Oct3/4, survivin and BCRP

β-catenin, Oct3/4, survivin and BCRP mRNA expression was decreased at 24, 48 and 72 h after interference in the siRNA group and the inhibition rate at 24 h was the most evident (48%). The curves for each mRNA were consistent (Fig. 1).

Figure 1

(A) mRNA expression of β-catenin, Oct3/4, survivin and BCRP following β-catenin small interfering RNA (siRNA) by semi-quantitative reverse transcription-polymerase chain reaction. In every image, the upper section is the mRNA of interest and the lower section is the internal control, β-actin. Lanes 1, 2, 3 and 4 represent PCR products at 0, 24, 48 and 72 h after transfection, respectively. M, marker (DL2000 for each mRNA, except 50-bp ladder for BCRP). (B) mRNA expression curve of β-catenin, Oct3/4, survivin and BCRP following β-catenin siRNA treatment. Each dot represents the relative grayscale value (ratio of corresponding mRNA to β-actin). All the values decreased following transfection and the decline was most evident at 24 h.

mRNA expression of β-catenin, Oct3/4, survivin and BCRP under chemotherapy

The above data showed that β-catenin interference was the most efficient at 24 h. Therefore, 24 h after β-catenin siRNA transfection, 5-FU (1 μg/ml) or saline was added to the MDA-MB-468 cells. RT-qPCR results showed that 5-FU inhibited the mRNA expression of β-catenin, Oct3/4, survivin and BCRP. Furthermore, β-catenin siRNA transfection enhanced the inhibition rate of 5-FU on these genes (Fig. 2). These results indicated that β-catenin siRNA enhanced the inhibition of Oct3/4, survivin and BCRP gene expression by 5-FU.

Figure 2

(A) mRNA expression of β-catenin, Oct3/4, survivin and BCRP at 24 h after 5-FU treatment by reverse transcription-polymerase chain reaction. In every image, the upper section is the mRNA of interest and the lower section is the internal control, β-actin. Lane 2 is 24 h after chemotherapy in the 5-FU group, whereas lane 1 is the blank control group. (B) mRNA expression of β-catenin, Oct3/4, survivin and BCRP 24 h after chemotherapy (48 h after transfection) in the 5-FU/mRNA group. Lanes 1, 2, 3, 4 and 5 are β-catenin, Oct3/4, BCRP, survivin and β-actin, respectively. M, DNA marker (left, 100-bp ladder; right, DL2000). (C) Inhibition rate of β-catenin, Oct3/4, survivin and BCRP. The inhibition rates were obtained from the relative grayscale value of each mRNA in the three experimental groups divided by that of the control group. The inhibition rates of each mRNA were the most efficient in the small interfering RNA (siRNA)/5-FU group.

Cell growth inhibition rates

CCK-8 analyses were used to assess the cell growth inhibition rate under different conditions. In the 5-FU or siRNA groups, the cell growth inhibition rates were 17 and 27%, respectively. In the 5-FU/siRNA group, the cell growth inhibition rate was 46%, which was significantly different compared to the other two groups (P<0.05). These results indicated that β-catenin siRNA could enhance the inhibition rate of 5-FU chemotherapy on cell growth (Fig. 3).

Figure 3

Cell growth inhibition rates. The cell growth inhibition rates were obtained using the Cell Counting kit-8 method. The small interfering RNA (siRNA)/5-FU group showed higher cell growth inhibition compared to the 5-FU or siRNA groups. ABS, absorbance; IR, Inhibition Rate.

Discussion

Distant metastases and invasion are responsible for >90% of cancer-related mortalities (10). The initial stage of metastatic progression is essentially dependent upon important biological events, including cell proliferation, epithelial-mesenchymal transition, drug resistance and cancer cell stemness (11,12).

Wnt/β-catenin signaling has been demonstrated to play an important role in metastasis development (13). In the study by DiMeo et al (14), the downstream target genes of the Wnt/β-catenin pathway were found to be significantly upregulated in early breast cancer metastatic cells in the lungs of a mouse model. Another study revealed that β-catenin is upregulated in human cancers and correlates with poor prognosis (15). The accumulation of nuclear β-catenin in the invasive fronts of primary tumors further emphasizes the critical role of β-catenin in the metastatic process (16). Previous studies have suggested that the β-catenin pathway may play a pivotal role in cancer metastasis and invasion (14–16). In the present study, it was shown that the β-catenin pathway affects the expression of genes involved in cell proliferation, drug resistance and cell stemness.

Following β-catenin siRNA transfection, β-catenin mRNA expression showed a significant downregulation compared to the scramble siRNA group, demonstrating the validity of the transfection. In the present study, mRNA expression of the stem/progenitor marker Oct3/4 decreased when β-catenin was repressed, indicating that decreasing β-catenin may be an effective way for reducing the proportion of stem/progenitor cells. Simultaneously, the mRNA expression of the anti-apoptosis factor survivin and the drug-resistance factor BCRP decreased similarly, showing a positive association between β-catenin, Oct3/4, survivin and BCRP expression. These results showed that stem/progenitor cells had inherent anti-apoptosis and drug-resistant properties, consistent with previous studies (5,17,18).

Oct3/4 encodes a transcription factor involved in embryonic development, ensuring embryonic stem cell pluripotency (19) and participating in stem cell renewal (20). Oct3/4 is a stem/progenitor cell general marker and represents the existence or quantity/functional changes in stem/progenitor cells. BCRP is a member of the adenosine triphosphate-binding cassette transporters superfamily involved in multi-drug resistance of cancer stem cells (21–23). Survivin encodes a negative regulatory protein that prevents apoptotic cell death (17) and is associated with drug-resistance of stem cells (5,18).

In the present study, Oct3/4, survivin and BCRP expression were significantly inhibited in the MDA-MB-468 cell line due to the knockdown of β-catenin. Oct3/4, survivin and BCRP expression were associated with breast cancer cell stemness, proliferation and drug resistance. However, there was no detailed data that showed that β-catenin knockdown could affect MDA-MB-468 cell stemness and drug resistance. However, cell proliferation was inhibited significantly following β-catenin knockdown. These results demonstrated that β-catenin could be a potential candidate for breast cancer therapy.

There are limited studies on the effects of decreasing β-catenin expression to restrain cancer stem/progenitor cells. Wang et al (24) silenced the expression of β-catenin in the esophageal cancer cell line, Eca-109, using little hairpin RNA and found that the cell cycle was blocked in the G0/G1 stage, resulting from the decreased expression of cyclin D1. A decrease in cell growth and colony formation rates were also observed, which could be used as a surrogate for stem cells quantity. These results are consistent with the aforementioned previous studies.

The present study revealed that the β-catenin inhibition rate (for mRNA and protein) was higher 24 h after transfection. The inhibition rate in the siRNA/5-FU and 5-FU groups was more evident compared to the siRNA group, possibly due to the decreased capacity of anti-apoptosis and drug-resistance resulting from decreased β-catenin protein expression. The data of the present study indicated that combining 5-FU with gene silencing could be an advantageous option for enhancing the curative effect of chemotherapy in breast cancer and other malignancies.

In conclusion, these preliminary results indicate that knockdown of β-catenin enhanced 5-FU-induced proliferation inhibition of the breast cancer cell line MDA-MB-468.

Acknowledgements

The present study was supported by a grant from the National Natural Science Foundation of China (grant no. 81172179).

References

1 

Eramo A, Ricci-Vitiani L, Zeuner A, et al: Chemotherapy resistance of glioblastoma stem cells. Cell Death Differ. 13:1238–1241. 2006. View Article : Google Scholar : PubMed/NCBI

2 

Dean M: ABC transporters, drug resistance, and cancer stem cells. J Mammary Gland Biol Neoplasia. 14:3–9. 2009. View Article : Google Scholar : PubMed/NCBI

3 

Dean M, Fojo T and Bates S: Tumour stem cells and drug resistance. Nat Rev Cancer. 5:275–284. 2005. View Article : Google Scholar

4 

Phillips TM, McBride WH and Pajonk F: The response of CD24(−/low)/CD44+ breast cancer-initiating cells to radiation. J Natl Cancer Inst. 98:1777–1785. 2006.

5 

Tanei T, Morimoto K, Shimazu K, et al: Association of breast cancer stem cells identified by aldehyde dehydrogenase 1 expression with resistance to sequential Paclitaxel and epirubicin-based chemotherapy for breast cancers. Clin Cancer Res. 15:4234–4241. 2009. View Article : Google Scholar : PubMed/NCBI

6 

Reya T and Clevers H: Wnt signalling in stem cells and cancer. Nature. 434:843–850. 2005. View Article : Google Scholar : PubMed/NCBI

7 

Li Y, Welm B, Podsypanina K, et al: Evidence that transgenes encoding components of the Wnt signaling pathway preferentially induce mammary cancers from progenitor cells. Proc Natl Acad Sci USA. 100:15853–15858. 2003. View Article : Google Scholar : PubMed/NCBI

8 

Liu BY, McDermott SP, Khwaja SS and Alexander CM: The transforming activity of Wnt effectors correlates with their ability to induce the accumulation of mammary progenitor cells. Proc Natl Acad Sci USA. 101:4158–4163. 2004. View Article : Google Scholar : PubMed/NCBI

9 

Lowry OH, Rosebrough NJ, Farr AL and Randall RJ: Protein measurement with the Folin phenol reagent. J Biol Chem. 193:265–275. 1951.PubMed/NCBI

10 

Chaffer CL and Weinberg RA: A perspective on cancer cell metastasis. Science. 331:1559–1564. 2011. View Article : Google Scholar : PubMed/NCBI

11 

Steeg PS: Tumor metastasis: mechanistic insights and clinical challenges. Nat Med. 12:895–904. 2006. View Article : Google Scholar : PubMed/NCBI

12 

Thiery JP, Acloque H, Huang RY and Nieto MA: Epithelial-mesenchymal transitions in development and disease. Cell. 139:871–890. 2009. View Article : Google Scholar : PubMed/NCBI

13 

Fu Y, Zheng S, An N, et al: β-catenin as a potential key target for tumor suppression. Int J Cancer. 129:1541–1551. 2011.

14 

DiMeo TA, Anderson K, Phadke P, et al: A novel lung metastasis signature links Wnt signaling with cancer cell self-renewal and epithelial-mesenchymal transition in basal-like breast cancer. Cancer Res. 69:5364–5373. 2009. View Article : Google Scholar : PubMed/NCBI

15 

Lin SY, Xia W, Wang JC, et al: Beta-catenin, a novel prognostic marker for breast cancer: its roles in cyclin D1 expression and cancer progression. Proc Natl Acad Sci USA. 97:4262–4266. 2000. View Article : Google Scholar : PubMed/NCBI

16 

Brabletz T, Jung A, Reu S, et al: Variable beta-catenin expression in colorectal cancers indicates tumor progression driven by the tumor environment. Proc Natl Acad Sci USA. 98:10356–10361. 2001. View Article : Google Scholar : PubMed/NCBI

17 

Khan S, Aspe JR, Asumen MG, et al: Extracellular, cell-permeable survivin inhibits apoptosis while promoting proliferative and metastatic potential. Br J Cancer. 100:1073–1086. 2009. View Article : Google Scholar : PubMed/NCBI

18 

Woodward WA, Chen MS, Behbod F, Alfaro MP, Buchholz TA and Rosen JM: WNT/beta-catenin mediates radiation resistance of mouse mammary progenitor cells. Proc Natl Acad Sci USA. 104:618–623. 2007. View Article : Google Scholar : PubMed/NCBI

19 

Schöler HR, Dressler GR, Balling R, Rohdewohld H and Gruss P: Oct-4: a germline-specific transcription factor mapping to the mouse t-complex. EMBO J. 9:2185–2195. 1990.PubMed/NCBI

20 

Schöler HR, Ruppert S, Suzuki N, Chowdhury K and Gruss P: New type of POU domain in germ line-specific protein Oct-4. Nature. 344:435–439. 1990.PubMed/NCBI

21 

Nakanishi T, Chumsri S, Khakpour N, et al: Side-population cells in luminal-type breast cancer have tumour-initiating cell properties, and are regulated by HER2 expression and signalling. Br J Cancer. 102:815–826. 2010. View Article : Google Scholar : PubMed/NCBI

22 

Nguyen NP, Almeida FS, Chi A, et al: Molecular biology of breast cancer stem cells: potential clinical applications. Cancer Treat Rev. 36:485–491. 2010. View Article : Google Scholar : PubMed/NCBI

23 

Abaan OD, Mutlu PK, Baran Y, Atalay C and Gunduz U: Multidrug resistance mediated by MRP1 gene overexpression in breast cancer patients. Cancer Invest. 27:201–205. 2009. View Article : Google Scholar : PubMed/NCBI

24 

Wang JS, Zheng CL, Wang YJ, et al: Gene silencing of beta-catenin by RNAi inhibits cell proliferation in human esophageal cancer cells in vitro and in nude mice. Dis Esophagus. 22:151–162. 2009. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Lv X, Pang X, Jin X, Song Y and Li H: β‑catenin knockdown enhances the effects of fluorouracil in the breast cancer cell line MDA‑MB‑468. Biomed Rep 2: 910-914, 2014.
APA
Lv, X., Pang, X., Jin, X., Song, Y., & Li, H. (2014). β‑catenin knockdown enhances the effects of fluorouracil in the breast cancer cell line MDA‑MB‑468. Biomedical Reports, 2, 910-914. https://doi.org/10.3892/br.2014.353
MLA
Lv, X., Pang, X., Jin, X., Song, Y., Li, H."β‑catenin knockdown enhances the effects of fluorouracil in the breast cancer cell line MDA‑MB‑468". Biomedical Reports 2.6 (2014): 910-914.
Chicago
Lv, X., Pang, X., Jin, X., Song, Y., Li, H."β‑catenin knockdown enhances the effects of fluorouracil in the breast cancer cell line MDA‑MB‑468". Biomedical Reports 2, no. 6 (2014): 910-914. https://doi.org/10.3892/br.2014.353
Copy and paste a formatted citation
x
Spandidos Publications style
Lv X, Pang X, Jin X, Song Y and Li H: β‑catenin knockdown enhances the effects of fluorouracil in the breast cancer cell line MDA‑MB‑468. Biomed Rep 2: 910-914, 2014.
APA
Lv, X., Pang, X., Jin, X., Song, Y., & Li, H. (2014). β‑catenin knockdown enhances the effects of fluorouracil in the breast cancer cell line MDA‑MB‑468. Biomedical Reports, 2, 910-914. https://doi.org/10.3892/br.2014.353
MLA
Lv, X., Pang, X., Jin, X., Song, Y., Li, H."β‑catenin knockdown enhances the effects of fluorouracil in the breast cancer cell line MDA‑MB‑468". Biomedical Reports 2.6 (2014): 910-914.
Chicago
Lv, X., Pang, X., Jin, X., Song, Y., Li, H."β‑catenin knockdown enhances the effects of fluorouracil in the breast cancer cell line MDA‑MB‑468". Biomedical Reports 2, no. 6 (2014): 910-914. https://doi.org/10.3892/br.2014.353
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team