
Absence of telomerase reverse transcriptase promoter mutations in neuroblastoma
- Authors:
- Published online on: May 13, 2015 https://doi.org/10.3892/br.2015.463
- Pages: 443-446
-
Copyright: © Lindner et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
Abstract
Introduction
Each mitotic cell division results in the shortening of telomeres (1). In somatic cells, subsequent shortening of telomeres eventually leads to senescence. The multiunit enzyme telomerase maintains telomere length by adding repetitive sequences to telomeres at each replicative cycle. However, the telomerase activity is absent in somatic cells. By contrast, malignant cells (re-)express telomerase or use an alternative mechanism to maintain telomere length, known as alternative lengthening of telomeres (ALT) (2).
Telomerase reverse transcriptase (TERT) is an essential part of the telomerase enzyme complex (3). Most recently, specific point mutations were described in the promoter region of the TERT gene in familial and sporadic melanoma (4). These point mutations lead to a cytosine to thymine exchange at the positions 228 or 250 upstream of the start codon of TERT, further referred to as C228T and C250T, respectively (3–5). Through these mutations, the TERT promoter acquires novel binding sites for the E twenty-six transcription factor, resulting in increased TERT expression (6). Subsequently, TERT promoter mutations were described in a variety of tumors, including several neuronal tumors as medulloblastoma (7) and glioma, as well as other tumor entities (4,5). Of note, the presence of TERT promoter mutations often correlated with aggressive disease and an adverse outcome.
Neuroblastoma is the most common extracranial tumor during childhood arising from the neural-crest (8,9). Only few recurrent mutations or genomic rearrangements have been described thus far (10). Among these are the genomic amplifications of MYCN and activating mutations of anaplastic lymphoma kinase. Most recently, two independent studies described ALT through mutations in the transcriptional regulator α-thalassemia/mental retardation X-linked (ATRX) in a minor fraction of neuroblastomas (11,12). Although the ALT phenotype may not be limited to neuroblastomas with ATRX mutations, the majority of neuroblastomas express telomerase and in particular TERT (13). Of note, high TERT expression was detected in MYCN-amplified tumors, but even in MYCN single copy neuroblastomas a high TERT expression correlated with adverse outcome (13). By contrast, low or absent TERT expression was detected in favorable neuroblastomas and absence of telomerase activity has been proposed as a potential mechanism to explain the high rate of spontaneous regression of favorable neuroblastomas (14). While MYCN is known to induce TERT transcription (15,16) and TERT amplification has been described in few neuroblastoma cases (17), the mechanism that drives TERT expression remains elusive in the majority of neuroblastomas.
As TERT promoter mutations are frequent in neural-crest-derived melanoma, as well as in various neuronal tumors including medulloblastoma, the present study analyzed the frequency of TERT promoter mutations in neuroblastoma.
Materials and methods
Primary tumor samples
Primary tumor samples and patient data were obtained from the German Society of Pediatric Oncology and Hematology Tumor Bank and Neuroblastoma Study Center (Cologne, Germany), respectively. All the patients were registered with the German neuroblastoma study and written informed consent was obtained. A tumor content of ≥60% was confirmed by a pathologist. DNA was isolated from ~20 mg of snap-frozen tissue obtained prior to cytotoxic treatment using the Puregene Blood Core kit B (Qiagen, Hilden, Germany), according to the manufacturer's instructions.
Cell culture
Neuroblastoma cell lines BEC(2), CHP134, IMR-32, IMR-5-75, KCN, KCN(R), Kelly, LAN1, LAN5, LAN6, NGP, NLF, SH-EP, SH-SY5Y, SK-N-AS, SK-N-BE, SK-N-FI and SK-N-SH were cultured in RPMI-1640 supplemented with 10% fetal calf serum, 5% penicillin (100 U/ml) and streptomycin (100 µg/ml) until reaching a confluence of 70%. Cells were collected and DNA was isolated using the QIAamp DNA kit (Qiagen). All the cell lines were authenticated by short tandem repeat genotyping performed by DSMZ (Braunschweig, Germany) or IDEXX GmbH (Ludwigsburg, Germany).
Polymerase chain reaction (PCR) and sequencing
DNA (100 ng) was used for the PCR reaction. To each PCR reaction, TERT forward (ACGAACGTGGCCAGCGGCAG) and reverse primers (CTGGCGTCCCTGCACCCTGG) were added to amplify a 474-base pair (bp) long region of the TERT promoter (390-bp upstream and 80-bp downstream of the start codon). The PCR program used was as follows: 95°C for 180 sec, followed by 95°C for 30 sec, 62°C for 45 sec and 72°C for 60 sec repeated 35 times, and a final amplification step at 72°C for 600 sec. Sanger sequencing was performed by Sequence Laboratories Göttingen GmbH (Göttingen, Germany).
Reverse transcription-quantitative PCR (RT-qPCR)
Total RNA was isolated from cells using the RNeasyMini kit (Qiagen) and cDNA synthesis was performed using the SuperScript® RT kit (Invitrogen Life Technologies, Darmstadt, Germany). TERT expression was monitored using the QuantiTect Primer Assay™ (Qiagen). Expression values were normalized to the geometric mean of GAPDH (18). Data analysis and error propagation were performed using the qbasePLUS software version 1.5 (http://www.biogazelle.com).
Pyrosequencing
To determine the presence of the mutant C228T allele or the wild-type allele using pyrosequencing, the following primers were used to amplify a 151-bp amplicon: Biotinylated forward primer 5′-BIOTIN-CTTCACCTTCCAGCTCCGC-3′, and reverse primer 5′-CGCTGCCTGAAACTCGC-3′. The PCR products were analyzed by pyrosequencing using the primer 5′-GAGGGGCTGGGAGGGCCC-3′, on the PyroMark Q96 MD system according to the manufacturer's instructions (Qiagen) and as previously described (19). Results were analyzed using PyroMark MD 1.0 software (Biotage, Uppsala, Sweden).
Genome-wide single-nucleotide polymorphism (SNP) analysis
SNP array experiments were performed according to the standard protocol for Affymetrix CytoScanHD arrays (Affymetrix, Inc., Santa Clara, CA, USA). In brief, a 250-ng sample of genomic DNA was digested with NspI, ligated to adaptors, amplified by PCR, fragmented and biotin-labeled. The labeled samples were hybridized to Affymetrix CytoscanHD arrays, followed by washing, staining and scanning in the Affymetrix GeneChip Scanner 3000. Analysis was performed using the Affymetrix Chromosome Analysis Suite v2.1.
Results
TERT promoter mutations are absent in primary neuroblastomas
To determine the frequency of TERT promoter mutations in neuroblastoma, including the previously described C228T and C250T mutations, the respective TERT promoter region of 131 primary neuroblastomas was sequenced. These tumors represented the whole spectrum of neuroblastoma regarding stage, MYCN and 1p36 status (Table I). Of note, none of the analyzed neuroblastomas harbored a C228T or a C250T mutation in the TERT promoter region.
TERT promoter mutations in neuroblastoma cell lines
In addition to primary neuroblastomas, 19 neuroblastoma cell lines were analyzed. In 3 out of 19 analyzed cell lines (16%) a mutation of the TERT promoter was detected. The neuroblastoma cell lines SK-N-SH, SH-SY5Y and SH-EP harbor the C228T mutation (Fig. 1A–C). Of note, SH-SY5Y and SH-EP are subclones of SK-N-SH (20). SK-N-SH was established from a bone marrow biopsy of a 4-year-old girl (21,22). The presence of the C228T TERT promoter mutation in SK-N-SH, SH-SY5Y and SH-EP was independently validated using pyrosequencing (Fig. 1B). As the C228T mutation appeared to be homozygous in SK-N-SH, SH-SY5Y and SH-EP, Affymetrix Human SNP array 6.0 arrays were used to analyze zygosity. The 3 probes located within the TERT gene were homozygeous in all three cell lines, which could point to the presence of a small loss-of-heterozygosity region spanning the TERT gene (Table II). To analyze if the mutations in the TERT promoter correlate with increased TERT expression, the expression was analyzed in all the neuroblastoma cell lines using RT-qPCR. No correlation between mutations and TERT expression was detected (Fig. 1D).
![]() | Table II.Location of the Affymetrix CytoScanHD array probes located within or near the TERT gene. The probes lying within the TERT gene showed a loss of heterozygousity for SH-EP, SH-SY5Y and SK-N-SH. Probes lying outside of the TERT gene showed a heterozygous status. |
Discussion
Analysis of the TERT gene promotor region in 20 neuroblastoma cell lines and 131 primary neuroblastoma tumors revealed mutations in 3 cell lines and no mutations in primary tumors.
Of note, the only 3 mutated cell lines, which harbor the C228T mutation, are SK-N-SH and its 2 subclones SH-EP and SH-SY5Y, further limiting the general indication of this finding. It is uncommon that TERT mutations occur homozygously, as detected in SK-N-SH, SH-EP and SY5Y. However, further analysis confirmed a loss-of-heterozygosity region in the region of the TERT gene, pointing to a hemizygous rather than a homozygous status of the C228T mutation in these cases. Taking into consideration the variable levels of TERT expression in SK-N-SH, SH-EP and SH-SY5Y cells, the functional indication of the C228T mutations in these cell lines remain questionable.
The absence of TERT mutations in primary neuroblastomas and the majority of analyzed cell lines is unexpected, as TERT expression is of pathogenic relevance in the majority of neuroblastomas (13) and TERT mutations are frequent in related neuroectodermal tumors, such as melanoma and medulloblastoma (4,7,23,24). However, the present results are in line with previous studies by Papathomas et al (25), who did not find TERT promoter mutations in 15 primary neuroblastomas and Killela et al (23), who identified only 2 TERT promoter mutations in 22 neuroblastomas.
The mechanisms by which TERT expression is induced, particularly in MYCN non-amplified high-risk neuroblastomas, remains elusive and warrants further studies. Potential alternative mechanisms underlying TERT induction in neuroblastoma include epigenetic changes, as well as mutations in more distant regulatory elements that were not analyzed in the present study.
Taken together, we conclude that TERT (core) promoter mutations are not relevant events in neuroblastoma pathogenesis.
Acknowledgements
The authors acknowledge the funding from the German Ministry for Education and Research (e:MED grant nos. SMOOSE FKZ: 01ZX1303B and SYSMED-NB FKZ: 01ZX1307E to J.H.S.) and the German Cancer Aid (grant no. 111301 to J.H.S.).
References
Shay JW and Wright WE: Role of telomeres and telomerase in cancer. Semin Cancer Biol. 21:349–353. 2011. View Article : Google Scholar : PubMed/NCBI | |
Nabetani A and Ishikawa F: Alternative lengthening of telomeres pathway: Recombination-mediated telomere maintenance mechanism in human cells. J Biochem. 149:5–14. 2011. View Article : Google Scholar : PubMed/NCBI | |
Griewank KG, Murali R, Schilling B, Scholz S, Sucker A, Song M, Süsskind D, Grabellus F, Zimmer L, Hillen U, et al: TERT promoter mutations in ocular melanoma distinguish between conjunctival and uveal tumours. Br J Cancer. 109:497–501. 2013. View Article : Google Scholar : PubMed/NCBI | |
Horn S, Figl A, Rachakonda PS, Fischer C, Sucker A, Gast A, Kadel S, Moll I, Nagore E, Hemminki K, et al: TERT promoter mutations in familial and sporadic melanoma. Science. 339:959–961. 2013. View Article : Google Scholar : PubMed/NCBI | |
Huang FW, Hodis E, Xu MJ, Kryukov GV, Chin L and Garraway LA: Highly recurrent TERT promoter mutations in human melanoma. Science. 339:957–959. 2013. View Article : Google Scholar : PubMed/NCBI | |
Xu D, Dwyer J, Li H, Duan W and Liu JP: Ets2 maintains hTERT gene expression and breast cancer cell proliferation by interacting with c-Myc. J Biol Chem. 283:23567–23580. 2008. View Article : Google Scholar : PubMed/NCBI | |
Remke M, Ramaswamy V, Peacock J, Shih DJ, Koelsche C, Northcott PA, Hill N, Cavalli FM, Kool M, Wang X, et al: TERT promoter mutations are highly recurrent in SHH subgroup medulloblastoma. Acta Neuropathol. 126:917–929. 2013. View Article : Google Scholar : PubMed/NCBI | |
Weiss WA, Aldape K, Mohapatra G, Feuerstein BG and Bishop JM: Targeted expression of MYCN causes neuroblastoma in transgenic mice. EMBO J. 16:2985–2995. 1997. View Article : Google Scholar : PubMed/NCBI | |
Maris JM, Hogarty MD, Bagatell R and Cohn SL: Neuroblastoma. Lancet. 369:2106–2120. 2007. View Article : Google Scholar : PubMed/NCBI | |
Pugh TJ, Morozova O, Attiyeh EF, Asgharzadeh S, Wei JS, Auclair D, Carter SL, Cibulskis K, Hanna M, Kiezun A, et al: The genetic landscape of high-risk neuroblastoma. Nat Genet. 45:279–284. 2013. View Article : Google Scholar : PubMed/NCBI | |
Molenaar JJ, Koster J, Zwijnenburg DA, van Sluis P, Valentijn LJ, van der Ploeg I, Hamdi M, van Nes J, Westerman BA, van Arkel J, et al: Sequencing of neuroblastoma identifies chromothripsis and defects in neuritogenesis genes. Nature. 483:589–593. 2012. View Article : Google Scholar : PubMed/NCBI | |
Cheung NK, Zhang J, Lu C, Parker M, Bahrami A, Tickoo SK, Heguy A, Pappo AS, Federico S, Dalton J, et al: St Jude Children's Research Hospital-Washington University Pediatric Cancer Genome Project: Association of age at diagnosis and genetic mutations in patients with neuroblastoma. JAMA. 307:1062–1071. 2012. View Article : Google Scholar : PubMed/NCBI | |
Poremba C, Scheel C, Hero B, Christiansen H, Schaefer KL, Nakayama Ji, Berthold F, Juergens H, Boecker W and Dockhorn-Dworniczak B: Telomerase activity and telomerase subunits gene expression patterns in neuroblastoma: A molecular and immunohistochemical study establishing prognostic tools for fresh-frozen and paraffin-embedded tissues. J Clin Oncol. 18:2582–2592. 2000.PubMed/NCBI | |
Brodeur GM and Bagatell R: Mechanisms of neuroblastoma regression. Nat Rev Clin Oncol. 11:704–713. 2014. View Article : Google Scholar : PubMed/NCBI | |
Mac SM, D'Cunha CA and Farnham PJ: Direct recruitment of N-myc to target gene promoters. Mol Carcinog. 29:76–86. 2000. View Article : Google Scholar : PubMed/NCBI | |
Schulte JH, Horn S, Otto T, et al: MYCN regulates oncogenic MicroRNAs in neuroblastoma. Int J Cancer. 122:699–704. 2008. View Article : Google Scholar : PubMed/NCBI | |
Cobrinik D, Ostrovnaya I, Hassimi M, Tickoo SK, Cheung IY and Cheung NK: Recurrent pre-existing and acquired DNA copy number alterations, including focal TERT gains, in neuroblastoma central nervous system metastases. Genes Chromosomes Cancer. 52:1150–1166. 2013. View Article : Google Scholar : PubMed/NCBI | |
Vandesompele J, De Preter K, Pattyn F, et al: Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 3:RESEARCH0034. 2002. View Article : Google Scholar : PubMed/NCBI | |
Bachmann HS, Heukamp LC, Schmitz KJ, et al: Regulatory BCL2 promoter polymorphism (−938C>A) is associated with adverse outcome in patients with prostate carcinoma. International journal of cancer. Int J Cancer. 129:2390–2399. 2011. View Article : Google Scholar : PubMed/NCBI | |
Sadée W, Yu VC, Richards ML, Preis PN, Schwab MR, Brodsky FM and Biedler JL: Expression of neurotransmitter receptors and myc protooncogenes in subclones of a human neuroblastoma cell line. Cancer Res. 47:5207–5212. 1987.PubMed/NCBI | |
Barnes EN, Biedler JL, Spengler BA and Lyser KM: The fine structure of continuous human neuroblastoma lines SK-N-SH, SK-N-BE(2) and SK-N-MC. In Vitro. 17:619–631. 1981. View Article : Google Scholar : PubMed/NCBI | |
Biedler JL, Helson L and Spengler BA: Morphology and growth, tumorigenicity and cytogenetics of human neuroblastoma cells in continuous culture. Cancer Res. 33:2643–2652. 1973.PubMed/NCBI | |
Killela PJ, Reitman ZJ, Jiao Y, Bettegowda C, Agrawal N, Diaz LA Jr, Friedman AH, Friedman H, Gallia GL, Giovanella BC, et al: TERT promoter mutations occur frequently in gliomas and a subset of tumors derived from cells with low rates of self-renewal. Proc Natl Acad Sci USA. 110:6021–6026. 2013. View Article : Google Scholar : PubMed/NCBI | |
Lindsey JC, Schwalbe EC, Potluri S, Bailey S, Williamson D and Clifford SC: TERT promoter mutation and aberrant hypermethylation are associated with elevated expression in medulloblastoma and characterise the majority of non-infant SHH subgroup tumours. Acta Neuropathol. 127:307–309. 2014. View Article : Google Scholar : PubMed/NCBI | |
Papathomas TG, Oudijk L, Zwarthoff EC, Post E, Duijkers FA, van Noesel MM, Hofland LJ, Pollard PJ, Maher ER, Restuccia DF, et al: Telomerase reverse transcriptase promoter mutations in tumors originating from the adrenal gland and extra-adrenal paraganglia. Endocr Relat Cancer. 21:653–661. 2014. View Article : Google Scholar : PubMed/NCBI |