Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Biomedical Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 2049-9434 Online ISSN: 2049-9442
Journal Cover
January-2018 Volume 8 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
January-2018 Volume 8 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Neuroprotective effects of selegiline on rat neural stem cells treated with hydrogen peroxide

  • Authors:
    • Alireza Abdanipour
    • Iraj Jafari Anarkooli
    • Saeed Shokri
    • Mehrdad Ghorbanlou
    • Vahid Bayati
    • Reza Nejatbakhsh
  • View Affiliations / Copyright

    Affiliations: Department of Anatomical Sciences, School of Medicine, Zanjan University of Medical Sciences, Zanjan 45139‑56184, Iran, Cellular and Molecular Research Center, School of Medicine, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Khuzestan 6135715794, Iran
  • Pages: 41-46
    |
    Published online on: November 22, 2017
       https://doi.org/10.3892/br.2017.1023
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Oxidative stress and reactive oxygen species generation have been implicated in the pathogenesis of several neurological disorders including Parkinson's disease, Alzheimer's disease, amyotrophic lateral sclerosis and multiple sclerosis. In the present study, the neuroprotective effects of selegiline against hydrogen peroxide‑induced oxidative stress in hippocampus‑derived neural stem cells (NSCs) were evaluated. NSCs isolated from neonatal Wistar rats were pretreated with different doses of selegiline for 48 h and then exposed to 125 µM H2O2 for 30 min. Using MTT and terminal deoxynucleotidyl transferase‑mediated dUTP nick end labeling assays, acridine orange/ethidium bromide staining and reverse transcription‑quantitative polymerase chain reaction, the effects of selegiline on cell survival, apoptosis and the expression of B‑cell lymphoma 2 (Bcl‑2) and heat shock protein 4 (Hspa4) in pretreated stem cells were assessed compared with a control group lacking pretreatment. The results indicated that the viability of cells pretreated with 20 µM selegiline was significantly increased compared with the control group (P<0.05). Additionally, 20 µM selegiline increased the mRNA expression of Bcl‑2 and Hspa4 (P<0.05 vs. control) and suppressed oxidative stress‑induced cell death (apoptosis and necrosis; P<0.05 vs. control and 10 µM groups). From these findings, it was concluded that selegiline may be a therapeutic candidate for the treatment of neurological diseases mediated by oxidative stress.

Introduction

The most common neorodegenerative disorders, namely Alzheimer's disease (AD) and Parkinson's disease (PD), are prevalent in ~1% of individuals aged 60 years and older (1). Their etiologies remain uncertain, though there are a number of established pathogenic factors, including oxidative stress, neural apoptosis, mitochondrial dysfunction, excitotoxicity, impairment of the ubiquitin-proteasome system and inflammation (2,3). Neuroprotective therapy has been suggested to prevent disease progression by inhibiting the action of pathogenic factors, for instance, by reducing the production of reactive oxygen species (ROS) (4). Overproduction of ROS may cause oxidative damage to biomolecules and subsequently DNA damage, ultimately leading to the development of neurodegenerative diseases. According to studies on PD, inhibitors of type B monoamine oxidase (MAO), including selegiline [also known as (−)-deprenyl] and rasagiline, are among the most promising neuroprotective agents identified to date (5–7). MAO exists in two forms, MAO-A and -B. The catalytic activity of these enzymes generates H2O2 and nitrogen species, which are toxic products that may cause oxidative damage to mitochondrial DNA (mtDNA) and thus have potential implications for apoptosis, aging and neurodegenerative processes (8). The MAO-B inhibitor, selegiline, is typically recommended as a first-line treatment for PD and has been demonstrated to possess neuroprotective functions (9); notably, this inhibitor protected neuronal cells against induced cell death in cellular and animal models (10,11). The neuroprotective functions of selegiline have been attributed to stabilization of the mitochondria, to the prevention of death signaling processes, and to upregulation of the anti-apoptotic B-cell lymphoma 2 (Bcl-2) protein family and neurotrophic factors (10,11). Previous studies have also indicated that MAO inhibitors suppress H2O2-induced oxidative stress and attenuate the induced cell injury by promoting expression of the Bcl-2 family (10,11). Unlike other drugs with neuroprotective properties, selegiline and its metabolites are able to cross the blood-brain barrier, following which they exhibit highest accumulation in the thalamus, basal ganglia, mesencephalon and cingulate gyrus (12,13).

As a follow-up to previous research by our group (14,15), the present study investigated the in vitro therapeutic effects of selegiline on the apoptosis and survival of hippocampus-derived rat neural stem cells (NSCs) treated with hydrogen peroxide, namely through MTT and terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL) assays and acridine orange/ethidium bromide staining, along with reverse transcription-quantitative polymerase chain reaction (RT-qPCR) to determine the expression of heat shock protein 4 (Hspa4) and Bcl-2.

Materials and methods

Isolation and expansion of NSCs

NSCs were isolated from the hippocampus of 5 neonatal Wistar rats (10 days old) purchased from the the Razi Vaccine and Serum Research Institute (Karaj, Iran) using a neurosphere assay as described previously (16). Prior to cell isolation, the rats were housed under a 12-h light/dark cycle at 24°C and 30–35% humidity with food and water available ad libitum. NSCs were collected from the hippocampus of the rats under anesthesia with ketamine (100 mg/kg) and xylazine (10 mg/kg; intraperitoneal injection). The dissected hippocampi were washed in phosphate-buffered saline (PBS) supplemented with 4.5 g/l glucose solution and then centrifuged for 5 min at 1,600 × g and 4°C. The collected tissues in the pellet were dissociated for 30 min at room temperature (RT) using a digestion mixture of 2.5 U/ml papain (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany), 40 U/ml dispase II (Sigma-Aldrich; Merck KGaA) and 400 U/ml accutase (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA), with mixing of the solution every 10 min. Subsequently, the cell mixture was passed through a 70-µm cell strainer and then centrifuged for 5 min at 800 × g and 4°C. Following centrifugation, the pellets were resuspended in 1 ml Dulbecco's modified Eagle's medium F-12 (DMEM/F12; Invitrogen; Thermo Fisher Scientific, Inc.). The isolated cells were seeded in a 25-cm2 non-adherent plastic flask (105 cells/ml) in DMEM/F12 supplemented with 2% B27 supplement (Gibco; Thermo Fisher Scientific, Inc.), 20 ng/ml basic fibroblast growth factor (bFGF; Invitrogen; Thermo Fisher Scientific, Inc.), 20 ng/ml epidermal growth factor (EGF; Invitrogen; Thermo Fisher Scientific, Inc.), 100 U/ml penicillin and 100 mg/ml streptomycin and incubated at 37°C in 5% CO2 for 1–2 weeks to enable neurosphere formation. The medium and growth factors were replenished every 2 days. Following this, floating neurospheres were collected by centrifugation at 300 × g for 5 min at RT. They were then dissociated enzymatically using trypsin-EDTA (0.25%) and mechanically (by pipetting) to single cells. The cells were then suspended in DMEM/F12 supplemented with 2% B27, 20 ng/ml bFGF, 20 ng/ml EGF and 5% fetal bovine serum (Sigma-Aldrich; Merck KGaA) for 1 week at 37°C and 5% CO2 in 6-well adherent plates (5×106 cells/well) coated with poly-l-lysine (Sigma-Aldrich; Merck KGaA) and passaged up to three times. Nestin as a neural stem/precursor cell marker (17) was evaluated immunocytochemically. The present study adhered to institutional guidelines for the care and use of laboratory animals, and all experimental procedures were reviewed and approved by the Ethics Committee for the Use of Experimental Animals at Tarbiat Modares University (Tehran, Iran).

Selegiline cell treatments

H2O2 was used to induce oxidative stress, and was prepared from 30% stock solution prior to each experiment. Third-passage NSCs were cultured in 96-well plates (105 cells/well) in DMEM/F12 medium supplemented with 2% B27, 20 ng/ml bFGF and 20 ng/ml EGF. The NSCs were then incubated at 37°C in 5% CO2 with 125 µM H2O2 for 30 min. To evaluate the neuroprotective effects of selegiline, cells were pretreated with different concentrations of selegiline (Sigma-Aldrich; Merck KGaA; 0, 10, 20, 30 and 40 µM) 48 h prior to the H2O2 treatment. NSCs without selegilin treatment (0 µM) were used as a control group. The control cells were cultured in the above DMEM/F12 medium for 48 h at 37°C, then treated with 125 µM H2O2 for 30 min.

Immunostaining

The hippocampus-derived NSCs were cultured on cover slides (5×103 cells/slide) in the supplemented DMEM/F12 (2% B27, 20 ng/ml bFGF and 20 ng/ml EGF) for 48 h at 37°C in 5% CO2, then fixed in 3% paraformaldehyde for 20 min at RT. The cells were then permeabilized in 100% methanol for 30 min at RT to enable antibody-antigen interaction. For immunofluorescence, the cells were incubated with anti-nestin monoclonal antibodies, (1:200; ab6142; Abcam, Cambridge, UK) for 2 h at 4°C, then with fluorescein isothiocyanate-conjugated rabbit anti-mouse antibody (1:300; ab6724; Abcam) for 2 h at RT. Nuclei were counterstained with ethidium bromide for 1 min at RT to visualize the nuclei. Following staining, cells were examined using an inverted fluorescence microscope and the number of immunopositive cells were counted in a minimum of 100 cells per experiment. Corresponding negative controls were established using secondary antibodies without primary antibody incubation, to exclude nonspecific binding of secondary antibody to the sample.

Viability assay

Cell viability was evaluated using an MTT bromide assay, as described previously (18). Cells were treated with 125 µM H2O2 and different concentrations of selegiline 48 h before the H2O2 treatment. The treated cells were incubated with 1 mg/ml MTT (Sigma Aldrich; Merck KGaA) for 4 h, after which the culture medium (DMEM/F12 with 2% B27, 20 ng/ml bFGF and 20 ng/ml EGF) was removed and 100 µl dimethyl sulfoxide was added to each well to dissolve the formazan crystals. The quantity of formazan dissolved was quantified from absorbance at 570 nm (A570) using a microplate ELISA reader, and relative cell viability (%) was calculated as follows: (A570 of treated samples/A570 of controls) ×100 (19,20).

TUNEL detection of apoptotic cells

Following treatment, the NSCs were fixed with 4% paraformaldehyde in PBS for 30 min at RT. The cells were subjected to a TUNEL assay using an In-Situ Cell Death Detection kit (Roche Applied Science, Penzberg, Germany) according to the manufacturer's instructions. TUNEL-positive cells were labeled using diaminobenzidine as the chromogen for 3–7 min at RT, and counterstained with hematoxylin for 5 min at RT. The percentage of TUNEL-positive cells was assessed using an Olympus phase contrast fluorescence microscope (Olympus Corporation, Tokyo, Japan) in five randomly selected fields for each well.

Acridine orange/ethidium bromide staining

Necrotic morphological changes in the treated cells were assessed by acridine orange/ethidium bromide staining. Following the selegiline and H2O2 treatments, the NSCs were washed with PBS buffer and fixed with 4% paraformaldehyde for 15 min at RT, then stained with acridine orange/ethidium bromide (Sigma-Aldrich; Merck KGaA; 100 µg/ml of each) for 5 min at RT. The number of necrotic cells, identified by orange/yellow cytoplasmic staining and by non-condensed chromatin and/or non-fragmented nuclei (21), were counted in a total of 200 cells. The cells were observed using a fluorescence microscope.

RT-qPCR

RT-qPCR was performed with cDNA obtained from the 0 (control) and 20 µM selegiline groups following induced oxidative stress. A total of 1,000 ng purified RNA obtained from cultured cells with TRIzol (Invitrogen; Thermo Fisher Scientific, Inc.) was used to synthesize 20 µl cDNA using a RevertAid™ First Strand cDNA Synthesis kit (Fermentas, Germany) according to the manufacturer's instructions. The cDNA was used to quantify Bcl-2 and Hspa4 mRNA levels, with β2-microglobulin (B2M) used as an internal control for normalization. The primer sequences of all primers used are listed in Table I. The PCR reaction was performed in a 25-µl final reaction volume [containing forward and reverse primers (200 nM each), cDNA (0.5 µl), SYBR®-Green I (12.5 µl; Fermentas; Thermo Fisher Scientific, Inc.) and nuclease-free water up to final volume] for 40 cycles at 95°C for 15 sec followed by 60°C for 1 min. Relative changes in target mRNA levels were determined using the ΔΔCq method (22).

Table I.

Primer sequences.

Table I.

Primer sequences.

GeneGenBank accession no.Forward, 5′-3′Reverse, 5′-3′
B2MNM_012512.2 CTTGCCATTCAGAAAACTCC CATCGGTCTCGGTGGGTG
Bcl-2NM_016993 ACGGTGGTGGAGGAACTCTTCAGG AATCAAACAGAGGTCGCATGCTGG
Hspa4NM_153629 GAGTGCGAATGCTTCAGACCTCCC CGTGTGGCTCCACCAACTATCTCC

[i] Primers were designed with Gene Runner 3.05 software (produced by info@genfanavaran.com). B2M, β2-microglobulin; Bcl-2, B-cell lymphoma 2; Hspa4, heat shock protein 4.

Statistical analysis

Data analysis was performed using SPSS 15.0 software (SPSS, Inc., Chicago, IL, USA). All data are presented as the mean ± standard error of the mean from 5 independent experiments. To compare differences between the means of multiple groups, one-way analysis of variance followed by Tukey's post hoc test was used. P<0.05 was considered to indicate statistical significance.

Results

Generation of NSCs

The results of the primary culture of hippocampus-derived NSCs are presented in Fig. 1A-D. Following NSC isolation and culture, single cells were observed to form primary neurospheres by day 7 (Fig. 1A). Secondary neurospheres originated from the primary neurospheres, and a homogeneous adherent NSC population was obtained after 3 passages (Fig. 1B). The majority of isolated cells (98.71±0.29%) exhibited positive staining for nestin marker (Fig. 1D), indicating successful isolation of NSCs, and negative controls incubated in the absence of primary antibody confirmed the specificity of labeling (data not shown).

Figure 1.

Representative photomicrographs of hippocampus-derived NSCs. (A) Floating neurospheres derived from rat hippocampus after culture for 7 days. (B) Hippocampus-derived NSCs at passage 3. (C) Phase contrast micrograph and (D) immunostaining of nestin (green) in the same field. Nuclei were counterstained with ethidium bromide (red). Magnification, ×200. NSC, neural stem cell.

Neuroprotective effect of selegiline on NSC viability

An MTT assay was performed to determine the neuroprotective effect of increasing concentrations of selegiline (0–40 µM) against oxidative stress induced by 125 µM H2O2. The attained values were normalized based on values of NSCs without any treatment (negative control group). As depicted in Fig. 2A, pretreatment with 20 µM selegiline for 48 h caused an increase in the percentage of viable cells (64.4±2.17%) compared with the 0 (29.66±2.04%; P<0.05) and 10 µM (58.44±6.60%) selegiline groups. However, further increases in selegiline concentration caused a decline in cell viability compared with the 20 µM selegiline group, which was deemed to be significant for 40 µM (44.94±2.94%; P<0.05).

Figure 2.

Effect of selegiline on cell viability, apoptosis and necrosis. (A) Mean percentages of viable, apoptotic and necrotic cells (relative to untreated cells) determined by MTT assay, TUNEL and acridine orange/ethidium bromide staining, respectively, following 125 µM H2O2 exposure with selegiline pretreatment. (B-E) Representative TUNEL and acridine orange staining images of NSCs at (B and D) 0 and (C and E) 20 µM selegiline followed by 125 µM H2O2 exposure. Red arrows indicate DNA fragmentation. Late necrotic NSCs exhibited orange/red staining in non-condensed, non-fragmented nuclei (white arrows). Counterstaining with hematoxylin is shown in blue. Magnification, ×200. The bars indicate the mean ± standard error of the mean. *P<0.05 vs. 20 µM group. NSC, neural stem cell; TUNEL, terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling.

Neuroprotective effect of selegiline on NSC survival

A TUNEL assay and acridine orange/ethidium bromide staining were performed to assess the pro-survival effects of selegiline in hippocampus-derived NSCs treated with increasing concentrations of selegiline for 48 h followed by H2O2 exposure. The TUNEL and necrotic cell staining indicated that H2O2 induced apoptotic and necrotic cell death (Fig. 2A-E). As depicted in Fig. 2A, pretreatment with 20 µM selegiline caused significant decreases in the percentages of apoptotic (30.10±1.48%) and necrotic (27.32±2.68%) cells compared with the 10 µM selegiline group (44.4±4.39 and 39.37±2.01%, respectively; P<0.05) and the 0 µM (control) group (67.84±3.91 and 59.74±3.07%, respectively; P<0.05). However, further increases in selegiline concentration caused increased rates of cell apoptosis and necrosis compared with the 20 µM selegiline group, which was deemed to be significant at 40 µM on cell apoptosis (33.89±2.21%; P<0.05).

Effect of selegiline on Bcl-2 and Hspa4 expression

Increased levels of Bcl-2 and Hspa4 mRNA in H2O2-induced NSCs pretreated with 20 µM selegiline for 48 h were confirmed by RT-qPCR (Fig. 3). Notably, following normalization to the expression of B2M, it was observed that the mRNA levels of Bcl-2 and Hspa4 were significantly increased in the 20 µM selegiline group (2.90±0.05 and 1.18±0.03, respectively) compared with the control group (1.01±0.11 and 0.77±0.02, respectively; P<0.05).

Figure 3.

Fold changes in Bcl-2 and Hspa4 mRNA expression in H2O2-induced NSCs treated with 20 µM selegiline. The results of polymerase chain reaction were presented as relative expression normalized to β2-microglobulin mRNA amplification. The bars indicate the mean ± standard error of the mean. *P<0.05 vs. 20 µM group. Bcl-2, B-cell lymphoma 2; Hspa4, heat shock protein 4; NSC, neural stem cell.

Discussion

In the present study, it was demonstrated that selegiline increased Bcl-2 and Hspa4 mRNA expression in hippocampus-derived NSCs, and protected the cells against H2O2-induced apoptosis and necrosis. It has previously been reported that free radicals serve a causal role in biomolecular damage and neuronal cell death following oxidative stress (2,23). In neurodegenerative disorders, a reduction of oxidative stress may attenuate apoptotic cell death and disease progression (24). MAO serves important roles in the generation of H2O2 and nitrogen species, and in apoptosis, aging and neurodegenerative processes (8,25). Furthermore, increased levels of MAO-B mRNA and enzymatic activity have been observed in neurodegenerative diseases including PD (26).

In vitro and in vivo experiments have demonstrated that selegiline is a potent inhibitor of MAO-B and also enhances the synthesis of neurotrophic factors including glial cell-derived neurotrophic factor and brain-derived neurotrophic factor (9,27,28). As a selective MAO-B inhibitor, selegiline may be used as an anti-PD drug to exert antioxidant and anti-apoptotic effects (29,30). It has also been indicated that selegiline decreases oxidative stress and cell death induced by 1-methyl-4-phenylpyridinium (MPP+), an inducing agent of PD (31). However, the protective effect of selegiline against MPP+-induced neuronal cell degeneration may be opposing dependent on concentration; while micromolar to submillimolar doses of selegiline promoted increased cell viability, concentrations of selegiline greater than 1 mM induced a decrease in cell viability in the MPP+-treated cells (32). This opposing effect of selegiline regarding anti-apoptotic activity has also been demonstrated in A-2058 human melanoma cell culture, in which selegiline at a concentration range of 10−7−10−3 M caused significant inhibition of apoptosis, while treatment 10−3 M selegiline caused 50% apoptosis after treatment for 72 h (29). The current results are in accordance with these previous studies.

The MAO-B inhibitors, rasagiline and selegiline, protect neuronal cells through upregulation of the pro-survival protein Bcl-2 and neurotrophic factors (33). In the present study, increases in the mRNA levels of Bcl-2 and Hspa4 were identified in hippocampal NSCs following treatment with 20 µM selegiline for 48 h. The Bcl-2 protein family controls the release of cytochrome c (Cyt-c) from the mitochondria and consists of pro-apoptotic (Bcl-2-associated X protein, Bcl-2 homologous antagonist/killer, BH3 interacting-domain death agonist, Bcl-2-associated death promoter) and anti-apoptotic [Bcl-2, Bcl-extra large (Bcl-xL)] members (34). The primary function of anti-apoptotic Bcl-2 is to suppress mitochondrial Cyt-c release, by regulating physiological membrane permeability, Ca2+ release and oxidative stress in the mitochondria (35,36). Specific regions of Bcl-2, namely the Bcl-2 homology-3 and −4 domains, exert anti-apoptotic effects in in vivo and in vitro models (37,38). Additionally, overexpression of Bcl-2 protein has been documented to reduce tissue damage in animal models of PD (39,40) and ischemia (41,42), and protects cells against apoptosis (43). Furthermore, Bcl-2 overexpression prevented Cyt-c release following peroxynitrite-induced apoptotic signaling, indicating the potential of Bcl-2 as a neuroprotective agent (44). In a previous study, selegiline increased the mRNA and protein levels of Bcl-2 and Bcl-xL in SH-SY5Y cells (45), but not in MAO-B-containing Caco-2 and U118MG cells (46,47). These studies are consistent with present findings regarding the significant upregulation of Bcl-2 and improved survival of NSCs in response to 20 µM selegiline.

Interestingly, it has been reported that Hspa4 may decrease the protein degradation and increase the stability of Bcl-2 during oxidative stress, and that an association may exist between Bcl-2 and the anti-apoptotic effect of Hspa4 (48). In consideration of the increases in Bcl-2 and Hspa4 mRNA and the potential role of Bcl-2 in the selegiline-treated group, the current study indicated that these factors may have been associated with the decreased percentages of necrotic and TUNEL-positive cells decreased in the 20 µM selegiline group compared with the 0 (control) and 10 µM groups.

In conclusion, the current data suggested that selegiline is effective in protecting NSCs against oxidative stress. Therefore, selegiline may be considered as a drug candidate for neurological disorders in which oxidative stress serves an important role in pathogenesis.

Acknowledgements

The authors would like to thank Dr Saeid Hashamein from the Stem Cell Laboratory of Islamic Azad University for assisting with the research. The study was partly funded by Islamic Azad University, Ardabil Branch (grant no. 91.502).

References

1 

DeMaagd G and Philip A: Parkinson's disease and its management: Part 1: Disease entity, risk factors, pathophysiology, clinical presentation, and diagnosis. PT. 40:504–532. 2015.

2 

Uttara B, Singh AV, Zamboni P and Mahajan RT: Oxidative stress and neurodegenerative diseases: A review of upstream and downstream antioxidant therapeutic options. Curr Neuropharmacol. 7:65–74. 2009. View Article : Google Scholar : PubMed/NCBI

3 

Guo C, Sun L, Chen X and Zhang D: Oxidative stress, mitochondrial damage and neurodegenerative diseases. Neural Regen Res. 8:2003–2014. 2013.PubMed/NCBI

4 

Sarkar S, Raymick J and Imam S: Neuroprotective and therapeutic strategies against Parkinson's disease: Recent Perspectives. Int J Mol Sci. 17:172016. View Article : Google Scholar

5 

Nayak L and Henchcliffe C: Rasagiline in treatment of Parkinson's disease. Neuropsychiatr Dis Treat. 4:23–32. 2008.PubMed/NCBI

6 

Riederer P and Laux G: MAO-inhibitors in Parkinson's disease. Exp Neurobiol. 20:1–17. 2011. View Article : Google Scholar : PubMed/NCBI

7 

Bonneh-Barkay D, Ziv N and Finberg JP: Characterization of the neuroprotective activity of rasagiline in cerebellar granule cells. Neuropharmacology. 48:406–416. 2005. View Article : Google Scholar : PubMed/NCBI

8 

Lu D, Johnson C, Johnson S, Tazik S and Ou XM: The neuroprotective effect of antidepressant drug via inhibition of TIEG2-MAO B mediated cell death. Drug Discov Ther. 2:289–295. 2008.PubMed/NCBI

9 

Zhao Q, Cai D and Bai Y: Selegiline rescues gait deficits and the loss of dopaminergic neurons in a subacute MPTP mouse model of Parkinson's disease. Int J Mol Med. 32:883–891. 2013.PubMed/NCBI

10 

Hara MR, Thomas B, Cascio MB, Bae BI, Hester LD, Dawson VL, Dawson TM, Sawa A and Snyder SH: Neuroprotection by pharmacologic blockade of the GAPDH death cascade. Proc Natl Acad Sci USA. 103:pp. 3887–3889. 2006; View Article : Google Scholar : PubMed/NCBI

11 

Maruyama W, Akao Y, Carrillo MC, Kitani K, Youdium MB and Naoi M: Neuroprotection by propargylamines in Parkinson's disease: Suppression of apoptosis and induction of prosurvival genes. Neurotoxicol Teratol. 24:675–682. 2002. View Article : Google Scholar : PubMed/NCBI

12 

Lecht S, Haroutiunian S, Hoffman A and Lazarovici P: Rasagiline - a novel MAO B inhibitor in Parkinson's disease therapy. Ther Clin Risk Manag. 3:467–474. 2007.PubMed/NCBI

13 

Fowler JS, Volkow ND, Logan J, Schlyer DJ, MacGregor RR, Wang GJ, Wolf AP, Pappas N, Alexoff D and Shea C: Monoamine oxidase B (MAO B) inhibitor therapy in Parkinson's disease: The degree and reversibility of human brain MAO B inhibition by Ro 19 6327. Neurology. 43:1984–1992. 1993. View Article : Google Scholar : PubMed/NCBI

14 

Abdanipour A, Tiraihi T and Delshad A: Trans-differentiation of the adipose tissue-derived stem cells into neuron-like cells expressing neurotrophins by selegiline. Iran Biomed J. 15:113–121. 2011.PubMed/NCBI

15 

Abdanipour A and Tiraihi T: Induction of adipose-derived stem cell into motoneuron-like cells using selegiline as preinducer. Brain Res. 1440:23–33. 2012. View Article : Google Scholar : PubMed/NCBI

16 

Abdanipour A, Sagha M, Noori-Zadeh A, Pakzad I and Tiraihi T: In vitro study of the long-term cortisol treatment effects on the growth rate and proliferation of the neural stem/precursor cells. Neurol Res. 37:117–124. 2015. View Article : Google Scholar : PubMed/NCBI

17 

Suzuki S, Namiki J, Shibata S, Mastuzaki Y and Okano H: The neural stem/progenitor cell marker nestin is expressed in proliferative endothelial cells, but not in mature vasculature. J Histochem Cytochem. 58:721–730. 2010. View Article : Google Scholar : PubMed/NCBI

18 

Gu J, Chi M, Sun X, Wang G, Li M, Liu L and Li X: Propofol-induced protection of SH-SY5Y cells against hydrogen peroxide is associated with the HO-1 via the ERK pathway. Int J Med Sci. 10:599–606. 2013. View Article : Google Scholar : PubMed/NCBI

19 

Han J, Talorete TP, Yamada P and Isoda H: Anti-proliferative and apoptotic effects of oleuropein and hydroxytyrosol on human breast cancer MCF-7 cells. Cytotechnology. 59:45–53. 2009. View Article : Google Scholar : PubMed/NCBI

20 

Abdanipour A, Noori-Zadeh A, Mesbah-Namin SA, Bakhtiyari S, Nejatbakhsh R and Anarkooli IJ: Di-(2-ethylhexyl) phthalate-induced hippocampus-derived neural stem cells proliferation. Cell J. 19:166–172. 2017.PubMed/NCBI

21 

Didenko VV, Ngo H and Baskin DS: Early necrotic DNA degradation: Presence of blunt-ended DNA breaks, 3′ and 5′ overhangs in apoptosis, but only 5′ overhangs in early necrosis. Am J Pathol. 162:1571–1578. 2003. View Article : Google Scholar : PubMed/NCBI

22 

Yuan JS, Reed A, Chen F and Stewart CN Jr: Statistical analysis of real-time PCR data. BMC Bioinformatics. 7:852006. View Article : Google Scholar : PubMed/NCBI

23 

Emerit J, Edeas M and Bricaire F: Neurodegenerative diseases and oxidative stress. Biomed Pharmacother. 58:39–46. 2004. View Article : Google Scholar : PubMed/NCBI

24 

Ischiropoulos H and Beckman JS: Oxidative stress and nitration in neurodegeneration: Cause, effect, or association? J Clin Invest. 111:163–169. 2003. View Article : Google Scholar : PubMed/NCBI

25 

Shih JC, Chen K and Ridd MJ: Monoamine oxidase: From genes to behavior. Annu Rev Neurosci. 22:197–217. 1999. View Article : Google Scholar : PubMed/NCBI

26 

Jakubauskiene E, Janaviciute V, Peciuliene I, Söderkvist P and Kanopka A: G/A polymorphism in intronic sequence affects the processing of MAO-B gene in patients with Parkinson disease. FEBS Lett. 586:3698–3704. 2012. View Article : Google Scholar : PubMed/NCBI

27 

Youdim MB, Gross A and Finberg JP: Rasagiline [N-propargyl-1R(+)-aminoindan], a selective and potent inhibitor of mitochondrial monoamine oxidase B. Br J Pharmacol. 132:500–506. 2001. View Article : Google Scholar : PubMed/NCBI

28 

Nagatsu T and Sawada M: Molecular mechanism of the relation of monoamine oxidase B and its inhibitors to Parkinson's disease: Possible implications of glial cells. J Neural Transm Suppl. 71:53–65. 2006. View Article : Google Scholar

29 

Magyar K and Szende B: (−)-Deprenyl, a selective MAO-B inhibitor, with apoptotic and anti-apoptotic properties. Neurotoxicology. 25:233–242. 2004. View Article : Google Scholar : PubMed/NCBI

30 

Tsao CM, Jhang JG, Chen SJ, Ka SM, Wu TC, Liaw WJ, Huang HC and Wu CC: Adjuvant potential of selegiline in attenuating organ dysfunction in septic rats with peritonitis. PLoS One. 9:e1084552014. View Article : Google Scholar : PubMed/NCBI

31 

Dias V, Junn E and Mouradian MM: The role of oxidative stress in Parkinson's disease. J Parkinsons Dis. 3:461–491. 2013.PubMed/NCBI

32 

Chetsawang B, Kooncumchoo P, Govitrapong P and Ebadi M: 1-Methyl-4-phenyl-pyridinium ion-induced oxidative stress, c-Jun phosphorylation and DNA fragmentation factor-45 cleavage in SK-N-SH cells are averted by selegiline. Neurochem Int. 53:283–288. 2008. View Article : Google Scholar : PubMed/NCBI

33 

Inaba-Hasegawa K, Akao Y, Maruyama W and Naoi M: Rasagiline and selegiline, inhibitors of type B monoamine oxidase, induce type A monoamine oxidase in human SH-SY5Y cells. J Neural Transm (Vienna). 120:435–444. 2013. View Article : Google Scholar : PubMed/NCBI

34 

Gillies LA and Kuwana T: Apoptosis regulation at the mitochondrial outer membrane. J Cell Biochem. 115:632–640. 2014. View Article : Google Scholar : PubMed/NCBI

35 

Shacka JJ and Roth KA: Regulation of neuronal cell death and neurodegeneration by members of the Bcl-2 family: Therapeutic implications. Curr Drug Targets CNS Neurol Disord. 4:25–39. 2005. View Article : Google Scholar : PubMed/NCBI

36 

Schwartz PS and Hockenbery DM: Bcl-2-related survival proteins. Cell Death Differ. 13:1250–1255. 2006. View Article : Google Scholar : PubMed/NCBI

37 

Shimizu S, Konishi A, Kodama T and Tsujimoto Y: BH4 domain of antiapoptotic Bcl-2 family members closes voltage-dependent anion channel and inhibits apoptotic mitochondrial changes and cell death. Proc Natl Acad Sci USA. 97:pp. 3100–3105. 2000; View Article : Google Scholar : PubMed/NCBI

38 

Malik JM, Shevtsova Z, Bähr M and Kügler S: Long-term in vivo inhibition of CNS neurodegeneration by Bcl-XL gene transfer. Mol Ther. 11:373–381. 2005. View Article : Google Scholar : PubMed/NCBI

39 

Offen D, Beart PM, Cheung NS, Pascoe CJ, Hochman A, Gorodin S, Melamed E, Bernard R and Bernard O: Transgenic mice expressing human Bcl-2 in their neurons are resistant to 6-hydroxydopamine and 1-methyl-4-phenyl-1,2,3,6- tetrahydropyridine neurotoxicity. Proc Natl Acad Sci USA. 95:pp. 5789–5794. 1998; View Article : Google Scholar : PubMed/NCBI

40 

Natsume A, Mata M, Goss J, Huang S, Wolfe D, Oligino T, Glorioso J and Fink DJ: Bcl-2 and GDNF delivered by HSV-mediated gene transfer act additively to protect dopaminergic neurons from 6-OHDA-induced degeneration. Exp Neurol. 169:231–238. 2001. View Article : Google Scholar : PubMed/NCBI

41 

Cao YJ, Shibata T and Rainov NG: Liposome-mediated transfer of the bcl-2 gene results in neuroprotection after in vivo transient focal cerebral ischemia in an animal model. Gene Ther. 9:415–419. 2002. View Article : Google Scholar : PubMed/NCBI

42 

Nuydens R, Dispersyn G, Van Den Kieboom G, de Jong M, Connors R, Ramaekers F, Borgers M and Geerts H: Bcl-2 protects neuronal cells against taxol-induced apoptosis by inducing multi-nucleation. Apoptosis. 5:335–343. 2000. View Article : Google Scholar : PubMed/NCBI

43 

Nuydens R, Dispersyn G, Van Den Keiboom G, de Jong M, Connors R, Ramaekers F, Borgers M and Geerts H: Bcl-2 protects against apoptosis-related microtubule alterations in neuronal cells. Apoptosis. 5:43–51. 2000. View Article : Google Scholar : PubMed/NCBI

44 

Yang J, Liu X, Bhalla K, Kim CN, Ibrado AM, Cai J, Peng TI, Jones DP and Wang X: Prevention of apoptosis by Bcl-2: Release of cytochrome c from mitochondria blocked. Science. 275:1129–1132. 1997. View Article : Google Scholar : PubMed/NCBI

45 

Naoi M, Maruyama W, Akao Y, Yi H and Yamaoka Y: Involvement of type A monoamine oxidase in neurodegeneration: Regulation of mitochondrial signaling leading to cell death or neuroprotection. J Neural Transm Suppl. 71:67–77. 2006. View Article : Google Scholar

46 

Naoi M, Maruyama W and Inaba-Hasegawa K: Type A and B monoamine oxidase in age-related neurodegenerative disorders: Their distinct roles in neuronal death and survival. Curr Top Med Chem. 12:2177–2188. 2012. View Article : Google Scholar : PubMed/NCBI

47 

Chiou SH, Ku HH, Tsai TH, Lin HL, Chen LH, Chien CS, Ho LL, Lee CH and Chang YL: Moclobemide upregulated Bcl-2 expression and induced neural stem cell differentiation into serotoninergic neuron via extracellular-regulated kinase pathway. Br J Pharmacol. 148:587–598. 2006. View Article : Google Scholar : PubMed/NCBI

48 

Jiang B, Liang P, Deng G, Tu Z, Liu M and Xiao X: Increased stability of Bcl-2 in HSP70-mediated protection against apoptosis induced by oxidative stress. Cell Stress Chaperones. 16:143–152. 2011. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Abdanipour A, Jafari Anarkooli I , Shokri S, Ghorbanlou M, Bayati V and Nejatbakhsh R: Neuroprotective effects of selegiline on rat neural stem cells treated with hydrogen peroxide. Biomed Rep 8: 41-46, 2018.
APA
Abdanipour, A., Jafari Anarkooli, I. ., Shokri, S., Ghorbanlou, M., Bayati, V., & Nejatbakhsh, R. (2018). Neuroprotective effects of selegiline on rat neural stem cells treated with hydrogen peroxide. Biomedical Reports, 8, 41-46. https://doi.org/10.3892/br.2017.1023
MLA
Abdanipour, A., Jafari Anarkooli, I. ., Shokri, S., Ghorbanlou, M., Bayati, V., Nejatbakhsh, R."Neuroprotective effects of selegiline on rat neural stem cells treated with hydrogen peroxide". Biomedical Reports 8.1 (2018): 41-46.
Chicago
Abdanipour, A., Jafari Anarkooli, I. ., Shokri, S., Ghorbanlou, M., Bayati, V., Nejatbakhsh, R."Neuroprotective effects of selegiline on rat neural stem cells treated with hydrogen peroxide". Biomedical Reports 8, no. 1 (2018): 41-46. https://doi.org/10.3892/br.2017.1023
Copy and paste a formatted citation
x
Spandidos Publications style
Abdanipour A, Jafari Anarkooli I , Shokri S, Ghorbanlou M, Bayati V and Nejatbakhsh R: Neuroprotective effects of selegiline on rat neural stem cells treated with hydrogen peroxide. Biomed Rep 8: 41-46, 2018.
APA
Abdanipour, A., Jafari Anarkooli, I. ., Shokri, S., Ghorbanlou, M., Bayati, V., & Nejatbakhsh, R. (2018). Neuroprotective effects of selegiline on rat neural stem cells treated with hydrogen peroxide. Biomedical Reports, 8, 41-46. https://doi.org/10.3892/br.2017.1023
MLA
Abdanipour, A., Jafari Anarkooli, I. ., Shokri, S., Ghorbanlou, M., Bayati, V., Nejatbakhsh, R."Neuroprotective effects of selegiline on rat neural stem cells treated with hydrogen peroxide". Biomedical Reports 8.1 (2018): 41-46.
Chicago
Abdanipour, A., Jafari Anarkooli, I. ., Shokri, S., Ghorbanlou, M., Bayati, V., Nejatbakhsh, R."Neuroprotective effects of selegiline on rat neural stem cells treated with hydrogen peroxide". Biomedical Reports 8, no. 1 (2018): 41-46. https://doi.org/10.3892/br.2017.1023
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team