Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Biomedical Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 2049-9434 Online ISSN: 2049-9442
Journal Cover
January-2021 Volume 14 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
January-2021 Volume 14 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Urinary expression of long non‑coding RNA TUG1 in non‑diabetic patients with glomerulonephritides

  • Authors:
    • Fernando Javier Salazar‑Torres
    • Miguel Medina‑Perez
    • Zesergio  Melo
    • Claudia Mendoza‑Cerpa
    • Raquel Echavarria
  • View Affiliations / Copyright

    Affiliations: Departamento de Nefrología, UMAE‑Hospital de Especialidades, CMNO, Instituto Mexicano del Seguro Social, Guadalajara, Jalisco 44340, México, CONACyT‑Centro de Investigación Biomédica de Occidente, Instituto Mexicano del Seguro Social, Guadalajara, Jalisco 44340, México, Departamento de Patología, UMAE‑Hospital de Especialidades, CMNO, Instituto Mexicano del Seguro Social, Guadalajara, Jalisco 44340, México
  • Article Number: 17
    |
    Published online on: November 20, 2020
       https://doi.org/10.3892/br.2020.1393
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Metabolic alterations serve a significant role in the pathogenesis of kidney disease. Long non‑coding RNA (lncRNA) taurine upregulated gene 1 (TUG1) is a known regulator of podocyte health and mitochondrial biogenesis. Although TUG1 protects against podocyte loss in models of diabetic nephropathy, it is unknown if urinary TUG1 expression is associated with clinical and histopathological findings in non‑diabetic patients diagnosed with glomerulonephritides. In the present study, the expression of TUG1, podocyte‑specific markers (nephrin and podocin) and mitochondrial biogenesis‑associated mRNAs (transcription factor A mitochondrial, cytochrome C oxidase subunit 5A and peroxisome proliferator‑activated receptor γ coactivator 1α) were examined in urinary sediment of non‑diabetic patients with biopsy‑confirmed glomerulonephritides and healthy controls. Urinary expression of TUG1 was significantly lower in patients with glomerulonephritides, particularly those diagnosed with Focal Segmental Glomerulosclerosis (FSGS). Furthermore, TUG1 levels were associated with urinary expression of podocyte‑specific markers and mRNAs associated with mitochondrial biogenesis. Loss of TUG1 expression in urinary sediment was strongly associated with FSGS, highlighting the potential of this lncRNA and its mitochondrial biogenesis‑associated targets as non‑invasive biomarkers of assessing podocytopathy.

Introduction

Glomerulonephritides are a group of rare diseases that often affects younger individuals and can lead to end-stage renal disease (ESRD) (1). Although the clinical presentation of glomerulonephritides and their outcomes are variable, well-established factors such as persistent proteinuria, hypertension, diabetes and cardiovascular disease increase the risk of ESRD progression (2). Podocyte injury is a hallmark of renal diseases, presenting clinically with proteinuria, glomerulosclerosis and kidney failure (3). Terminally differentiated podocytes have a limited capacity to self-replicate; hence, direct cellular damage contributes to the onset and progression of glomerular diseases such as Focal Segmental Glomerulosclerosis (FSGS), Minimal Change Disease and Diabetic Nephropathy (DN) (4). Additionally, immune-mediated damage is responsible for the establishment and progression of secondary glomerulonephritides, including lupus nephritis (LN) and ANCA-associated vasculitis (AAV) (5).

The gold standard for confirming a diagnosis of glomerulonephritides diagnosis is renal biopsy (6). However, biopsies are invasive, may have complications and are hard to interpret due to the presence of highly complex pathogenic mechanisms that translate into limited histological responses of kidney injury (7). Thus, identifying non-invasive biomarkers of glomerular disease may result in improved diagnosis and guide therapeutic choices in the field of nephrology (8).

Long non-coding RNAs (lncRNAs) are RNA molecules comprised of >200 nucleotides with no protein-coding capacity. They are a class of RNAs comprised of heterogeneous intergenic transcripts, sense or antisense transcripts that overlap with other genes, or enhancer RNAs with a range of functions that includes the regulation of gene expression, chromatin remodelling, microRNA (miRNA/miR)-sponging and protein scaffolding (9,10). LncRNAs modulate several biological processes, including homeostasis, cellular metabolism, proliferation, apoptosis and differentiation (10,11). Dysregulated expression of lncRNAs such as metastasis-associated lung adenocarcinoma transcript 1, LOC105374325, LOC105375913, X-inactive specific transcript and RP11-2B6.2 contribute to the pathogenesis of various kidney diseases (12-17). Moreover, circulating lncRNAs are stable and easily detectable in plasma, serum and urine, characteristics that make them convenient for use diagnostically (18,19).

The lncRNA taurine upregulated gene 1 (TUG1), located on chromosome 22q12, regulates podocyte health and glomerulosclerosis by altering the expression of peroxisome proliferator-activated receptor γ Coactivator 1α (PGC1A) (20-23). PGC1A is a transcriptional coactivator that controls mitochondrial biogenesis and is encoded by the PPARGC1A gene in humans (24,25). A decrease in PGC1A expression contributes to the onset of metabolic diseases such as DN, and transgenic expression of PPARGC1A in tubular cells protects mice from developing acute and chronic forms of kidney disease (26,27). Long et al (28) found that podocyte-specific transgenic expression of lncRNA TUG1 protects against DN in a mouse model, and demonstrated that lower glomerular filtration rates (GFR) were correlated with a decrease in TUG1 intrarenal expression in human subjects. However, it is unknown if TUG1 can be detected in urine and if its expression levels are correlated with histopathological findings in kidney biopsies from patients diagnosed with glomerulonephritides other than DN. In the present study, the urinary expression of TUG1 in non-diabetic patients with glomerulonephritides was characterized and it was shown that a decrease in TUG1 expression was significantly associated with FSGS.

Materials and methods

Ethical considerations

The present study complied with the ethical principles for medical research specified in the Declaration of Helsinki (29) and was approved by the Local Ethics and Research Committee at the Hospital de Especialidades NUM. 1, Bajio, Leon, Guanajuato, Instituto Mexicano del Seguro Social (approval no. CLIEIS R-2018-1001-114). Each participant provided written informed consent prior to enrolment in the study.

Patient enrolment

A total of 11 patients with biopsy-confirmed glomerulonephritides (7 females and 4 males; median age, 31 years; range 19-59 years), and 10 healthy controls (6 females and 4 males; median age 34 years; range 22-54) were enrolled in the present study at UMAE-Hospital de Especialidades, CMNO in Guadalajara, Mexico. Inclusion criteria were non-diabetic patients aged ≥18 years. Exclusion criteria were intake of non-steroid anti-inflammatory drugs or platelet anti-aggregation medication a week before sampling, administration of anticoagulant medication 96 h before the biopsy, blood pressure >160/90 mmHg, active urinary infection or anaemia. Urine sample collection was taken shortly before biopsy collection. Only 1 patient enrolled in the study was unable to provide a urine sample and, therefore, was excluded from further analysis.

Data collection

Biochemical parameters corresponding to each glomerulonephritides patient at the time of biopsy were assayed by routine laboratory techniques at UMAE-Hospital de Especialidades and retrieved from patients' electronic medical records.

Reverse transcription-quantitative (RT-q)PCR

Urine specimens from patients and healthy controls were collected and centrifuged at 4,500 x g for 30 min at 4˚C. The urinary sediments were recovered by discarding the supernatant, and total RNA was extracted using RiboZol reagent (Amresco LLC) according to the manufacturer's protocol. cDNA was synthesized by reverse transcription using 1 µg total RNA and a QuantiTect Reverse Transcription kit according to the manufacturer's protocol (Qiagen, Inc.). The cDNA was used to perform quantitative PCR using EvaGreen 5x qPCR mix (qARTA Bio Inc.) and 10 pmol/µl each of the reverse and forward primers in a Lightcycler 96 (Roche Diagnostics). The sequences of the primers used to amplify human lncRNA TUG1(30), nephrin (NSPH1), podocin (NSPH2), transcription factor A, mitochondrial (TFAM), cytochrome C oxidase subunit 5A (COX5A), PPARGC1A and GAPDH are shown in Table I. The amplification conditions consisted of 1 cycle of initial denaturation at 95˚C for 15 min; followed by 40 cycles of denaturation at 95˚C for 15 sec, annealing at 56˚C for 20 sec and extension at 72˚C for 20 sec. GAPDH was used as the internal control to normalize gene expression data. The relative mRNA expression was calculated using the 2-∆∆Cq method (31).

Table I

Sequences of the primers.

Table I

Sequences of the primers.

GeneSequence, 5'-3'Size, bp
TUG1 150
     Forward TAGCAGTTCCCCAATCCTTG 
     Reverse CACAAATTCCCATCATTCCC 
NPHS1 124
     Forward GTGCACTATGCTCCCACCAT 
     Reverse TCTCCCAGTTGAACATGCCC 
NPHS2 160
     Forward GAGGAAGGTACCAAATCCTCCG 
     Reverse GCAGATGTCCCAGTCGGAATA 
TFAM 105
     Forward ATGGAGGCAGGAGTTTCGTT 
     Reverse CCTAGATGAGTTCTGCCTGCT 
COX5A 160
     Forward AGATGCCTGGGAATTGCGTA 
     Reverse AGGTCCTGCTTTGTCCTTAACA 
PPARGC1A 158
     Forward TGTGGAGTCCCTGGAATGGA 
     Reverse AAGATCGTGTTGGGCGAGAG 
GAPDH 153
     Forward CCCACTCCTCCACCTTTGAC 
     Reverse TGGTCCAGGGGTCTTACTCC 
In silico identification of TUG1/miR-204-5p axis mRNA targets

The VarElect phenotype program from GeneAnalytics (geneanalytics.genecards.org), a pathway enrichment analysis tool, was used to identify predicted mRNA targets of the TUG1/miR-204-5p axis involved in mitochondrial biogenesis based on the genomic information stored in GeneCards (32). In total, 453 predicted mRNA targets of hsa-miR-204-5p downloaded from TargetScan version 7.2 (targetscan.org) (33) were profiled with GeneAnalytics. The entries were scored and ranked using an algorithm that enables matching of genomic expression, sequencing and microarray datasets to tissues and cells.

Statistical analysis

Data are expressed as the mean ± standard error of the mean. Non-parametric variables were compared using a Mann-Whitney U-test or a Kruskal-Wallis test with a Dunn's post-hoc test, as appropriate. A Spearman's rank correlation analysis was used to analyse correlations. Statistical analysis was performed in GraphPad Prism Version 6.01 (GraphPad Software, Inc.). P<0.05 was considered to indicate a statistically significant difference.

Results

Clinical and biochemical characteristics of glomerulonephritides patients and healthy controls

The present study included 10 patients with biopsy-confirmed diagnosis, 4 males and 6 females, and 10 sex-matched healthy controls. The mean age at renal biopsy was 34.4±11.1 years old, the mean body mass index was 30.1±5.1, and the diagnoses were as follows: 5 cases of FSGS, 3 cases of LN, 1 case of AAV and 1 case of advanced glomerular sclerosis (AGS). Table II shows the biochemical parameters of the glomerulonephritides patients. A total of 80% of the patients had haemoglobin values within the normal range. All glomerulonephritides patients had proteinuria, with the highest levels present in the patient diagnosed with AGS. However, CKD staging, classified according to the level of GFR (34) varied greatly. Only 2 patients had a normal GFR of >90 ml/min/1.73 m2; 3 FSGS patients were Stage 2; 1 AAV patient was Stage 3B; 3 patients were Stage 4 and only 1 LN patient was Stage 5 with a GFR <15 ml/min/1.73m2. The presence of glomerular damage in the absence of renal failure highlights the importance of identifying novel circulating markers able to detect glomerulonephritides during the early stages of CKD.

Table II

Biochemical parameters of glomerulonephritides patients.

Table II

Biochemical parameters of glomerulonephritides patients.

  Patient no.
Factor12345678910
DiagnosisFSGSFSGSAAVLNAGSFSGSLNLNFSGSFSGS
Hemoglobin, g/dl14.713.212.811.68.710.515.613.816.716.3
sCr, mg/dl0.840.571.53.73.92.10.868.41.41.5
GFR, ml/min/1.73m2901263817152810786663
Proteinuria, g/24 h1.282.681.92.245.83.681.592.92.721.79
Albumin, g/dl3.72.14.13.62.52.32.933.54.3
pANCA+-++++-+++++++--
cANCA----------
Antinuclear antibodies-0.097220.263890.486110.097220.097220.152780.152780.15278-
Anti-DNA antibodies---+++--++++--
C3 fraction, mg/dl12411293.95510412759.792.2143125
C4 fraction, mg/dl28.638.424.4731.828.99.2919.433.533.5
CRP, mg/l3.75<3.235.53<3.2315.8<3.231611.1<3.23<3.23
ESR, mm/h3742161218-2826-10

[i] FSGS, focal segmental glomerulosclerosis; LN, lupus nephritis; AVV, ANCA-associated vasculitis; AGS, advanced global sclerosis; sCr, serum creatinine; pANCA, perinuclear/nuclear antineutrophil cytoplasmic antibody; cANCA, cytoplasmic antineutrophil cytoplasmic antibody; C3, complement component 3; C4, complement component 4; CRP, C reactive protein; ESR, erythrocyte sedimentation rate; -, negative; +, low; ++, moderate; +++, high.

Glomerulonephritides patients have low levels of urinary TUG1 expression

Cell-free lncRNAs are stable in urine and may potentially be used as non-invasive biomarkers to identify diseases, such as lupus nephritis and membranous nephropathy (18,19). To assess alterations in TUG1 expression in the urinary sediment of patients with glomerulonephritides, RT-qPCR was used. Urinary expression of TUG1 was reduced in glomerulonephritides patients compared with the healthy controls (Fig. 1A). Furthermore, significantly lower TUG1 expression levels in urinary sediment was observed in patients with FSGS when compared with all other diagnoses (Fig. 1B). These results suggest that the urinary expression of TUG1 decreases with podocytopathy.

Figure 1

Urinary expression of TUG1 is decreased in FSGS patients. (A) RT-qPCR results showing the log2-fold change in expression of TUG1/GAPDH in the urinary sediment of healthy controls (n=10) and glomerulonephritides patients (n=10). (B) Reverse transcription-quantitative PCR results showing the log2-fold change in expression of TUG1/GAPDH in the urinary sediment of healthy controls (n=10), FSGS patients (n=5) and other diagnoses (lupus nephritis, n=3; ANCA-associated vasculitis, n=1; and advanced glomerular sclerosis, n=1). Data are presented as the mean ± standard error of the mean. *P<0.05, **P<0.01. TUG1, taurine upregulated gene 1; FSGS, focal segmental glomerulosclerosis.

Urinary expression of TUG1 correlates with podocyte marker expression

Glomerular injury is associated with podocyte loss, a phenomenon that can be monitored by detecting podocyte-specific mRNAs in the urine (35). In the present study, two podocyte-specific mRNAs, NPHS1 and NPHS2, were detected using RT-qPCR. Although the expression levels of urinary NPHS1 was not significantly different between glomerulonephritides patients and healthy controls, NPHS1 urinary expression was significantly lower in the FSGS patients when compared with other diagnoses (Fig. 2A). In contrast, NPHS2 mRNA did not differ significantly amongst the groups (Fig. 2B). Interestingly, a positive correlation was observed between TUG1 urinary expression and both podocyte-specific mRNAs (NPHS1, r=0.6486, **P<0.01; NPHS2, r=0.4782, *P<0.05; Fig. 2C and D). These results further suggest an association between TUG1 urinary expression and podocyte damage.

Figure 2

TUG1 urinary expression is correlated with podocyte marker mRNA expression in glomerulonephritides patients and healthy controls. Reverse transcription-quantitative PCR results showing the log2-fold change in expression of (A) NPHS1 and (B) NPHS2 in the urinary sediment of healthy controls (n=10), FSGS patients (n=5) and other diagnoses (lupus nephritis, n=3; ANCA-associated vasculitis, n=1; and advanced glomerular sclerosis, n=1). Data are presented as the mean ± standard error of the mean. *P<0.05. Correlation between lncRNA TUG1 transcript levels and (C) NPHS1 or (D) NPHS2 in the urinary sediment of healthy controls (n=10) and glomerulonephritides patients (n=10). *P<0.05, **P<0.01. TUG1, taurine upregulated gene 1; NSPH1, nephrin; NSPH2, podocin; ns, not significant.

Urinary expression of mitochondrial biogenesis markers is correlated with TUG1 expression levels

Several studies have validated the functional role of TUG1 as a lncRNA in directly binding to specific miRNAs to regulate post-transcriptional processing via a competing endogenous RNA mechanism (21,23,28,30). One such target is miR-204-5p (30). Thus, the VarElect phenotype program from Gene Analytics was used to predict mRNA targets of the TUG1/miR-204-5p axis involved in mitochondrial biogenesis. Through gene data profiling, a total of 27 genes significantly associated with mitochondrial biogenesis were identified (Table III).

Table III

Predicted targets of TUG1/miR-204-5p axis involved in mitochondrial biogenesis.

Table III

Predicted targets of TUG1/miR-204-5p axis involved in mitochondrial biogenesis.

SymbolDescriptionGlobal RankaScorea,b
PPARGC1APPARG Coactivator 1α118.76
TFAMTranscription Factor A, Mitochondrial411.67
CREB1CAMP Responsive Element Binding Protein 1254.98
SIRT1Sirtuin 1264.80
COX5ACytochrome C Oxidase Subunit 5A393.13
ATF2Activating Transcription Factor 2522.42
MAPK1Mitogen-Activated Protein Kinase 1562.32
ESR1Estrogen Receptor 1611.96
CAMK2DCalcium/Calmodulin Dependent Protein Kinase II δ681.68
NFATC3Nuclear Factor of Activated T Cells 3681.68
OGTO-Linked N-Acetylglucosamine (GlcNAc) Transferase691.59
MXI1MAX Interactor 1, Dimerization Protein691.59
ESRRGEstrogen Related Receptor γ750.68
CPOXCoproporphyrinogen Oxidase750.68
ESR2Estrogen Receptor 2800.36
TFAP2ATranscription Factor AP-2α800.36
ZBTB20Zinc Finger and BTB Domain Containing 20810.26
NPAS3Neuronal PAS Domain Protein 3810.26
NR4A2Nuclear Receptor Subfamily 4 Group A Member 2810.26
RICTORRPTOR Independent Companion of mTOR Complex 2810.26
CAMK1Calcium/Calmodulin Dependent Protein Kinase I810.26
TET2Tet Methylcytosine Dioxygenase 2810.26
ATXN1Ataxin 1810.26
VHLVon Hippel-Lindau Tumor Suppressor810.26
HMGCR 3-Hydroxy-3-Methylglutaryl-CoA Reductase810.26
ZNF521Zinc Finger Protein 521810.26

[i] FSGS, focal segmental glomerulosclerosis; LN, lupus nephritis; AVV, ANCA-associated vasculitis; AGS, advanced global sclerosis; sCr, serum creatinine; CRP, C reactive protein; ESR, erythrocyte sedimentation rate.

[ii] aObtained from a total of 453 genes.

[iii] bBased on analysis in VarElect of miR-204-5p predicted targets from TargetScan.

Next, the urinary expression of two predicted TUG1/miR-204 mRNA targets significantly associated with mitochondrial biogenesis, TFAM and COX5A, as well as one validated target, PPARGC1A (36), were quantified (Fig. 3). The relative expression levels of COXA5 and PPARGC1A were lower in the urinary sediment of glomerulonephritides patients when compared with healthy controls (Fig. 3C and E). Additionally, there was a significant correlation between TUG1 urinary expression and all three mitochondrial biogenesis mRNAs quantified in the present study (TFAM, r=0.6328, **P<0.01; COXA5, r=0.4872, *P<0.05; PPARGC1A, r=0.7206, **P<0.01; Fig. 3B-F). These results suggest that urinary RNAs may reflect molecular processes involved in the pathophysiology of renal dysfunction.

Figure 3

Levels of urinary lncRNA TUG1 correlate with mitochondrial biogenesis mRNAs predicted to be modulated by the TUG1/miR-2014-5p axis. Reverse transcription-quantitative PCR results showing the log2-fold change in expression of (A) TFAM, (C) COX5A and (E) PPARGC1A in the urinary sediment of healthy controls (n=10) and glomerulonehritides patients (n=10). Data are presented as the mean ± standard error of the mean. Correlation between lncRNA TUG1 transcript levels and (B) TFAM, (D) COXA5 and (F) PARGC1A in the urinary sediment of healthy controls (n=10) and glomerulonephritides patients (n=10). *P<0.05, **P<0.01. TUG1, taurine upregulated gene 1; miR, microRNA; TFAM, transcription factor A mitochondrial, COX5A, cytochrome C oxidase subunit 5A; and PPARGC1A, peroxisome proliferator-activated receptor γ coactivator 1α.

Discussion

The diagnosis of glomerulonephritides in current clinical practice is primarily dependent on the histological analysis of renal biopsies (6). However, this traditional approach is being challenged by molecular techniques that go beyond description and examine disease mechanisms (37,38). Multiple studies have shown the association between dysregulated expression of certain lncRNAs and the development and progression of pathological disease states that affect the kidney (12-17). Urinary non-coding RNAs are a promising non-invasive tool able to reflect renal disease, aid in its appropriate diagnosis, and guide therapeutic choices (12,39,40). In the present study, it was shown that lncRNA TUG1 was present in the urinary sediment, and its expression was significantly reduced in patients with biopsy-confirmed glomerulonephritides, particularly those diagnosed with FSGS. Moreover, there was a positive correlation between urinary TUG1 expression and mRNAs known to be involved in pathogenic mechanisms associated with podocyte loss.

Mutations in NPHS1 or NPHS2 lead to proteinuria and rapid ESRD progression, highlighting the critical role of these podocyte-specific structural proteins in glomerular filtration barrier function (41,42). Although NPHS1 and NPHS2 are detectable in the urine of glomerulonephritides patients and have been described as clinically valuable biomarkers of podocyte injury, the results between studies are inconsistent and raise questions regarding the reasons behind the contrasting findings (43). In the present study, a decrease in urinary NPHS1 expression in FSGS was observed when compared to other diagnoses, but no differences in NPHS2 levels within the groups was found. These results partially agree with previous studies that showed urinary NPHS1 and NPHS2 mRNA levels were reduced in patients with MCN and FSGS, a feature that correlates with the degree of proteinuria (44,45). However, TUG1 expression levels showed no correlation with GFR, proteinuria or albuminuria in the present study (data not shown). Although it has been proposed that these podocyte-specific biomarkers can detect nephropathy before the development of albuminuria (46-48), a larger patient cohort is required to assess the relationship between TUG1 urinary expression and clinical markers of renal dysfunction traditionally used in the diagnosis of glomerulonephritides. In the present study, a positive correlation between NPHS1 and NPHS2 mRNA levels and TUG1 expression was observed, which suggests that the molecular mechanisms described in vitro and in animal models of DN regarding the relationship between TUG1 and podocyte loss are reflected in the urine of non-diabetic patients (28).

A decrease in PGC1A, a transcriptional coactivator that regulates energy homeostasis and mitochondrial biogenesis, has been implicated in the development of acute kidney injury, DN and renal fibrosis (49). The expression levels and activity of PGC1A depend on multiple transcriptional and post-transcriptional mechanisms, some mediated by non-coding RNAs (22,28). Interactions between TUG1 and the promoter of PGC1A enhances its transcription, and increases mitochondrial content and cellular ATP levels whilst reducing mitochondrial reactive oxygen species levels. In addition, TUG1 acts as a competitive endogenous RNA for miRNAs such as miR-145, miR-144 and miR-204-5p (30,50,51). miRNA miR-204-5p is involved in multiple cellular processes, including angiogenesis, vascular disease, metabolism and glucose homeostasis (30,52). Through in silico analysis, targets of the TUG1/miR-204-5p axis involved in mitochondrial biogenesis were predicted and it was subsequently shown that PGC1A, COX5A and TFAM were also detectable in the urine and were correlated with TUG1 expression. PGC1A is a known posttranscriptional target of miR-204-5p (53,54); however, COX5A and TFAM still require experimental validation. Nonetheless, the results suggest that the TUG1/miR-204 axis and their mitochondrial biogenesis targets are relevant in FSGS pathogenesis and may serve as potential biomarkers.

The present study has some limitations, including the small number of glomerulonephritides patients enrolled and the variability of diagnosis, which included primary and secondary glomerulonephritides. Nonetheless, our findings support a role for lncRNA TUG1 in the development of glomerulonephritides, and justify further exploration of urinary TUG1 as a potential biomarker of FSGS. More extensive studies, with carefully selected subjects are required to confirm the relationship between urinary TUG1 expression, clinical markers of renal dysfunction and glomerular damage observed in kidney biopsies; and to validate lncRNA TUG1 as a biomarker of FSGS. Additionally, more in vitro and animal experiments focused on the TUG1/miR-204-5p axis should be performed to increase our understanding of these non-coding RNAs in mitochondrial bioenergetics and podocyte loss.

In conclusion, the results of the present study highlight the potential of urinary non-coding RNAs, such as TUG1, in the diagnosis of renal disease, and suggests that this lncRNA and its mitochondrial-associated pathways are relevant in glomerulonephritides other than DN. Further studies are required to evaluate urinary TUG1 as a potential biomarker of podocytopathy, and to determine its association with kidney dysfunction and patient prognosis.

Acknowledgements

We would like to thank Claudia Susana Meza Calvillo for her technical assistance as part of the Scientific Research Summer Program of the Mexican Academy of Science 2019.

Funding

This study was supported by Consejo Nacional de Ciencia y Tecnología (CONACyT), Mexico (grant no. SALUD-2018-02-B-S-42687).

Availability of data and materials

The datasets used and/or analysed during the present study are available from the corresponding author on reasonable request.

Authors' contributions

FJS-T, MM-P and RE conceived the study. FJS-T and MM-P collected and analysed the data. ZM performed the experiments. CM-C performed the histopathological analysis of renal biopsies. RE drafted the manuscript. All authors read and approved the final manuscript.

Ethics approval and consent to participate

The present study complied with the ethical principles for medical research specified in the Declaration of Helsinki and was approved by the Local Ethics and Research Committee at the Hospital de Especialidades NUM. 1, Bajio, Leon, Guanajuato, Instituto Mexicano del Seguro Social (approval no. CLIEIS R-2018-1001-114). Each participant provided written informed consent prior to enrolment in the study.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Floege J and Amann K: Primary glomerulonephritides. Lancet. 387:2036–2048. 2016.PubMed/NCBI View Article : Google Scholar

2 

Caliskan Y and Kiryluk K: Novel biomarkers in glomerular disease. Adv Chronic Kidney Dis. 21:205–216. 2014.PubMed/NCBI View Article : Google Scholar

3 

Matovinović MS: Podocyte injury in glomerular diseases. EJIFCC. 20:21–27. 2009.PubMed/NCBI

4 

Mallipattu SK and He JC: The podocyte as a direct target for treatment of glomerular disease? Am J Physiol Renal Physiol. 311:F46–F51. 2016.PubMed/NCBI View Article : Google Scholar

5 

Bagavant H and Fu SM: Pathogenesis of kidney disease in systemic lupus erythematosus. Curr Opin Rheumatol. 21:489–494. 2009.PubMed/NCBI View Article : Google Scholar

6 

Hogan J, Mohan P and Appel GB: Diagnostic tests and treatment options in glomerular disease: 2014 update. Am J Kidney Dis. 63:656–666. 2014.PubMed/NCBI View Article : Google Scholar

7 

Parikh SV, Ayoub I and Rovin BH: The kidney biopsy in lupus nephritis: Time to move beyond histology. Nephrol Dial Transplant. 30:3–6. 2015.PubMed/NCBI View Article : Google Scholar

8 

Rovin BH, Almaani S and Malvar A: Reimagining the kidney biopsy in the era of diagnostic biomarkers of glomerular disease. Kidney Int. 95:265–267. 2019.PubMed/NCBI View Article : Google Scholar

9 

Kopp F and Mendell JT: Functional classification and experimental dissection of long noncoding RNAs. Cell. 172:393–407. 2018.PubMed/NCBI View Article : Google Scholar

10 

Mongelli A, Martelli F, Farsetti A and Gaetano C: The dark that matters: Long Non-coding RNAs as master regulators of cellular metabolism in Non-communicable diseases. Front Physiol. 10(369)2019.PubMed/NCBI View Article : Google Scholar

11 

Lorenzen JM and Thum T: Long noncoding RNAs in kidney and cardiovascular diseases. Nat Rev Nephrol. 12:360–373. 2016.PubMed/NCBI View Article : Google Scholar

12 

Ignarski M, Islam R and Müller RU: Long Non-coding RNAs in kidney disease. Int J Mol Sci. 20(3276)2019.PubMed/NCBI View Article : Google Scholar

13 

Tian H, Wu M, Zhou P, Huang C, Ye C and Wang L: The long non-coding RNA MALAT1 is increased in renal ischemia-reperfusion injury and inhibits hypoxia-induced inflammation. Ren Fail. 40:527–533. 2018.PubMed/NCBI View Article : Google Scholar

14 

Hu S, Han R, Shi J, Zhu X, Qin W, Zeng C, Bao H and Liu Z: The long noncoding RNA LOC105374325 causes podocyte injury in individuals with focal segmental glomerulosclerosis. J Biol Chem. 293:20227–20239. 2018.PubMed/NCBI View Article : Google Scholar

15 

Han R, Hu S, Qin W, Shi J, Zeng C, Bao H and Liu Z: Upregulated long noncoding RNA LOC105375913 induces tubulointerstitial fibrosis in focal segmental glomerulosclerosis. Sci Rep. 9(716)2019.PubMed/NCBI View Article : Google Scholar

16 

Jin LW, Pan M, Ye HY, Zheng Y, Chen Y, Huang WW, Xu XY and Zheng SB: Down-regulation of the long non-coding RNA XIST ameliorates podocyte apoptosis in membranous nephropathy via the miR-217-TLR4 pathway. Exp Physiol. 104:220–230. 2019.PubMed/NCBI View Article : Google Scholar

17 

Liao Z, Ye Z, Xue Z, Wu L, Ouyang Y, Yao C, Cui C, Xu N, Ma J, Hou G, et al: Identification of renal long Non-coding RNA RP11-2B6.2 as a positive regulator of type I interferon signaling pathway in lupus nephritis. Front Immunol. 10(975)2019.PubMed/NCBI View Article : Google Scholar

18 

Santer L, López B, Ravassa S, Baer C, Riedel I, Chatterjee S, Moreno MU, González A, Querejeta R, Pinet F, et al: Circulating long noncoding RNA LIPCAR predicts heart failure outcomes in patients without chronic kidney disease. Hypertension. 73:820–828. 2019.PubMed/NCBI View Article : Google Scholar

19 

Huang YS, Hsieh HY, Shih HM, Sytwu HK and Wu CC: Urinary Xist is a potential biomarker for membranous nephropathy. Biochem Biophys Res Commun. 452:415–421. 2014.PubMed/NCBI View Article : Google Scholar

20 

Forbes JM and Thorburn DR: Mitochondrial dysfunction in diabetic kidney disease. Nat Rev Nephrol. 14:291–312. 2018.PubMed/NCBI View Article : Google Scholar

21 

Young TL, Matsuda T and Cepko CL: The noncoding RNA taurine upregulated gene 1 is required for differentiation of the murine retina. Curr Biol. 15:501–512. 2005.PubMed/NCBI View Article : Google Scholar

22 

Li SY, Park J, Qiu C, Han SH, Palmer MB, Arany Z and Susztak K: Increasing the level of peroxisome proliferator-activated receptor γ coactivator-1α in podocytes results in collapsing glomerulopathy. JCI Insight. 2(e92930)2017.PubMed/NCBI View Article : Google Scholar

23 

Li SY and Susztak K: The long noncoding RNA Tug1 connects metabolic changes with kidney disease in podocytes. J Clin Invest. 126:4072–4075. 2016.PubMed/NCBI View Article : Google Scholar

24 

LeBleu VS, O'Connell JT, Gonzalez Herrera KN, Wikman H, Pantel K, Haigis MC, de Carvalho FM, Damascena A, Domingos Chinen LT, Rocha RM, et al: PGC-1α mediates mitochondrial biogenesis and oxidative phosphorylation in cancer cells to promote metastasis. Nat Cell Biol. 16:992–1003, 1-15. 2014.PubMed/NCBI View Article : Google Scholar

25 

Uldry M, Yang W, St-Pierre J, Lin J, Seale P and Spiegelman BM: Complementary action of the PGC-1 coactivators in mitochondrial biogenesis and brown fat differentiation. Cell Metab. 3:333–341. 2006.PubMed/NCBI View Article : Google Scholar

26 

Finck BN and Kelly DP: PGC-1 coactivators: Inducible regulators of energy metabolism in health and disease. J Clin Invest. 116:615–622. 2006.PubMed/NCBI View Article : Google Scholar

27 

Kang HM, Ahn SH, Choi P, Ko YA, Han SH, Chinga F, Park AS, Tao J, Sharma K, Pullman J, et al: Defective fatty acid oxidation in renal tubular epithelial cells has a key role in kidney fibrosis development. Nat Med. 21:37–46. 2015.PubMed/NCBI View Article : Google Scholar

28 

Long J, Badal SS, Ye Z, Wang Y, Ayanga BA, Galvan DL, Green NH, Chang BH, Overbeek PA and Danesh FR: Long noncoding RNA Tug1 regulates mitochondrial bioenergetics in diabetic nephropathy. J Clin Invest. 126:4205–4218. 2016.PubMed/NCBI View Article : Google Scholar

29 

Association WM: World medical association declaration of Helsinki: Ethical principles for medical research involving human subjects. JAMA. 310:2191–2194. 2013.PubMed/NCBI View Article : Google Scholar

30 

Yu C, Li L, Xie F, Guo S, Liu F, Dong N and Wang Y: LncRNA TUG1 sponges miR-204-5p to promote osteoblast differentiation through upregulating Runx2 in aortic valve calcification. Cardiovasc Res. 114:168–179. 2018.PubMed/NCBI View Article : Google Scholar

31 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001.PubMed/NCBI View Article : Google Scholar

32 

Ben-Ari Fuchs S, Lieder I, Stelzer G, Mazor Y, Buzhor E, Kaplan S, Bogoch Y, Plaschkes I, Shitrit A, Rappaport N, et al: GeneAnalytics: An integrative gene set analysis tool for next generation sequencing, RNAseq and microarray data. OMICS. 20:139–151. 2016.PubMed/NCBI View Article : Google Scholar

33 

Agarwal V, Bell GW, Nam JW and Bartel DP: Predicting effective microRNA target sites in mammalian mRNAs. Elife. 4(e05005)2015.PubMed/NCBI View Article : Google Scholar

34 

Levey AS, Eckardt KU, Tsukamoto Y, Levin A, Coresh J, Rossert J, De Zeeuw D, Hostetter TH, Lameire N and Eknoyan G: Definition and classification of chronic kidney disease: A position statement from Kidney Disease: Improving Global Outcomes (KDIGO). Kidney Int. 67:2089–2100. 2005.PubMed/NCBI View Article : Google Scholar

35 

Fukuda A, Wickman LT, Venkatareddy MP, Wang SQ, Chowdhury MA, Wiggins JE, Shedden KA and Wiggins RC: Urine podocin:nephrin mRNA ratio (PNR) as a podocyte stress biomarker. Nephrol Dial Transplant. 27:4079–4087. 2012.PubMed/NCBI View Article : Google Scholar

36 

Civelek M, Hagopian R, Pan C, Che N, Yang WP, Kayne PS, Saleem NK, Cederberg H, Kuusisto J, Gargalovic PS, et al: Genetic regulation of human adipose microRNA expression and its consequences for metabolic traits. Hum Mol Genet. 22:3023–3037. 2013.PubMed/NCBI View Article : Google Scholar

37 

Saez-Rodriguez J, Rinschen MM, Floege J and Kramann R: Big science and big data in nephrology. Kidney Int. 95:1326–1337. 2019.PubMed/NCBI View Article : Google Scholar

38 

Kretzler M, Cohen CD, Doran P, Henger A, Madden S, Gröne EF, Nelson PJ, Schlöndorff D and Gröne HJ: Repuncturing the renal biopsy: Strategies for molecular diagnosis in nephrology. J Am Soc Nephrol. 13:1961–1972. 2002.PubMed/NCBI View Article : Google Scholar

39 

Sun IO and Lerman LO: Urinary microRNA in kidney disease: Utility and roles. Am J Physiol Renal Physiol. 316:F785–F793. 2019.PubMed/NCBI View Article : Google Scholar

40 

Brandenburger T, Salgado Somoza A, Devaux Y and Lorenzen JM: Noncoding RNAs in acute kidney injury. Kidney Int. 94:870–881. 2018.PubMed/NCBI View Article : Google Scholar

41 

Patrakka J, Kestilä M, Wartiovaara J, Ruotsalainen V, Tissari P, Lenkkeri U, Männikkö M, Visapää I, Holmberg C, Rapola J, et al: Congenital nephrotic syndrome (NPHS1): Features resulting from different mutations in Finnish patients. Kidney Int. 58:972–980. 2000.PubMed/NCBI View Article : Google Scholar

42 

Boute N, Gribouval O, Roselli S, Benessy F, Lee H, Fuchshuber A, Dahan K, Gubler MC, Niaudet P and Antignac C: NPHS2, encoding the glomerular protein podocin, is mutated in autosomal recessive steroid-resistant nephrotic syndrome. Nat Genet. 24:349–354. 2000.PubMed/NCBI View Article : Google Scholar

43 

Sekulic M and Pichler Sekulic S: A compendium of urinary biomarkers indicative of glomerular podocytopathy. Patholog Res Int. 2013(782395)2013.PubMed/NCBI View Article : Google Scholar

44 

Hara M, Yanagihara T and Kihara I: Urinary podocytes in primary focal segmental glomerulosclerosis. Nephron. 89:342–347. 2001.PubMed/NCBI View Article : Google Scholar

45 

Szeto CC, Wang G, Chow KM, Lai FM, Ma TK, Kwan BC, Luk CC and Li PK: Podocyte mRNA in the urinary sediment of minimal change nephropathy and focal segmental glomerulosclerosis. Clin Nephrol. 84:198–205. 2015.PubMed/NCBI View Article : Google Scholar

46 

Pätäri A, Forsblom C, Havana M, Taipale H, Groop PH and Holthöfer H: Nephrinuria in diabetic nephropathy of type 1 diabetes. Diabetes. 52:2969–2974. 2003.PubMed/NCBI View Article : Google Scholar

47 

Ng DP, Tai BC, Tan E, Leong H, Nurbaya S, Lim XL, Chia KS, Wong CS, Lim WY and Holthöfer H: Nephrinuria associates with multiple renal traits in type 2 diabetes. Nephrol Dial Transplant. 26:2508–2514. 2011.PubMed/NCBI View Article : Google Scholar

48 

Chang JH, Paik SY, Mao L, Eisner W, Flannery PJ, Wang L, Tang Y, Mattocks N, Hadjadj S, Goujon JM, et al: Diabetic kidney disease in FVB/NJ Akita mice: Temporal pattern of kidney injury and urinary nephrin excretion. PLoS One. 7(e33942)2012.PubMed/NCBI View Article : Google Scholar

49 

Lynch MR, Tran MT and Parikh SM: PGC1α in the kidney. Am J Physiol Renal Physiol. 314:F1–F8. 2018.PubMed/NCBI View Article : Google Scholar

50 

Tan J, Qiu K, Li M and Liang Y: Double-negative feedback loop between long non-coding RNA TUG1 and miR-145 promotes epithelial to mesenchymal transition and radioresistance in human bladder cancer cells. FEBS Lett. 589:3175–3181. 2015.PubMed/NCBI View Article : Google Scholar

51 

Cai H, Xue Y, Wang P, Wang Z, Li Z, Hu Y, Li Z, Shang X and Liu Y: The long noncoding RNA TUG1 regulates blood-tumor barrier permeability by targeting miR-144. Oncotarget. 6:19759–19779. 2015.PubMed/NCBI View Article : Google Scholar

52 

Flores-Pérez A, Marchat LA, Rodríguez-Cuevas S, Bautista-Piña V, Hidalgo-Miranda A, Ocampo EA, Martínez M, Palma-Flores C, Fonseca-Sánchez MA, Astudillo-de la Vega H, et al: Dual targeting of ANGPT1 and TGFBR2 genes by miR-204 controls angiogenesis in breast cancer. Sci Rep. 6(34504)2016.PubMed/NCBI View Article : Google Scholar

53 

Maniyadath B, Chattopadhyay T, Verma S, Kumari S, Kulkarni P, Banerjee K, Lazarus A, Kokane SS, Shetty T, Anamika K and Kolthur-Seetharam U: Loss of hepatic oscillatory fed microRNAs Abrogates Refed transition and causes liver dysfunctions. Cell Rep. 26:2212–2226. 2019.PubMed/NCBI View Article : Google Scholar

54 

Houzelle A, Dahlmans D, Nascimento EBM, Schaart G, Jörgensen JA, Moonen-Kornips E, Kersten S, Wang X and Hoeks J: MicroRNA-204-5p modulates mitochondrial biogenesis in C2C12 myotubes and associates with oxidative capacity in humans. J Cell Physiol. 235:9851–9863. 2020.PubMed/NCBI View Article : Google Scholar

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Salazar‑Torres FJ, Medina‑Perez M, Melo Z, Mendoza‑Cerpa C and Echavarria R: Urinary expression of long non‑coding RNA TUG1 in non‑diabetic patients with glomerulonephritides. Biomed Rep 14: 17, 2021.
APA
Salazar‑Torres, F.J., Medina‑Perez, M., Melo, Z., Mendoza‑Cerpa, C., & Echavarria, R. (2021). Urinary expression of long non‑coding RNA TUG1 in non‑diabetic patients with glomerulonephritides. Biomedical Reports, 14, 17. https://doi.org/10.3892/br.2020.1393
MLA
Salazar‑Torres, F. J., Medina‑Perez, M., Melo, Z., Mendoza‑Cerpa, C., Echavarria, R."Urinary expression of long non‑coding RNA TUG1 in non‑diabetic patients with glomerulonephritides". Biomedical Reports 14.1 (2021): 17.
Chicago
Salazar‑Torres, F. J., Medina‑Perez, M., Melo, Z., Mendoza‑Cerpa, C., Echavarria, R."Urinary expression of long non‑coding RNA TUG1 in non‑diabetic patients with glomerulonephritides". Biomedical Reports 14, no. 1 (2021): 17. https://doi.org/10.3892/br.2020.1393
Copy and paste a formatted citation
x
Spandidos Publications style
Salazar‑Torres FJ, Medina‑Perez M, Melo Z, Mendoza‑Cerpa C and Echavarria R: Urinary expression of long non‑coding RNA TUG1 in non‑diabetic patients with glomerulonephritides. Biomed Rep 14: 17, 2021.
APA
Salazar‑Torres, F.J., Medina‑Perez, M., Melo, Z., Mendoza‑Cerpa, C., & Echavarria, R. (2021). Urinary expression of long non‑coding RNA TUG1 in non‑diabetic patients with glomerulonephritides. Biomedical Reports, 14, 17. https://doi.org/10.3892/br.2020.1393
MLA
Salazar‑Torres, F. J., Medina‑Perez, M., Melo, Z., Mendoza‑Cerpa, C., Echavarria, R."Urinary expression of long non‑coding RNA TUG1 in non‑diabetic patients with glomerulonephritides". Biomedical Reports 14.1 (2021): 17.
Chicago
Salazar‑Torres, F. J., Medina‑Perez, M., Melo, Z., Mendoza‑Cerpa, C., Echavarria, R."Urinary expression of long non‑coding RNA TUG1 in non‑diabetic patients with glomerulonephritides". Biomedical Reports 14, no. 1 (2021): 17. https://doi.org/10.3892/br.2020.1393
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team