Open Access

14-3‑3γ regulates cell viability and milk fat synthesis in lipopolysaccharide-induced dairy cow mammary epithelial cells

  • Authors:
    • Lixin Liu
    • Li Zhang
    • Ye Lin
    • Yanjie Bian
    • Xuejun Gao
    • Bo Qu
    • Qingzhang Li
  • View Affiliations

  • Published online on: January 28, 2016     https://doi.org/10.3892/etm.2016.3029
  • Pages: 1279-1287
  • Copyright: © Liu et al. This is an open access article distributed under the terms of Creative Commons Attribution License.

Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Our previous study demonstrated that 14-3-3γ overexpression was able to inhibit the production of lipopolysaccharide (LPS)-induced cytokines in dairy cow mammary epithelial cells (DCMECs) by inhibiting the activation of nuclear factor‑κB (NF‑κB) signaling pathways. However, the association between 14‑3‑3γ overexpression and milk fat synthesis in LPS‑induced DCMECs remains unclear. Therefore, the present study investigated the effect of 14‑3‑3γ on cell viability and milk fat synthesis in LPS‑induced DCMECs. The results of the MTT assay and lactate dehydrogenase activity assay demonstrated that 14‑3‑3γ overexpression was able to attenuate LPS‑induced cytotoxicity in DCMECs, and increase the viability of the cells. In addition, the results of reverse transcription‑quantitative polymerase chain reaction suggested that mRNA expression levels of genes associated with milk fat synthesis, including sterol regulatory element binding protein (SREBP1), peroxisome proliferator‑activated receptor‑γ (PPARG), cluster of differentiation 36, acetyl‑coA carboxylase (ACC), fatty acid synthase (FAS) and fatty acid binding protein‑3, were significantly upregulated in cells overexpressing the 14‑3‑3γ protein. In addition, as compared with the LPS‑treated group, the activities of FAS and ACC were significantly increased. Furthermore, western blotting demonstrated that 14‑3‑3γ overexpression enhanced the protein expression levels of phosphorylated SREBP1 and PPARG. These results suggested that high levels of 14‑3‑3γ protein were able to attenuate LPS‑induced cell damage and promote milk fat synthesis in LPS‑induced DCMECs by increasing the cell viability and upregulating the expression levels of transcription factors associated with milk fat synthesis.

Introduction

Subacute ruminal acidosis (SARA), which is a common disease in high yielding dairy cows that receive highly digestible diets, has a high economic impact (1). SARA increases the content of free lipopolysaccharide (LPS) in the rumen by increasing the lysis of gram-negative bacteria (2). LPS is the primary component of the gram-negative bacterial outer membrane, and is a key factor that induces the release of proinflammatory cytokines, including tumor necrosis factor (TNF)-α, interleukin (IL)-1β, and IL-6 (3), which in turn activate hepatocytic receptors and initiate the synthesis of acute phase proteins (4). In addition, LPS induces the activation of nuclear factor (NF)-κB, which translocates into the nucleus and regulates the expression of genes involved in cellular differentiation, proliferation, inflammation and apoptosis (5,6). Furthermore, LPS has been shown to regulate lactation and the synthesis of milk fat (7); previous studies associated rumen LPS-mediated inflammatory responses with milk fat depression (MFD) syndrome in lactating dairy cows, which is characterized by reduced milk fat synthesis and milk energy efficiency (8,9). Previous in vitro experiments have demonstrated that LPS is capable of inhibiting fatty acid synthase (FAS), acetyl-coA carboxylase (ACC) and peroxisome proliferator-activated receptor-γ (PPARG) gene expression levels, thereby inhibiting the synthesis of fatty acids (1012). Therefore, inhibiting LPS-induced inflammatory cytokine production is a formidable challenge that may improve milk fat content and milk quality.

14-3-3γ is an influential member of the 14-3-3 family, which are localized to the cell nucleus (13) and have important roles in coordinating the progression of cells (14,15). Previous studies have reported that 14-3-3γ overexpression promotes the viability of DCMECs (16) and 14-3-3γ may serve a crucial function in the regulation of LPS-induced myocardial injury (17,18). Our previous study (11) demonstrated that 14-3-3γ was able to inhibit the production of LPS-induced cytokines in dairy cow mammary epithelial cells (DCMECs) by inhibiting the activation of NF-κB signaling pathways. However, to the best of our knowledge, the mechanism underlying the role of 14-3-3γ in LPS-induced DCMEC injury, and the association between 14-3-3γ and milk fat synthesis in LPS-induced DCMECs, has yet to be investigated.

The present study aimed to investigate the protective effect of 14-3-3γ on LPS-induced DCMECs and the effects of 14-3-3γ on milk fat synthesis. A grapevine chrome mosaic virus (GCMV)/internal ribosome entry site (IRES)/enhanced green fluorescent protein (EGFP)-14-3-3γ expression vector was constructed and transfected into DCMECs in order to evaluate the ability of 14-3-3γ to protect against LPS-induced cell damage, and to determine its effect on the expression levels of milk fat synthesis-associated genes.

Materials and methods

Ethics statement

All experiments in the present study were approved by the Northeast Agricultural University Provincial Experimental Animal Management Committee (Harbin, China) and were performed in accordance with the guidelines of this committee.

Chemicals and reagents

LPS (Escherichia coli 0111:B4) and MTT were obtained from Sigma-Aldrich (St. Louis, MO, USA). Fetal bovine serum (FBS) and Dulbecco's modified Eagle's medium: F12 (DMEM/F12) base were obtained from Thermo Fisher Scientific, Inc. (Gibco; Waltham, MA, USA). Antibodies against PPARG, phosphorylated (p)-PPARG, sterol regulatory element binding protein (SREBP1) and β-actin were purchased from Santa Cruz Biotechnology, Inc. (Dallas, TX, USA). Anti-p-SREBP1 was purchased from Cell Signaling Technology Inc. (Danvers, MA, USA) and horseradish peroxidase-conjugated goat anti-rabbit and anti-mouse secondary antibodies were obtained from Beijing Biosynthesis Biotechnology Co., Ltd. (Beijing, China). ACC (GMS50510.2 v.A) and FAS (GMS50509.1 v.A) activity detection kits were obtained from Shanghai GenePharma Co. Ltd. (Shanghai, China).

Culture of DCMECs

Purified DCMECs were obtained from the Key Laboratory of Dairy Science of Education Ministry at Northeast Agricultural University. The cells were incubated at 37°C in an atmosphere containing 5% CO2 in basic culture medium (DMEM/F12 base with 10% FBS, 100 U/ml penicillin (Harbin Pharmaceutical Group Co., Ltd., Harbin, China) and 100 U/ml streptomycin (Dalian Merro Pharmaceutical Factory, Dalian, China (19,20).

Construction of pGCMV/IRES/EGFP-14-3-3γ expression vectors

The full-length cDNA encoding bovine 14-3-3γ was generated by polymerase chain reaction (PCR) using total RNA extracted from DCMECs. The final reaction volume of 20 µl contained 10 µl SYBR® Premix Eq Taq™, 0.4 µl forward primer (10 µM), 0.4 µl reverse primer (10 µM), 0.4 µl Rox reference dye (50X), 2 µl cDNA template and 6.8 µl diethylpyrocarbonate-treated water. Reaction conditions were as follows: 94°C for 5 min, followed by 35 cycles of 94°C for 30 sec, 62°C for 30 sec and 72°C for 60 sec, and finally 72°C for 10 min. Primers were purchased from the Beijing Genomics Institute and the sequences were as follows: Forward, 5′-GATCATCCTCGTCCGG-3′ and reverse, 5′-CAGTCCACCTGGGGGC-3′. The PCR products were digested with EcoRI and BamHI (both Takara Biotechnology Co., Ltd., Dalian, China) and were subsequently subcloned into the multiple cloning sites of the pGCMV/IRES/EGFP expression vector (Ambion; Thermo Fisher Scientific, Inc.), as previously described (16).

Transfection of pGCMV/IRES/EGFP-14-3-3γ

DCMECs were cultured in 6-well plates (3×105 cells/cm2) until 80–90% cell density was reached. pGCMV/IRES/EGFP-14-3-3γ or pGCMV/IRES/EGFP expression vectors were transfected into cells using Lipofectamine™ 2000 (Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. Briefly, 4 µg pGCMV/IRES/EGFP-14-3-3γ plasmid and 10 µl Lipofectamine™ 2000 were diluted using 250 µl Gibco Opti-MEM I medium (Thermo Fisher Scientific, Inc.) and the complexes were incubated at room temperature for 20 min, prior to addition to the cell cultures. The cultures were then incubated with serum- and antibiotic-free DMEM/F12 medium at 37°C for 4 h, after which the medium was discarded and fresh culture medium was added. Following transfection for 24 h, the mRNA expression levels of 14-3-3γ were measured, as previously described (11).

Transfection of small interfering RNAs (siRNAs)

14-3-3γ siRNAs and negative scrambled control siRNA were purchased from Shanghai GenePharma Co. Ltd. The 14-3-3γ siRNA had the following sequence: Sense, 5′-CCCUUAACUACUCCGUCUUTT-3′ and antisense, 5′-AAGACGGAGUAGUUAAGGGTT-3′. The negative scrambled control siRNA lacked significant sequence homology to any gene and had the following sequence: Sense, 5′-UUCUUGAACGUGUCACGUTT-3′ and antisense, 5′-ACGUGACACGUUCGGAGAATT-3′. DCMECs were cultured in 6-well plates until they reached a cell density of 80–90%. siRNA-14-3-3γ or negative control were transfected into the cells using Lipofectamine™2000, according to the manufacturer's protocol. Briefly, 2 µl siRNA-14-3-3γ and 5 µl Lipofectamine™ 2000 were diluted using 200 ml Opti-MEM I medium, after which the mixture was incubated at room temperature for 20 min, prior to addition into the wells. The cultures were then incubated with serum- and antibiotic-free medium at 37°C for 4 h, after which the medium was discarded and fresh culture medium with was added. Transfection efficiency was observed under a fluorescence microscope (CKX41; Olympus Corporation, Tokyo, Japan) according to the number of fluorescent cells.

MTT assay

The viability of DCMECs was measured using the MTT assay. Briefly, DCMECs were transfected with with pGCMV/IRES/EGFP-14-3-3γ, pGCMV-IRES-EGFP, 14-3-3γ siRNA or negative control siRNA for 24 h. Transfected cells were seeded into 96-well plates at 1×105 cells/well, followed by 24 h culturing in the presence or absence of 1 µg/ml LPS. Subsequently, the cells were washed with D-Hanks, and MTT (5 mg/ml in PBS; all Sigma-Aldrich) was added to each well and incubated for 4 h at 37°C. The reaction was stopped by the addition of 100 µl dimethyl sulfoxide (Amresco, LLC, Solon, OH, USA). After the mixture was oscillated for 15 min, absorbance was measured at 570 nm using a spectrophotometer (DU800; Beckman Coulter, Inc., Brea, CA, USA).

Lactate dehydrogenase (LDH) activity assay

Following transfecion, DCMECs were incubated with antibiotic-free DMEM/F12 medium for 24 h and subsequently treated with 1 µg/ml LPS for 24 h, after which the cell-free supernatants were collected for LDH viability assays using LDH Assay kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China), according to the manufacturer's protocol. The optical density (OD) of the cell-free supernatants was measured using a Sunrise-Basic microplate reader (Tecan Group, Ltd., Männedorf, Switzerland) at 440 nm.

Acridine orange (AO) double staining

DCMECs were transfected for 24 h and subsequently treated with 1 µg/ml LPS. After 24 h, the cells was collected and washed three times with PBS and were adjusted to a density of 5×105 cells/ml. Subsequently, 4 µl AO dye liquor (100 mg/l in PBS; Amresco, LLC) was added to 96 µl cell suspension, after which the specimens were incubated in the dark for 30 min at room temperature. After rinsing three times with PBS, the cellular morphology was visualized and photographed using a CKX41 fluorescence microscope (Olympus Corporation), as previously described (6).

Reverse transcription-quantitative PCR (RT-qPCR)

DCMECs were transfected for 24 h. Transfected cells were treated with 1 µg/ml LPS for 24 h. Total RNA was isolated using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.), according to the method described in a previous study (21). Total RNA was reverse transcribed into cDNA using PrimeScript Reverse Transcriptase (Takara Biotechnology Co., Ltd.), according to the manufacturer's protocol. The mRNA expression levels of various genes were quantified using SYBR premix Ex Taq™ (Takara Bio, Inc., Otsu, Japan), and the analysis was performed by the ABI PRISM 7300 Real-Time PCR system (Applied Biosystems, Thermo Fisher Scientific, Inc.), as previously described (16). Primers used for RT-qPCR analysis are presented in Table I. The RT-qPCR conditions were as follows: 95°C for 30 sec, followed by 40 cycles of 95°C for 5 sec and 60°C for 31 sec, according to the manufacturer's instructions. All target cDNA were analyzed in triplicate. The relative mRNA expression levels were quantified using the 2−ΔΔCq method.

Table I.

Primer sequences for the reverse transcription-quantitative polymerase chain reaction.

Table I.

Primer sequences for the reverse transcription-quantitative polymerase chain reaction.

Gene nameAccession numberPrimer sequence (5′-3′)Product size (bp)
14–3–3γBC153255.1Forward: GAATGAGCCACTGTCCAA171
Reverse: GCACATCCTGACATACGG
SREBP1NM_001113302.1Forward: GTAGCAGCGGTGGAAGT67
Reverse: GCAGCGGCTCTGGATT
PPARGNM_181024.2Forward: GCAGCGGCTCTGGATT170
Reverse: ATAGTGGAACCCTGACG
CD36NM_001046239.1Forward: GGAAAGGACGACATAAGCAAAG187
Reverse: TCAACAAAAGGTGGAAATGAGG
ACCNM_174224.2Forward: AGACAAACAGGGACCATT141
Reverse: AGGGACTGCCGAAACAT
FASNM_001012669.1Forward: CCACGGCTGTCGGTAAT171
Reverse: CGCTCCCACTCATCCTG
FABP3NM_174313.2Forward: GAACTCGACTCCCAGCTTGAA214
Reverse: AAGCCTACCACAATCATCGAAG
β-actinNM_173979Forward: CCGCAAGGACCTCTACGC206
Reverse: ATGCCAATCTCATCTCGTTTT

[i] SREBP, sterol regulatory element binding protein; PPARG, peroxisome proliferator-activated receptor gamma; CD36, cluster of differentiation 36; ACC, acetyl-CoA carboxylase; FAS, fatty acid synthase; FABP, fatty acid binding protein.

Enzyme activity assay

The activities of FAS and ACC in the LPS-treated transfected DCMECs were analyzed using the Enzyme Activity Detection kit, according to the manufacturer's protocol. The OD of the microplate was read at 340 nm using a Sunrise-Basic microplate reader (Tecan Group, Ltd., Männedorf, Switzerland).

Western blot analysis

DCMECs were transfected for 24 h, after which the cells were stimulated with 1 µg/ml LPS for 24 h. Subsequently, the cells were washed with cold PBS and ice-cold lysis buffer (Cell Signaling Technology Inc.), which contained 20 mM Tris-HCl (pH7.5), 150 mM NaCl, 1mM Na2 EDTA, 1mM EGTA, 1% NP-40, 1% sodium decxycholate, 2.5 mM β-glycerophosphate, 1 mM Na3VO4 and 1 µg/ml leupeptin. The cells were scraped and collected in a microfuge tube. Total protein was isolated from DCMECs using a method described in a previous study (22). Briefly, the protein concentration was measured using the bicinchoninic acid assay (Beyotime Institute of Biotechnology, Haimen, China), after which 30 µg protein was separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred onto nitrocellulose membranes using glycine transfer buffer (192 mM glycine, 25 mM Tris-HCl (pH 8.8), 20% methanol) (both Bio-Rad Laboratories, Inc., Hercules, CA, USA). The membranes were blocked using blocking buffer (5% nonfat dry milk) for 1.5 h at room temperature, and incubated with the following specific primary polyclonal antibodies at 4°C overnight at a dilution of 1:200: rabbit PPARG (sc-7196) and p-PPARG (sc-28001-R), and mouse SREBP1 (sc-365513), p-SREBP1 (9874) and β-actin (sc-8432). Following washing with TBST three times, the membranes were subsequently incubated with goat anti-mouse (bs-0296G) or anti-rabbit (bs-0295G) horseradish peroxidase-conjugated secondary antibodies at 37°C for 1.5 h at a dilution of 1:1,000. Antibody complexes were detected by enhanced chemiluminescence using the Super ECL Plus (Applygen Technologies, Inc., Beijing, China). Subsequently, the western blotting results were analyzed using a Tanon 1600R Gel Imaging System (Tanon Science and Technology Co., Ltd., Shanghai, China).

Statistical analysis

Quantitative data from the experiments are presented as the mean ± standard deviation of triplicate experiments. Differences between mean values of normally distributed data were analyzed using one-way analysis of variance. Statistical analyses were conducted using the SPSS software, version 17.0 (SPSS, Inc., Chicago, IL, USA). P<0.05 was considered to indicate a statistically significant difference.

Results

mRNA expression levels of 14-3-3γ in transfected DCMECs

In order to determine whether the recombinant pGCMV/IRES/EGFP-14-3-3γ expression vector had been successfully constructed, the mRNA expression levels of 14-3-3γ were detected. DCMECs were transfected with pGCMV/IRES/EGFP-14-3-3γ or pGCMV/IRES/EGFP for 24 h, after which total RNA was extracted and analyzed by RT-qPCR The relative mRNA expression levels of 14-3-3γ in the DCMECs transfected with pGCMV/IRES/EGFP-14-3-3γ were significantly increased, as compared with the control group and pGCMV/IRES/EGFP group (P<0.01; Fig. 1). These results suggested that the pGCMV/IRES/EGFP-14-3-3γ expression vector was effectively expressed in cultured DCMECs.

14-3-3γ regulates the viability of LPS-induced DCMECs

In order to investigate whether 14-3-3γ was able to confer protection against LPS-induced DCMEC damage, pre-transfected cells were treated with 1 µg/ml LPS for 24 h and MTT and LDH activity assays were conducted to evaluate cell damage. Cell viability was significantly reduced, and LDH activity was significantly increased, in the LPS-treated DCMECs, as compared with the control group (P<0.01). However, 14-3-3γ overexpression significantly increased cell viability and decreased LDH activity in the LPS-induced DCMECs by 34.29 and 16.30% respectively, as compared with the LPS-treated group (P<0.01 and P<0.05), respectively (Table II). Conversely, treatment with 14-3-3γ siRNA significantly reduced the cell viability and increased the LDH activity in LPS-induced DCMECs by 15.74 and 18.10% respectively, as compared with the LPS-treated group (P<0.05), respectively (Table III). These findings suggested that 14-3-3γ was capable of increasing cell viability in LPS-induced DCMECs.

Table II.

Effects of 14–3–3γ overexpression on cell viability and LDH activity in LPS-induced dairy cow mammary epithelial cells.

Table II.

Effects of 14–3–3γ overexpression on cell viability and LDH activity in LPS-induced dairy cow mammary epithelial cells.

GroupsViability (%)LDH Viability (U/l)
Control95.53±0.9652.05±4.31
LPS 56.21±0.73a    125.7±12.13a
pGCMV/IRES/EGFP-14–3–3γ + LPS 70.49±0.81b   105.2±5.63c
pGCMV/IRES/EGFP + LPS 59.89±0.81a      129.12±10.38a

{ label (or @symbol) needed for fn[@id='tfn2-etm-0-0-3029'] } Data are presented as the mean ± standard deviation of three independent experiments.

a P<0.05 vs. the control group

b P<0.01 vs. the LPS group

c P<0.01 vs. the control group. LPS, lipopolysaccharide; LDH, lactate dehydrogenase; GCMV, grapevine chrome mosaic virus; IRES, internal ribosome entry site; EGFP, enhanced green fluorescent protein.

Table III.

Effects of 14–3–3γ siRNA on cell viability and LDH activity in LPS-induced dairy cow mammary epithelial cells.

Table III.

Effects of 14–3–3γ siRNA on cell viability and LDH activity in LPS-induced dairy cow mammary epithelial cells.

GroupsViability (%)LDH Viability (U/l)
Control93.73±0.8360.05±5.81
LPS 60.01±0.63a      131.76±14.15a
siRNA-14–3–3γ+LPS 50.56±0.59b    155.62±8.64c
Negative control+LPS 58.79±0.91a      138.14±11.18a

{ label (or @symbol) needed for fn[@id='tfn6-etm-0-0-3029'] } Data are presented as the mean ± standard deviation of three independent experiments.

a P<0.01 vs. the control group

b P<0.05 vs. the LPS group

c P<0.05 vs. the control group. LPS, lipopolysaccharide; LDH, lactate dehydrogenase; siRNA, small interfering RNA.

14-3-3γ regulates LPS-induced apoptosis in DCMECs

In order to evaluate the effect of 14-3-3γ on LPS-induced DCMEC apoptosis, the extent of apoptosis was analyzed morphologically by staining the cells with AO and performing fluorescence microscopy. Normal viable cells were dyed with AO and emitted uniform green fluorescence. Conversely, cells undergoing apoptosis emitted a yellow-green fluorescence and exhibited condensed or fragmented chromatin. In addition, 200 stained cells were randomly counted and viability was calculated as the percentage of the number of living cells, as compared with the total number of cells. LPS treatment significantly reduced the viability and increased the extent of apoptosis of DCMECs, as compared with the control group (P<0.01). Conversely, 14-3-3γ overexpression significantly increased the viability of the cells and decreased the extent of cell apoptosis, as compared with the LPS-treated group (P<0.01; Fig. 2A and B). Following treatment with 14-3-3γ siRNA, opposite results were observed, as compared with those for the 14-3-3γ recombinant plasmid (Fig. 2A and C).

14-3-3γ regulates the expression of genes associated with milk fat synthesis in LPS-induced DCMECs at the transcriptional level

In order to investigate the effects of 14-3-3γ on the mRNA expression levels of genes associated with milk fat synthesis in LPS-induced DCMECs, RT-qPCR was conducted. LPS significantly decreased the mRNA expression levels of SREBP1, PPARG, cluster of differentiation 36 (CD36), ACC, FAS and fatty acid binding protein (FABP), as compared with the control group (P<0.05). Conversely, the mRNA expression levels of these genes were significantly increased in LPS-induced DCMECs overexpressing 14-3-3γ, as compared with the LPS group (P<0.01; Fig. 3A), whereas treatment with siRNA-14-3-3γ significantly reduced the mRNA expression levels of these genes (P<0.05; Fig. 3B).

14-3-3γ regulates the activities of FAS and ACC in LPS-induced DCMECs

In order to determine whether 14-3-3γ affects milk fat synthesis-associated enzymes in LPS-induced DCMECs, the activities of FAS and ACC were analyzed using enzyme activity assays. The activities of FAS and ACC were significantly increased in LPS-induced DCMECs overexpressing 14-3-3γ, as compared with the LPS group (P<0.01). Conversely, 14-3-3γ siRNA significantly decreased the activities of FAS and ACC, as compared with the LPS group (P<0.01; Fig. 4). These findings suggested that 14-3-3γ was capable of increasing the activities of milk fat synthesis-associated enzymes in LPS-induced DCMECs.

14-3-3γ regulates the expression of proteins associated with milk fat synthesis in LPS-induced DCMECs

In order to investigate whether proteins involved in milk fat synthesis signaling pathways are regulated by 14-3-3γ in LPS-induced DCMECs, the protein expression levels of SREBP1, p-SREBP1, PPARG and p-PPARG were analyzed by western blotting. The protein expression levels of SREBP1 and PPARG in LPS-treated DCMECs were significantly decreased, as compared with the control group (P<0.05). Conversely, the protein expression levels of SREBP1 and PPARG were significantly increased in LPS-induced DCMECs overexpressing 14-3-3γ, as compared with the LPS group (P<0.05; Fig. 5A), whereas 14-3-3γ siRNA significantly inhibited the expression of SREBP1 and PPARG proteins in LPS-induced DCMECs, as compared with the LPS group (P<0.01; Fig. 5B). These findings suggested that 14-3-3γ was capable of increasing the expression of proteins associated with milk fat synthesis in LPS-induced DCMECs.

Discussion

The present study investigated the protective effects of 14-3-3γ overexpression against LPS-induced damage in DCMECs, and demonstrated that a high level of 14-3-3γ protein was able to attenuate LPS-induced apoptosis or death of DCMECs, and promote milk fat synthesis. Conversely, treatment of DCMECs with 14-3-3γ siRNA revealed opposed results; thus suggesting that 14-3-3γ may have a potential role in preventing SARA-induced MFD.

Bacterial LPS concentrations are markedly increased during SARA (23). LPS, which is a major component of the outer membrane of gram-negative bacteria, is a highly efficient pro-inflammatory response factor that triggers a series of immune responses and results in the production of cytokines, including TNF-α, IL-6 and IL-1β (24). In addition, LPS has been shown to significantly increase the mRNA expression levels of NF-κB (25.26). It has been reported that LPS is among the most potent microbial inducer of inflammation, which is a cascade of intracellular events that may initiate cell death (27). Furthermore, LPS has been shown to induce the activation of executioner caspases and other signaling cascades that ultimately lead to apoptosis and destruction of cells (28). Previous studies have implicated 14-3-3 proteins, a set of highly conserved scaffolding proteins, in the regulation of numerous important cellular processes, including the cell cycle, apoptosis and mitogenic signaling (29,30). In addition, 14-3-3 proteins have been shown to have critical roles in various vital physiological and pathological processes by controlling the activity of their target proteins (31).

Our previous study (11) demonstrated that 14-3-3γ may exert promising anti-inflammatory activity by downregulating the NF-κB and mitogen-activated protein kinase signaling pathways. In the present study, a pGCMV/IRES/EGFP-14-3-3γ expression vector was successfully constructed and transfected into DCMECs. After 24 h, the cells were treated with 1 µg/ml LPS for 24 h, after which the effects of LPS on DCMECs were analyzed using the MTT, LDH activity and AO double staining assays. It has previously been reported that the ability to produce milk is determined by the number and activity of secreting cells in ruminants (32). In the present study, LPS reduced the viability of DCMECs, increased the activity of LDH, and promoted the apoptosis of DCMECs; thus indicating that LPS induced DCMECs injury. However, in the DCMECs transfected with pGCMV/IRES/EGFP-14-3-3γ, 14-3-3γ overexpression significantly increased the viability of the LPS-induced cells and decreased the extent of apoptosis. Conversely, the inhibition of 14-3-3γ using 14-3-3γ siRNA significantly decreased the viability of LPS-induced DCMECs; thus suggesting that 14-3-3γ may regulate LPS-induced cell viability. The results of the present study suggested that 14-3-3γ overexpression may have protective effects against LPS-induced DCMECs injury.

SARA has been shown to affect both the viability of DCMECs, as well as their ability to lactate; in particular it has been shown to inhibit milk fat synthesis (10). It has been suggested that SARA may initiate the activation of systemic inflammatory responses and other essential metabolic disturbances of the host, leading to MFD. MFD is a syndrome characterized by a reduction in milk fat content (3336). In a previous study, LPS stimulated lipolysis in adipose cells via the Toll-like receptor 4 and MEK1/2-ERK1/2 signaling pathway in the process of inhibiting milk fat synthesis (37). Previous studies have reported that LPS may affect milk fat synthesis, and indirectly downregulate the expression levels of the fatty acid transporter, via the release of proinflammatory cytokines (3840). Our previous study demonstrated that 14-3-3γ overexpression was able to suppress the production of TNF-α and IL-6 in cell culture supernatants. Therefore, since 14-3-3γ overexpression has been shown to suppress inflammation and increase the activity of cells, the present study hypothesized it may also improve the milk fat synthesis. In the present study, LPS significantly decreased the activities of key enzymes associated with de novo fatty acid synthesis, including FAS and ACC, in LPS-induced DCMECs, and this is consistent with a previous study (8). However, when the 14-3-3γ protein was overexpressed in DCMECs, the activities of FAS and ACC were significantly increased, whereas, the opposite results were observed when 14-3-3γ was inhibited using siRNA. These results suggested that 14-3-3γ overexpressed was able to promote de novo fatty acid synthesis.

SREBP1 and PPARG have important roles in gene networks associated with milk fat synthesis, and have been shown to regulate the expression of numerous genes associated with milk fat synthesis (41). PPARG, which is a member of the nuclear receptor superfamily of transcription factors that have been shown to be responsible for the transcriptional regulation of fatty acid metabolism (42), is activated by lipophilic ligands and is important for maintaining the quality of milk by inhibiting the production of inflammatory lipids in lactating mammary glands (43). SREBP1 is a member of the basic helix-loop-helix transcription factor family, which are the major nuclear transcription factors that contribute to the regulation of milk fat synthesis (44). In the present study, LPS significantly decreased the expression levels of SREBP1 and PPARG in DCMECs, and this affect was attenuated by 14-3-3γ overexpression in these cells. Conversely, the expression levels of SREBP1 and PPARG were significantly decreased in LPS-induced DCMECs transfected with pGCMV/IRES/EGFP-14-3-3γ following the inhibition of 14-3-3γ expression using siRNA. These results suggested that 14-3-3γ was able to regulate genes associated with fatty acid metabolism in order to improve milk fat synthesis by increasing the expression levels of SREBP1 and PPARG in LPS-induced DCMECs.

In conclusion, the present study demonstrated that a high level of 14-3-3γ protein exerted protective effects against LPS-induced DCMEC injury, by increasing cell viability and promoting milk fat synthesis through the upregulation of SREBP1, PPARG, FAS, ACC, CD36 and FABP genes. It has previously been demonstrated that the expression levels of 14-3-3γ were affected by estrogen and prolactin (16); thus suggesting that the addition of nutrients to the dairy cow diet during lactation may allow the expression levels of 14-3-3γ to be regulated, in order to prevent SARA-induced MFD.

Acknowledgements

The present study was supported by the Major State Basic Research Development Program of China (program 973; grant no. 2011CB100804) and the National High Technology Research and Development Program of China (program 863; grant no. 2006AA10Z1A4).

Glossary

Abbreviations

Abbreviations:

LPS

lipopolysaccharide

DCMEC

dairy cow mammary epithelial cell

SARA

subacute ruminal acidosis

MFD

milk fat depression

References

1 

Plaizier JC, Krause DO, Gozho GN and McBride BW: Subacute ruminal acidosis in dairy cows: The physiological causes, incidence and consequences. Vet J. 176:21–31. 2008. View Article : Google Scholar : PubMed/NCBI

2 

Gozho GN, Krause DO and Plaizier JC: Ruminal lipopolysaccharide concentration and inflammatory response during grain-induced subacute ruminal acidosis in dairy cows. J Dairy Sci. 90:856–866. 2007. View Article : Google Scholar : PubMed/NCBI

3 

Waldron MR, Nishida T, Nonnecke BJ and Overton TR: Effect of lipopolysaccharide on indices of peripheral and hepatic metabolism in lactating cows. J Dairy Sci. 86:3447–3459. 2003. View Article : Google Scholar : PubMed/NCBI

4 

Sweet MJ and Hume DA: Endotoxin signal transduction in macrophages. J Leukoc Biol. 60:8–26. 1996.PubMed/NCBI

5 

Zandi E, Rothwarf DM, Delhase M, Hayakawa M and Karin M: The IkappaB kinase complex (IKK) contains two kinase subunits, IKKalpha and IKKbeta, necessary for IkappaB phosphorylation and NF-kappaB activation. Cell. 91:243–252. 1997. View Article : Google Scholar : PubMed/NCBI

6 

Ansari N, Khodagholi F, Amini M and Shaerzadeh F: Attenuation of LPS-induced apoptosis in NGF-differentiated PC12 cells via NF-kB pathway and regulation of cellular redox status by an oxazine derivative. Biochimie. 93:899–908. 2011. View Article : Google Scholar : PubMed/NCBI

7 

Ling B and Alcorn J: LPS-induced inflammation downregulates mammary gland glucose, fatty acid, and L-carnitine transporter expression at different lactation stages. Res Vet Sci. 89:200–202. 2010. View Article : Google Scholar : PubMed/NCBI

8 

Zebeli Q and Ametaj BN: Relationships between rumen lipopolysaccharide and mediators of inflammatory response with milk fat production and efficiency in dairy cows. J Dairy Sci. 92:3800–3809. 2009. View Article : Google Scholar : PubMed/NCBI

9 

Waggoner JW, Löest CA, Turner JL, Mathis CP and Hallford DM: Effects of dietary protein and bacterial lipopolysaccharide infusion on nitrogen metabolism and hormonal responses of growing beef steers. J Anim Sci. 87:3656–3668. 2009. View Article : Google Scholar : PubMed/NCBI

10 

Zhang YD, Wang JQ and Hu T: Infusion of lipopolysaccharide into external pudendal artery of lactating dairy cows: Effects on milk composition and milk fat constituents. Dong Wu Ying Yang Xue Bao. 23:1317–1323. 2011.

11 

Liu L, Lin Y, Liu L, Bian Y, Zhang L, Gao X and Li Q: 14-3-3γ regulates lipopolysaccharide-induced inflammatory responses and lactation in dairy cow mammary epithelial cells by inhibiting NF-κB and MAPKs and up-regulating mTOR signaling. Int J Mol. 16:16622–16641. 2015. View Article : Google Scholar

12 

López-Soriano FJ and Williamson DH: Acute effects of endotoxin (lipopolysaccharide) on tissue lipid metabolism in the lactating rat. The role of delivery of intestinal glucose. Mol Cell Biochem. 141:113–120. 1994. View Article : Google Scholar : PubMed/NCBI

13 

Hosing AS, Kundu ST and Dalal SN: 14-3-3 Gamma is required to enforce both the incomplete S phase and G2 DNA damage checkpoints. Cell Cycle. 7:3171–3179. 2008. View Article : Google Scholar : PubMed/NCBI

14 

Pozuelo-Rubio M: Proteomic and biochemical analysis of 14-3-3-binding proteins during C2-ceramide-induced apoptosis. FEBS J. 277:3321–3342. 2010. View Article : Google Scholar : PubMed/NCBI

15 

van Hemert MJ, Steensma HY and van Heusden GP: 14-3-3 proteins: Key regulators of cell division, signalling and apoptosis. Bioessays. 23:936–946. 2001. View Article : Google Scholar : PubMed/NCBI

16 

Huang JG: Proteomic analysis of the lactation regulation in DCMECs treated with different hormones (unpublished PhD thesis). Harbin, China: Northeast Agricultural University. 2012.

17 

Liu D, Yin D, Yan GH, Sun D, Xu M and He M: Protective role of 14-3-3γ in burn and LPS-induced rat myocardial injury. Zhong Guo Bing Li Sheng Li Za Zhi. 28:1160–1165. 2012.(In Chinese).

18 

Liu D, Yin D, Sun D, Xu M and He M: The Role of Bax in the 14-3-3γ protection against cardiomyocyte damage induced by LPS. Tian Jin Yi Yao. 40:1222–1225. 2012.(In Chinese).

19 

Zhao K, Liu HY, Zhou MM and Liu JX: Establishment and characterization of a lactating bovine mammary epithelial cell model for the study of milk synthesis. Cell Biol Int. 34:717–721. 2010. View Article : Google Scholar : PubMed/NCBI

20 

Li HM, Wang CM, Li QZ and Gao XJ: MiR-15a decreases bovine mammary epithelial cell viability and lactation and regulates growth hormone receptor expression. Molecules. 17:12037–12048. 2012. View Article : Google Scholar : PubMed/NCBI

21 

Lu LM, Li QZ, Huang JG and Gao XJ: Proteomic and functional analyses reveal MAPK1 regulates milk protein synthesis. Molecules. 18:263–275. 2012. View Article : Google Scholar : PubMed/NCBI

22 

Zhang Q, Zhao XH and Wang ZJ: Cytotoxicity of flavones and flavonols to a human esophageal squamous cell carcinoma cell line (KYSE-510) by induction of G2/M arrest and apoptosis. Toxicol In Vitro. 23:797–807. 2009. View Article : Google Scholar : PubMed/NCBI

23 

Khafipour E, Krause DO and Plaizier JC: A grain-based subacute ruminal acidosis challenge causes translocation of lipopolysaccharide and triggers inflammation. J Dairy Sci. 92:1060–1070. 2009. View Article : Google Scholar : PubMed/NCBI

24 

Bruckmaier RM: Gene expression of factors related to the immune reaction in response to intramammary Escherichia coli lipopolysaccharide challenge. J Dairy Res. 72:120–124. 2005. View Article : Google Scholar : PubMed/NCBI

25 

Cheng G, Zhao Y, Li H, Wu Y, Li X, Han Q, Dai C and Li Y: Forsythiaside attenuates lipopolysaccharide-induced inflammatory responses in the bursa of Fabricius of chickens by downregulating the NF-kB signaling pathway. Exp Ther Med. 7:179–184. 2014.PubMed/NCBI

26 

Reddy DB and Reddanna P: Chebulagic acid (CA) attenuates LPS-induced inflammation by suppressing NF-kappaB and MAPK activation in RAW 264.7 macrophages. Biochem Biophys Res Commun. 381:112–117. 2009. View Article : Google Scholar : PubMed/NCBI

27 

Wong PM, Chugn SW and Sultzer BM: Genes, receptors, signals and responses to lipopolysaccharide endotoxin. Scand J Immunol. 51:123–127. 2000. View Article : Google Scholar : PubMed/NCBI

28 

Yang F, Sun X, Beech W, Teter B, Wu S, Sigel J, Vinters HV, Frautschy SA and Cole GM: Antibody to caspase-cleaved actin detects apoptosis in differentiated neuroblastoma and plaque-associated neurons and microglia in Alzheimer's disease. Am J Pathol. 152:379–389. 1998.PubMed/NCBI

29 

Radhakrishnan VM and Martinez JD: 14-3-3gamma induces oncogenic transformation by stimulating MAP kinase and PI3K signaling. PLOS One. 5:114332010. View Article : Google Scholar

30 

Samuel T, Weber HO, Rauch P, Verdoodt B, Eppel JT, McShea A, Hermeking H and Funk JO: The G2/M regulator 14-3-3sigma prevents apoptosis through sequestration of Bax. J Biol Chem. 276:45201–45206. 2001. View Article : Google Scholar : PubMed/NCBI

31 

Obsilova V, Silhan J, Boura E, Teisinger J and Obsil T: 14-3-3 proteins: A family of versatile molecular regulators. Physiol Res. 57(Suppl 3): S11–S21. 2008.PubMed/NCBI

32 

Boutinaud M, Guinard-Flamenta J and Jammes H: The number and activity of mammary epithelial cells, determining factors for milk production. Reprod Nutr Dev. 44:499–508. 2004. View Article : Google Scholar : PubMed/NCBI

33 

Ametaj BN, Emmanuel DG, Zebeli Q and Dunn SM: Feeding high proportions of barley grain in a total mixed ration perturbs diurnal patterns of plasma metabolites in lactating dairy cows. J Dairy Sci. 92:1084–1091. 2009. View Article : Google Scholar : PubMed/NCBI

34 

Zebeli Q, Dunn SM and Ametaj BN: Perturbations of plasma metabolites correlated with the rise of rumen endotoxin in dairy cows fed diets rich in easily degradable carbohydrates. J Dairy Sci. 94:2374–2382. 2011. View Article : Google Scholar : PubMed/NCBI

35 

Mao SY, Zhang RY, Wang DS and Zhu WY: Impact of subacute ruminal acidosis (SARA) adaptation on rumen microbiota in dairy cattle using pyrosequencing. Anaerobe. 24:12–19. 2013. View Article : Google Scholar : PubMed/NCBI

36 

Kleen JL, Hooijer GA, Rehage J and Noordhuizen JP: Subacute ruminal acidosis (SARA): A review. J Vet Med A Physiol Pathol Clin Med. 50:406–414. 2003. View Article : Google Scholar : PubMed/NCBI

37 

Zu L, He J, Jiang H, Xu C, Pu S and Xu G: Bacterial endotoxin stimulates adipose lipolysis via toll-like receptor 4 and extracellular signal-regulated kinase pathway. J Biol Chem. 284:5915–5926. 2009. View Article : Google Scholar : PubMed/NCBI

38 

Ling B and Alcorn J: LPS-induced inflammation downregulates mammary gland glucose, fatty acid, and L-carnitine transporter expression at different lactation stages. Res Vet Sci. 89:200–202. 2010. View Article : Google Scholar : PubMed/NCBI

39 

López-Soriano FJ and Williamson DH: Acute effects of endotoxin (lipopolysaccharide) on tissue lipid metabolism in the lactating rat. The role of delivery of intestinal glucose. Mol Cell Biochem. 141:113–120. 1994. View Article : Google Scholar : PubMed/NCBI

40 

Pekala PH, Kawakami M, Angus CW, Lane MD and Cerami A: Selective inhibition of synthesis of enzymes for de novo fatty acid biosynthesis by an endotoxin-induced mediator from exudate cells. Proc Natl Acad Sci USA. 80:2743–2747. 1983. View Article : Google Scholar : PubMed/NCBI

41 

Bionaz M and Loor JJ: Gene networks driving bovine milk fat synthesis during the lactation cycle. BMC Genomics. 9:3662008. View Article : Google Scholar : PubMed/NCBI

42 

Yang Q and Li Y: Roles of PPARs on regulating myocardial energy and lipid homeostasis. J Mol Med (Berl). 85:697–706. 2007. View Article : Google Scholar : PubMed/NCBI

43 

Wan Y, Saghatelian A, Chong LW, Zhang CL, Cravatt BF and Evans RM: Maternal PPAR gamma protects nursing neonates by suppressing the production of inflammatory milk. Genes Dev. 21:1895–1908. 2007. View Article : Google Scholar : PubMed/NCBI

44 

Anderson SM, Rudolph MC, McManaman JL and Neville MC: Key stages in mammary gland development. Secretory activation in the mammary gland: It's not just about milk protein synthesis! Breast Cancer Res. 9:2042007.

Related Articles

Journal Cover

April-2016
Volume 11 Issue 4

Print ISSN: 1792-0981
Online ISSN:1792-1015

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Liu L, Zhang L, Lin Y, Bian Y, Gao X, Qu B and Li Q: 14-3‑3γ regulates cell viability and milk fat synthesis in lipopolysaccharide-induced dairy cow mammary epithelial cells. Exp Ther Med 11: 1279-1287, 2016
APA
Liu, L., Zhang, L., Lin, Y., Bian, Y., Gao, X., Qu, B., & Li, Q. (2016). 14-3‑3γ regulates cell viability and milk fat synthesis in lipopolysaccharide-induced dairy cow mammary epithelial cells. Experimental and Therapeutic Medicine, 11, 1279-1287. https://doi.org/10.3892/etm.2016.3029
MLA
Liu, L., Zhang, L., Lin, Y., Bian, Y., Gao, X., Qu, B., Li, Q."14-3‑3γ regulates cell viability and milk fat synthesis in lipopolysaccharide-induced dairy cow mammary epithelial cells". Experimental and Therapeutic Medicine 11.4 (2016): 1279-1287.
Chicago
Liu, L., Zhang, L., Lin, Y., Bian, Y., Gao, X., Qu, B., Li, Q."14-3‑3γ regulates cell viability and milk fat synthesis in lipopolysaccharide-induced dairy cow mammary epithelial cells". Experimental and Therapeutic Medicine 11, no. 4 (2016): 1279-1287. https://doi.org/10.3892/etm.2016.3029