Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
November-2018 Volume 16 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
November-2018 Volume 16 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Toxic effects of four kinds of dental restorative materials on fibroblast HGF‑1 and impacts on expression of Bcl‑2 and Bax genes

  • Authors:
    • Yuanyuan Wei
    • Jian Sun
    • Qinglin Men
    • Xiaobei Tian
  • View Affiliations / Copyright

    Affiliations: Department of Prosthodontics, Xuzhou Stomatology Hospital, Xuzhou, Jiangsu 221003, P.R. China, Department of Endodontics, Xuzhou Stomatology Hospital, Xuzhou, Jiangsu 221003, P.R. China
  • Pages: 4155-4161
    |
    Published online on: September 7, 2018
       https://doi.org/10.3892/etm.2018.6705
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

The aim of this study was to investigate and discuss the toxic effect of four kinds of dental restorative materials on fibroblast HGF‑1 and their impacts on the expression of B‑cell lymphoma‑2 (Bcl‑2) and Bcl‑2‑associated X protein (Bax) genes. One hundred and ninety‑two patients (240 diseased teeth), who received dental restoration in the Department of Stomatology of Xuzhou Stomatology Hospital from March 2014 to March 2015, were selected and randomly divided into four groups; namely, silver amalgam group, glass‑ionomer cement group, nichrome group and novel nano‑composite resin group, with 60 teeth in each group. The diseased teeth were restored. The fibroblast HGF‑1 was incubated in the water extracts from the four kinds of materials and ordinary cell culture fluid (negative control). Reverse transcription‑quantitative polymerase chain reaction (RT‑qPCR) and western blotting were used to measure the levels of Bcl‑2 and Bax. A flow cytometer was applied to detect cell apoptosis. RT‑qPCR results showed that compared with those in the negative control group, the mRNA expression levels of Bcl‑2 in the cells of silver amalgam group, glass‑ionomer cement group and nichrome group were decreased, while those of Bax were upregulated (P<0.05). The mRNA expression of Bcl‑2 in glass‑ionomer cement group was the highest among these three groups; the mRNA expression of Bax in nichrome group was the highest of all groups. The western blotting results revealed the same tendency as those of RT‑qPCR. The results via the flow cytometer showed that cell apoptosis in nichrome group, silver amalgam group and glass‑ionomer cement group was increased significantly (P<0.05) compared with that in the negative control group. The novel nano‑composite resin has no obvious toxic effect on cells, and its clinical application effect is better than that of traditional dental restorative materials, which is worthy of application and generalization in clinical practice.

Introduction

The composite repair material, such as metallic, ceramic and resin material, as well as glass-ionomer cement, is one of the numerous achievements in the research on modern biomaterials (1,2); its biocompatibility is so good that it is comparable to biological tissues, providing great convenience for the mechanical property, in situ immobilization and beautiful outlook of the prostheses (3). However, when these materials are utilized for dental restoration treatment in current clinical practices, phenomena such as abnormal hyperplasia, swelling and aching, and increased secretion at gingival crevice often occur in the gingiva adjacent to the repair materials (4,5). Therefore, searching for safe and effective dental restorative materials has become an urgent issue that needs to be addressed. In this research, the novel nano-composite resin researched and developed by the College of Materials Science and Engineering, Nanjing University (Nanjing, China) was applied and compared with conventional silver amalgam, glass-ionomer cement and nichrome to study the efficacy and cytotoxicity in clinical patients, and to determine the safety and effect of novel nano-composite resin material.

Patients and methods

Clinical data

One hundred and ninety-two patients (240 diseased teeth), who received dental restoration in the Department of Stomatology of Xuzhou Stomatology Hospital (Xuzhou, China) from March 2014 to March 2015, were selected and randomly divided into four groups, with 60 teeth in each group. With regard to different dental restorative materials applied, the groups were called silver amalgam group, glass-ionomer cement group, nichrome group and novel nano-composite resin group, respectively. The novel nano-composite resin material was researched and developed by the College of Materials Science and Engineering, Nanjing University, and the glass-ionomer cement, silver amalgam and nichrome materials were purchased from Shanghai Huifeng Medical Instrument Co., Ltd. (Shanghai, China).

Inclusion criteria of participants: i) patients with at least one defect tooth after oral examination, on which dental restoration needed to be performed; and ii) after root canal therapy, patients without apparent periodontal pain, percussion pain and shadow at the tooth root as well as notable widening around the root through X-ray examination (6). The side effects and complications of the patients were evaluated through follow-up at 1 month and 2 years later. Informed consent was signed by all the patients or the guardians. The study was approved by the Ethics Committee of Xuzhou Stomatology Hospital.

Preparation of water extracts

Four kinds of materials (silver amalgam, glass-ionomer cement, nichrome and novel nano-composite resin) were made into round pieces with a diameter of 10 mm and thickness of 1 mm, respectively, followed by polishing, ultrasonic cleaning, disinfection with 75% alcohol and overnight ultraviolet radiation; later, 1 piece of each kind was placed in a 6-well plate for cell culture. According to China's national standard GB/T16886.521997 (‘Biological evaluation criteria for medical devices - Part 5: Tests for in vitro cytotoxicity’), the ratio of the surface area of the material to the volume of the extraction medium should be 0.5–6 cm2/ml (7). In this study, this ratio was 1 cm2/ml. Extract was DMEM containing 5% fetal bovine serum. Based on previous studies, 6-well plate was put in an incubator at 37°C and incubated for 1 week (8). In negative control group, DMEM containing 5% fetal bovine serum, without any treatment, was adopted.

Cell culture

Human fibroblast cell line L-929 was purchased from the Cell Bank of the American Type Culture Collection (ATCC; Manassas, VA, USA). Cell culture was conducted in the high-glucose DMEM containing 10% fetal bovine serum, to which 100 µg/ml streptomycin and 100 IU/ml penicillin were added. The cell culture flask was placed in an incubator containing 5% CO2 at 37°C with a humidity of 95%.

Detection of the expression of apoptosis-related indexes [B-cell lymphoma-2 (Bcl-2) and Bcl-2-associated X protein (Bax)] via reverse transcription quantitative polymerase chain reaction (RT-qPCR)

After the cells were cultured in the four kinds of water extracts for 24 h, respectively, RNeasy kit (Qiagen GmbH, Hilden, Germany) was used to extract the total messenger RNA (mRNA). Total mRNA (1.0 µg) was synthesized into complementary DNA (cDNA) using the reverse transcription kit (SuperScript® VILO™ cDNA Synthesis Kit and Master Mix; Thermo Fisher Scientific, Inc., Waltham, MA, USA). The expression of Bax and Bcl-2 was detected via the qRT-PCR kit (Guangzhou FulenGen Co., Ltd., Guangdong, China) and fluorescence-based RT-qPCR instrument (Thermo Fisher Scientific, Inc.). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was adopted as the internal control of calibration for each sample. The formula for the relative mRNA expression of each index was 2−ΔΔCq [ΔCq = Cq (target gene) - Cq (GAPDH)] (9). All the primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd (Shanghai, China). The corresponding primer sequences are shown in Table I.

Table I.

Primer sequences for RT-qPCR.

Table I.

Primer sequences for RT-qPCR.

Gene namePrimer sequence
BaxF: 5′-3′ AGACAGGGGCCTTTTTGCTAC
R: 3′-5′ AATTCGCCGGAGACACTCG
Bcl-2F: 5′-3′ GCTACCGTCGTGACTTCGC
R: 3′-5′ CCCCACCGAACTCAAAGAAGG
GAPDHF: 5′-3′ TGACTTCAACAGCGACACCCA
R: 3′-5′ CACCCTGTTGCTGTAGCCAAA

[i] Bax, Bcl-2-associated X protein; Bcl-2, B-cell lymphoma-2; F, forward; R, reverse.

Detection of the expression of apoptosis-related indexes (Bcl-2 and Bax) via western blotting

After culturing in the four kinds of water extracts for 24 h, respectively, the cells were lysed on ice with radio-immunoprecipitation assay (RIPA) lysis buffer (Beyotime Biotechnology, Guangzhou, China) for 1 h, followed by extraction of protein supernatant through centrifugation at 13,000 × g, 4°C for 30 min. Bicinchoninic acid (BCA) protein assay kit was applied to measure the protein concentration, and then an appropriate amount of loading buffer (both from Beyotime Biotechnology) was added for denaturation at 100°C for 5 min. Every sample at an equal loading of 40 µg, underwent electrophoresis. Later, the proteins were transferred to the polyvinylidene fluoride (PVDF) membrane. Then the membrane was blocked in 5% skim milk at room temperature for 1 h, followed by incubation of rabbit anti-human Bax, Bcl-2 and GAPDH monoclonal antibodies (1:2,000; cat nos. ab32503, ab32124 and ab181602; all from Abcam, Cambridge, UK). The membrane was washed with Tris-buffered saline and Tween-20 (TBST), and incubated with corresponding horseradish peroxidase-conjugated goat anti-rabbit secondary polyclonal antibody (1:5,000; cat no. A0208; Beyotime Biotechnology, Shanghai, China). Later, an enhanced chemiluminescence (ECL) detection system (Bio-Rad Laboratories, Inc., Hercules, CA, USA) was utilized to visualize the membrane, and a gel analyzer (GraphPad Prism 5; GraphPad Software, Inc., La Jolla, CA, USA) was applied for gray analysis. The relative content of the target protein was the ratio of the target protein to gray value of the corresponding internal control band.

Detection of the cell apoptosis level via flow cytometer

The apoptosis level of cells in each group was measured using an apoptosis kit (BD Biosciences, Franklin Lakes, NJ, USA). After the cells were treated with different water extracts for 48 h, the cell culture fluids were absorbed and reserved, which were centrifuged at 850 × g for 5 min together with the digested cells, followed by washing with phosphate-buffered saline (PBS) and centrifugation twice. After that, the samples were resuspended in 100 µl 1X binding buffer, to which 5 µl propidium iodide (PI) and 5 µl Annexin V were added, followed by incubation in the dark at room temperature for 15 min. Then the samples were sent to the scientific research center of the hospital within 1 h for detection by a flow cytometer (FACSCalibur; BD Biosciences, Detroit, MI, USA). Cell apoptosis rate = early apoptosis rate + late apoptosis rate.

Statistical methods

GraphPad Prism software (version 5.01) was used for the statistical analysis of the experimental results. The data were expressed as mean ± SD. The one-way analysis of variance (ANOVA) was applied to compare the differences in indexes among multiple groups and the least significant difference (LSD) test was the post hoc test used. P<0.05 was considered to indicate a statistically significant difference.

Results

General information of patients

As shown in Table II, there was no statistically significant difference in age, sex and tooth structure among the four groups of patients (P>0.05).

Table II.

General information of patients (mean ± SD).

Table II.

General information of patients (mean ± SD).

ItemsSilver amalgam group (n=60)Novel nano-composite resin group (n=60)Glass-ionomer cement group (n=60)Nichrome group (n=60)P-value
Age (years)37.34±12.8335.48±14.0236.16±14.2337.15±15.030.765
Sex 0.926
  Male33312632
  Female27293428
Anterior tooth (n)182118200.738
Premolar (n)221719190.815
Molar (n)202223210.892

[i] There is no statistically significant difference in age, sex and tooth structure among the four groups of patients (P>0.05).

Patient complications at 1 month after repair

The follow-up results at 1 month after the treatment of the patients showed (Table III) that in silver amalgam group, there were 3 cases of bleeding, 2 cases of local anaphylaxis, 3 cases of gingival inflammation and 2 cases of toothache; in novel nano-composite resin group, there was 1 case of bleeding and toothache, respectively; in glass-ionomer cement group, there was 1 case of bleeding, 2 cases of gingival inflammation and 3 cases of toothache; in nichrome group, the cases of bleeding, local anaphylaxis, gingival inflammation, oral ulcer and toothache were 3, 3, 1, 1 and 4, respectively. At 1 month after the treatment there was no statistically significant difference in the total number of diseased teeth between nichrome group and control group (P>0.05); the total number of diseased teeth in novel nano-composite resin group and glass-ionomer cement group was significantly decreased compared with that in control group (P<0.05), of which the total number of diseased teeth in novel nano-composite resin group was smaller than that in glass-ionomer cement group (P<0.05).

Table III.

Patient complications at 1 month after repair.

Table III.

Patient complications at 1 month after repair.

ItemsSilver amalgam group (n=60)Novel nano-composite resin group (n=60)Glass-ionomer cement group (n=60)Nichrome group (n=60)
Bleeding3113
Local anaphylaxis2003
Gingival inflammation3021
Oral ulcer0001
Toothache2134
Total cases10 (16.7%)2 (3.3%)6 (10%)12 (20%)
Conditions of diseased teeth at 2 years after repair

The follow-up results at 2 years after the treatment of the patients showed (Table IV) that in silver amalgam group, there were 9 cases of marginal black line, 4 cases of secondary caries and 1 case of tooth fracture; in novel nano-composite resin group, there was 1 case of looseness and loss of tooth as well as 1 case of fracture; in glass-ionomer cement group, there were 3 cases of marginal black line, 3 cases of looseness and loss, 1 case of tooth fracture and 2 cases of dental abnormality; in nichrome group, there were 8 cases of marginal black line, 5 cases of secondary caries and 2 cases of looseness and loss. At 2 years after treatment there was no statistically significant difference in the total number of diseased teeth between nichrome group and control group (P>0.05); the total number of diseased teeth in novel nano-composite resin group and glass-ionomer cement group was significantly decreased compared with that in control group (P<0.05), of which the total number of diseased teeth in novel nano-composite resin group was smaller than that in glass-ionomer cement group (P<0.05).

Table IV.

Conditions of diseased teeth at 2 years after repair.

Table IV.

Conditions of diseased teeth at 2 years after repair.

ItemsSilver amalgam group (n=60)Novel nano-composite resin group (n=60)Glass-ionomer cement group (n=60)Nichrome group (n=60)
Marginal black line9038
Secondary caries4005
Looseness and loss0132
Fracture1110
Abnormality0020
Total cases14 (23.3%)2 (3.3%)9 (15%)15 (25%)
Detection of the apoptosis-related indexes via RT-qPCR

As shown in Fig. 1, there was no statistically significant difference in the mRNA expression levels of Bax and Bcl-2 between the cells in novel nano-composite resin group and negative control group (P>0.05). Compared with those in the negative control group, the mRNA expression levels of the pro-apoptotic index Bax were remarkably upregulated in glass-ionomer cement group, silver amalgam group and nichrome group, from the lowest to the highest (P<0.05). However, the mRNA expression of the anti-apoptotic index Bcl-2 in glass-ionomer cement group was higher than that in silver amalgam group and nichrome group, which were notably downregulated (P<0.05).

Figure 1.

Detection of mRNA expression of Bax and Bcl-2 in five groups of cells via RT-qPCR. There is no significant difference in the mRNA expression levels of Bax and Bcl-2 between the cells in novel nano-composite resin group and negative control group (P>0.05); however, the mRNA expression levels of Bax in the cells of the remaining three groups is obviously increased, and those of Bcl-2 are significantly downregulated (P<0.05). Compared with control group, *P<0.05, **P<0.01, ***P<0.001. Bax, Bcl-2-associated X protein; Bcl-2, B-cell lymphoma-2; RT-qPCR, reverse transcription quantitative polymerase chain reaction.

Detection of the apoptosis-related indexes via western blotting

As indicated in Fig. 2, the protein trends and mRNA trends of Bax and Bcl-2 in the five treatment groups of cells were the same. The differences in the protein levels of Bax and Bcl-2 between the cells in novel nano-composite resin group and negative control group were no statistically significant (P>0.05). Compared with those in the negative control group, the protein levels of the pro-apoptotic index Bax were remarkably upregulated in glass-ionomer cement group, silver amalgam group and nichrome group, from the lowest to the highest (P<0.05). However, the protein level of the anti-apoptotic index Bcl-2 in glass-ionomer cement group was higher than that in silver amalgam group and nichrome group, which were notably downregulated (P<0.05).

Figure 2.

Detection of protein status of Bax and Bcl-2 in five groups of cells via western blotting. There is no significant difference in the protein levels of Bax and Bcl-2 between the cells in novel nano-composite resin group and negative control group (P>0.05); however, the protein levels of Bax in the cells of the remaining three groups are obviously upregulated, and those of Bcl-2 are significantly downregulated (P<0.05). Compared with control group, *P<0.05, **P<0.01, ***P<0.001. Bax, Bcl-2-associated X protein; Bcl-2, B-cell lymphoma-2.

Detection of cell apoptosis via the flow cytometer

The Annexin V/PI double staining was applied to label the early and late apoptotic cells. The results indicated that the cell apoptosis level in novel nano-composite resin group was not statistically different from that in the negative control group (P>0.05). Compared with that in the negative control group, the cell apoptosis level in glass-ionomer cement group, silver amalgam group and nichrome group was increased (P<0.05) (Fig. 3).

Figure 3.

Detection of apoptosis in five groups of cells via the flow cytometer. The cell apoptosis level in novel nano-composite resin group is not statistically different from that in negative control group (P>0.05). Compared with that in the negative control group, the cell apoptosis level in glass-ionomer cement group, silver amalgam group and nichrome group is significantly increased (P<0.05). Compared with control group, *P<0.05, **P<0.01. Bax, Bcl-2-associated X protein; Bcl-2, B-cell lymphoma-2.

Discussion

Dentistry is gradually developing into a complex biomedical discipline (10,11), and materials such as silver amalgam and glass-ionomer cement have made great contribution to clinical practices over the past decades (12). The color of silver amalgam is similar to that of the teeth, so that this kind of material is still widely used by dentists at present. Studies published so far have revealed that silver amalgam clearly does not meet the requirements for safety and longevity, and that the physical, chemical and biological characteristics of the materials currently utilized in restorative dentistry need to be re-evaluated (13). The conventional glass-ionomer cement is made of glass (e.g., calcium-aluminosilicate glass) and polycarbonate (propylene carbonate). These materials were once considered as possible substitutes for silver amalgam filling due to their good biocompatibility (14). Although the newly developed composite materials have improved their physicochemical properties, in vitro studies have indicated that the intrinsic toxicity of glass-ionomer cement is still very high (15).

Firstly, the free monomers released by the conventional dental restorative materials (glass-ionomer cement and nichrome) are conducive to the proliferation of bacteria, especially the microorganisms related to the formation of dental caries, which are helpful in the occurrence of secondary caries (16). Secondly, the cellular and molecular mechanisms of cytotoxicity are triggered by the monomers, which lead to dental pulp changes and marginal gingival recession (17). Thirdly, some literature reports have revealed that silver amalgam can cause local and systemic anaphylaxis (18). In our research, there were 2 cases of local anaphylaxis in silver amalgam group.

However, the major side effect of conventional dental restorative materials is cytotoxicity. Specifically, the mechanism of cytotoxicity is firstly correlated with the short-term release of free monomers in the monomer-polymer transformation process. Relevant studies have revealed that the molecular mechanism that involves the glutathione depletion and reactive oxygen species (ROS) generation is the key factor for apoptosis of dental pulp or gingiva (19–21). Rai et al identified that glass-ionomer cement can produce cytotoxicity to human dental pulp and gingiva cells (18). Stanislawski et al found that some nichrome materials have toxic effects on the primary fibroblasts of rabbit pulp (19). The study of Geurtsen et al indicated that the release of metal ions may be a reason for silver amalgam generating toxicity to cells in vitro (22). Consistent with these research results, the anti-apoptotic index Bcl-2 and pro-apoptotic index Bax were examined via western blotting. It was discovered that the protein levels of Bcl-2 were obviously decreased in the water extracts of glass-ionomer cement group, silver amalgam group and nichrome group, and those of Bax were elevated. The results through flow cytometer suggested that the water extracts of glass-ionomer cement, silver amalgam and nichrome also significantly promoted the apoptosis of fibroblast L-929. The patients' complications at 1 month and 2 years after the dental restoration in the three groups were remarkably higher than those in novel nano-composite resin group; however, the water extract from novel nano-composite resin had no significant impact on the Bcl-2 and Bax protein levels of L-929 cells, and there was no statistically significant difference in apoptosis level of L-929 cells compared with that in negative control group.

In addition, secondary caries is the most common complication after dental restoration (23). Conventional resin materials shrink during the polymerization process, leaving a space surrounded by bacteria between the material and cavity wall, while the so-called mixing layer even has bacteria infiltrating, which is conducive to the occurrence of secondary caries (24,25). The novel nano-composite resin utilized in this experiment was the nano-repair material made of silicon dioxide and zirconium oxide which had stable chemical properties, hard texture and luster and quality of natural enamel. It was manifested in this experiment that the conditions of bleeding, local anaphylaxis, gingival inflammation, toothache, oral ulcer and other diseases at 1 month and 2 years after the use of the novel nano-composite resin to patients, as well as its service conditions, were superior to those of the other three kinds of conventional materials.

In conclusion, the impacts of silver amalgam, glass-ionomer cement, nichrome and novel nano-composite resin on the toxicity of fibroblasts, as well as the effects of their use on clinical patients, were mainly compared in this study. The results showed that the novel nano-composite resin has no toxic effect on the fibroblast L-929, and its clinical side effects are remarkably fewer than those of conventional materials; due to these advantages, it is worthy of application and generalization in clinical practice.

Acknowledgements

Not applicable.

Funding

No funding was received.

Availability of data and materials

The datasets used and/or analyzed during the present study are available from the corresponding author on reasonable request.

Authors' contributions

YW and JS conceived and designed the study. YW, QM and XT were responsible for the collection and analysis of the patient data. JS and QM interpreted the data and drafted the manuscript. YW revised the manuscript critically for important intellectual content. All authors read and approved the final manuscript.

Ethics approval and consent to participate

The study was approved by the Ethics Committee of Xuzhou Stomatology Hospital (Xuzhou, China). Signed informed consents were obtained from the patients or the guardians.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Wang Y, He J, Li Q and Shen J: Preparation of sodium alginate-nanohydroxyapatite composite material for bone repair and its biocompatibility. Hua Xi Kou Qiang Yi Xue Za Zhi. 32:27–31. 2014.(In Chinese). PubMed/NCBI

2 

Kawajiri H, Yamanami M, Mizuno T, Kanda K, Yaku H and Nakayama Y: Feasibility of connective tissue membrane (bio-sheet) prepared in the body as cardiovascular repair material as a substitute for self-pericardium. Circulation. 128:A129102013.

3 

Croll TP, Berg JH and Donly KJ: Dental repair material: A resin-modified glass-ionomer bioactive ionic resin-based composite. Compend Contin Educ Dent. 36:60–65. 2015.PubMed/NCBI

4 

Cvar JF and Ryge G: Reprint of criteria for the clinical evaluation of dental restorative materials. 1971. Clin Oral Investig. 9:215–232. 2005. View Article : Google Scholar : PubMed/NCBI

5 

Zhou HM, Shen Y, Wang ZJ, Li L, Zheng YF, Häkkinen L and Haapasalo M: In vitro cytotoxicity evaluation of a novel root repair material. J Endod. 39:478–483. 2013. View Article : Google Scholar : PubMed/NCBI

6 

Sang Z, Liu ZY, Gu YD and Feng JN: Evaluation and analysis on clinical effects of different dental restorative materials. J Taishan Med Coll. 37:907–909. 2016.

7 

Abedi G, Jahanshahi A, Fathi MH, Haghdost IS and Veshkini A: Study of nano-hydroxyapatite/zirconia stabilized with yttria in bone healing: Histopathological study in rabbit model. Pol J Pathol. 65:40–47. 2014. View Article : Google Scholar : PubMed/NCBI

8 

Wataha JC, Nelson SK and Lockwood PE: Elemental release from dental casting alloys into biological media with and without protein. Dent Mater. 17:409–414. 2001. View Article : Google Scholar : PubMed/NCBI

9 

Livak KJ and Schmittgen TD: Analysis of relative geneexpression data using real-time quantitative PCR and the2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

10 

Anusavice K, Shen C and Rawls HR: Phillips' Science of Dental Materials. 12th edition. Saunders; 2012, View Article : Google Scholar

11 

Feinberg M, Garcia LT, Polverini PJ, Fox CH and Valachovic RW: The vital role of research funding in preserving the oral health of the public and the dental profession. J Am Dent Assoc. 146:355–356. 2015. View Article : Google Scholar : PubMed/NCBI

12 

Mickenautsch S: Are high-viscosity glass-ionomer cements inferior to silver amalgam as restorative materials for permanent posterior teeth? A Bayesian analysis. BMC Oral Health. 15:1182015. View Article : Google Scholar : PubMed/NCBI

13 

Saghiri MA, Banava S, Sabzian MA, Gutmann JL, Asatourian A, Ramezani GH, Garcia-Godoy F and Sheibani N: Correlation between long-term in vivo amalgam restorations and the presence of heavy elements in the dental pulp. J Trace Elem Med Biol. 28:200–204. 2014. View Article : Google Scholar : PubMed/NCBI

14 

Mickenautsch S: Retention of GIC versus Amalgam as restorations [October 06, 2015]. J Minim Inter Dent. 9:28–30. 2016.

15 

Chen S, Mestres G, Lan WH, Xia W and Engqvist H: In vitro cytotoxicity of dental cements on odontoblast cells. Presented at Towards Future Regenerative Therapies TERMIS-EU 2016 Conference. (abstract P87). 2016.http://ecmconferences.org/abstracts/2016/Collection1/c1_poster.html

16 

Kuper NK, Montagner AF, van de Sande FH, Bronkhorst EM, Opdam NJ and Huysmans MC: Secondary caries development in in situ gaps next to composite and amalgam. Caries Res. 49:557–563. 2015. View Article : Google Scholar : PubMed/NCBI

17 

De Munck J, Van Landuyt K, Peumans M, Poitevin A, Lambrechts P, Braem M and Van Meerbeek B: A critical review of the durability of adhesion to tooth tissue: Methods and results. J Dent Res. 84:118–132. 2005. View Article : Google Scholar : PubMed/NCBI

18 

Rai R, Dinakar D, Kurian SS and Bindoo YA: Investigation of contact allergy to dental materials by patch testing. Indian Dermatol Online J. 5:282–286. 2014. View Article : Google Scholar : PubMed/NCBI

19 

Stanislawski L, Soheili-Majd E, Perianin A and Goldberg M: Dental restorative biomaterials induce glutathione depletion in cultured human gingival fibroblast: Protective effect of N-acetyl cysteine. J Biomed Mater Res. 51:469–474. 2000. View Article : Google Scholar : PubMed/NCBI

20 

Goldberg M, Stanislawski L, Bonte E, Daniau X, Bonte E, Daniau X and Lasfargues JJ: Biocompatibility of glass-ionomer cementsAdvances in Glass-Ionomer Cements. Davidson CL and Mjör IA: 1st edition. Quintessence Publishing Co.; Chicago: pp. 103–120. 1999

21 

Szep S, Kunkel A, Ronge K and Heidemann D: Cytotoxicity of modern dentin adhesives - in vitro testing on gingival fibroblasts. J Biomed Mater Res. 63:53–60. 2002. View Article : Google Scholar : PubMed/NCBI

22 

Geurtsen W, Lehmann F, Spahl W and Leyhausen G: Cytotoxicity of 35 dental resin composite monomers/additives in permanent 3T3 and three human primary fibroblast cultures. J Biomed Mater Res. 41:474–480. 1998. View Article : Google Scholar : PubMed/NCBI

23 

Fontana M and González-Cabezas C: Secondary caries and restoration replacement: An unresolved problem. Compend Contin Educ Dent. 21(15–18): 21–24, 26 passim, quiz 30. 2000.

24 

Zhang N, Melo MA, Chen C, Liu J, Weir MD, Bai Y and Xu HH: Development of a multifunctional adhesive system for prevention of root caries and secondary caries. Dent Mater. 31:1119–1131. 2015. View Article : Google Scholar : PubMed/NCBI

25 

Schwendicke F, Kern M, Blunck U, Dörfer C, Drenck J and Paris S: Marginal integrity and secondary caries of selectively excavated teeth in vitro. J Dent. 42:1261–1268. 2014. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Wei Y, Sun J, Men Q and Tian X: Toxic effects of four kinds of dental restorative materials on fibroblast HGF‑1 and impacts on expression of Bcl‑2 and Bax genes. Exp Ther Med 16: 4155-4161, 2018.
APA
Wei, Y., Sun, J., Men, Q., & Tian, X. (2018). Toxic effects of four kinds of dental restorative materials on fibroblast HGF‑1 and impacts on expression of Bcl‑2 and Bax genes. Experimental and Therapeutic Medicine, 16, 4155-4161. https://doi.org/10.3892/etm.2018.6705
MLA
Wei, Y., Sun, J., Men, Q., Tian, X."Toxic effects of four kinds of dental restorative materials on fibroblast HGF‑1 and impacts on expression of Bcl‑2 and Bax genes". Experimental and Therapeutic Medicine 16.5 (2018): 4155-4161.
Chicago
Wei, Y., Sun, J., Men, Q., Tian, X."Toxic effects of four kinds of dental restorative materials on fibroblast HGF‑1 and impacts on expression of Bcl‑2 and Bax genes". Experimental and Therapeutic Medicine 16, no. 5 (2018): 4155-4161. https://doi.org/10.3892/etm.2018.6705
Copy and paste a formatted citation
x
Spandidos Publications style
Wei Y, Sun J, Men Q and Tian X: Toxic effects of four kinds of dental restorative materials on fibroblast HGF‑1 and impacts on expression of Bcl‑2 and Bax genes. Exp Ther Med 16: 4155-4161, 2018.
APA
Wei, Y., Sun, J., Men, Q., & Tian, X. (2018). Toxic effects of four kinds of dental restorative materials on fibroblast HGF‑1 and impacts on expression of Bcl‑2 and Bax genes. Experimental and Therapeutic Medicine, 16, 4155-4161. https://doi.org/10.3892/etm.2018.6705
MLA
Wei, Y., Sun, J., Men, Q., Tian, X."Toxic effects of four kinds of dental restorative materials on fibroblast HGF‑1 and impacts on expression of Bcl‑2 and Bax genes". Experimental and Therapeutic Medicine 16.5 (2018): 4155-4161.
Chicago
Wei, Y., Sun, J., Men, Q., Tian, X."Toxic effects of four kinds of dental restorative materials on fibroblast HGF‑1 and impacts on expression of Bcl‑2 and Bax genes". Experimental and Therapeutic Medicine 16, no. 5 (2018): 4155-4161. https://doi.org/10.3892/etm.2018.6705
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team