Open Access

Modulating effects of the probiotic Lactococcus lactis on the hepatic fibrotic process induced by CCl4 in Wistar rats

  • Authors:
    • Catalina Soledad Delgado‑Venegas
    • Sandra Luz Martínez‑Hernández
    • Daniel Cervantes‑García
    • Roberto Montes de Oca‑Luna
    • María de Jesús Loera‑Arias
    • María Guadalupe Mata‑Martínez
    • Javier Ventura‑Juárez
    • Martín Humberto Muñoz‑Ortega
  • View Affiliations

  • Published online on: February 10, 2021     https://doi.org/10.3892/etm.2021.9770
  • Article Number: 339
  • Copyright: © Delgado‑Venegas et al. This is an open access article distributed under the terms of Creative Commons Attribution License.

Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Hepatic cirrhosis is a chronic disease that affects one fifth of the World's population and is the third leading cause of death in Mexico. Attempts have been made to develop treatments for this hepatic cirrhosis, which include manipulating the intestinal microbiota and thus decreasing the early inflammatory response. The microbiota is reportedly altered in patients with cirrhosis. Due to its immunomodulatory properties and its ability to survive in the gastrointestinal tract, Lactococcus lactis (L. lactis) has been used as a therapeutic measure in inflammatory disorders of the colon. The objective of the present study was to evaluate the efficacy of the L. lactis probiotic NZ9000 in preventing tetrachloromethane (CCl4)‑induced experimental hepatic fibrosis. The following 4 groups were included in the experimental stage (n=5): i) Control group; ii) L. lactis group; iii) CCl4 group; and iv) L. lactis‑CCl4 group. For the first 2 weeks, L. lactis was orally administered to the L. lactis and L. lactis‑CCl4 groups; CCl4 was then peritoneally administered to the lactis‑CCl4 group for a further 4 weeks (in addition to the probiotic), while the L. lactis group received the probiotic only. For the CCl4 group, CCl4 was administered for 4 weeks. The experimental groups were all compared with the control group and the L. lactis + CCl4 group. Tissue samples were analyzed histologically and biochemically, and the gene expression levels of interleukin (IL)‑1, IL‑10 and forkhead box protein P3 (FoxP3) were determined. L. lactis decreased hepatic cirrhosis by preventing steatosis and fibrosis, and by reducing the levels of AST and ALT. Subchronic CCl4 injury induced upregulation of the IL‑1β gene in the liver, which was decreased by L. lactis. It was also found that the group treated with L. lactis showed increased expression of Foxp3 in the liver and IL‑10 in the gut. These results suggested that oral administration of L. lactis may be a potential probiotic to prevent or protect against CCl4‑induced liver injury.

Introduction

Fibrosis is defined as an excessive component deposition of the extracellular matrix (ECM), collagen and peptidoglycans in organs and tissues as a result of the proliferation and activation of fibroblasts, stellate cells and myofibroblasts (1-3). Inflammatory reactions of both the innate and adaptive immune system contribute to the development of fibrosis; in the early stages of fibrosis, neutrophils, macrophages, natural killer (NK) cells and T lymphocytes promote pro-fibrotic processes, including hepatic stellate cell activation, increased transforming growth factor (TGF)-β, platelet-derived growth factor, fibroblast growth factor, matrix metalloproteinase (MMP) 9 and metalloproteinase inhibitor-1/-2 expression, and a decrease in MMP13 expression (1-4). Activated macrophages produce tumor necrosis factor (TNF)-α and interleukin (IL)-1, which in turn activate hepatic stellate cells and fibroblasts to induce ECM overproduction. The signal transduction triggered by TNF-α leads to the expression of fibrogenic cytokines, primarily via the NF-κB and SMAD pathways (1,3). By contrast, interferon (IFN)-γ produced by activated NK cells (and a subsequent increase in IL-10) exerts antifibrotic effects (3). During cirrhosis, collagen types I and III are deposited in the hepatic stroma, creating fine or wide fibrous septa. Subsequently, new vascular channels are formed that facilitate communication between the portal region (hepatic arteries and portal veins) and the centrilobular veins, establishing an alternative circuit through which blood can bypass the sinusoids due to the increase of collagen fibers in the Dissé space (4,5).

Continuous collagen deposition in the Dissé space of the parenchyma is associated with the loss of sinusoidal endothelial cell fenestrae, in this process, the sinusoidal space takes on a capillary-like structure rather than a channel for the exchange of solutes between hepatocytes and the plasma (4). Collectively, this alters the secretion of hepatocellular proteins such as albumin, coagulation factors and lipoproteins (1,5). A number of therapeutic strategies have been developed to prevent this process and to subsequently decrease or reverse fibrosis/cirrhosis-associated liver damage (6); for example, the use of antioxidants (7), adrenoblockers (8), anti-inflammatory cytokines (9,10) and probiotics (11) has been suggested, but a complete cure for the disease has yet to be identified.

The pharmacological basis of a number of fibrosis treatments is the interaction between the intestinal microbiome and the host, which helps to maintain homeostasis (12-14). Haller et al (15) demonstrated that Lactobacillus (L.) johnsonii of an intestinal origin did not induce TNF-α or IL-1β release, but promoted that of TGF-β, presenting a global anti-inflammatory profile in a colitis model. In addition to in vitro studies, experimental animal models of colitis have demonstrated the usefulness of probiotics in the control of intestinal inflammation. In an acetic acid-induced rat colitis model, administration of L. reuteri R2LC immediately after induction prevented the development of colitis (16). Similarly, L. plantarum administration to rats decreased the severity of colitis in an intraperitoneal methotrexate-induced enterocolitis model (17,18).

L. lactis is a gram-positive, spherical, homolactic, non-sporulant and facultative anaerobic bacterium, with hundreds of strains and biovariants published to date (19). L. lactis is categorized into three subspecies: i) L. lactis ssp. Lactis; ii) L. lactis ssp. Cremoris; and iii) L. lactis ssp. Hordniae (19-21). Bajaj et al (11) demonstrated that L. rhamnosus GG induced a decrease in endotoxemia and systemic inflammation in patients with cirrhosis. Similar results were observed following the administration of lactulose, rifaximin and probiotics containing Lactobacillus, which partially reversed cirrhosis-associated enteric dysbiosis, together with improving the severity of encephalopathy (18). Due to its immunomodulatory properties (22-24) and ability to transit through the gastrointestinal tract, L. lactis does not colonize the intestine in the manner of other similar organisms, such as Lactobacillus spp. (24).

The primary beneficial effect reported for wild or recombinant strains of L. lactis is its anti-inflammatory potential, indicating its potential use as a therapeutic tool for chronic intestinal diseases. Cellular in vitro models, as well as mouse models of colitis, have been used to investigate the anti-inflammatory properties of L. lactis, where an increase in anti-inflammatory cytokines and a decrease in NF-κB have been reported (25-28). In the present study, the protective effects of oral administration of L. lactis were evaluated after tetrachloromethane (CCl4)-induced fibrosis in Wistar rats.

Materials and methods

Bacterial strains and culture conditions

Pure stocks of L. lactis (10 µl) in 1 ml M17 medium (10% glucose and 30% glycerol) were donated by Dr Maria de Jesus Loera Arias of the Autonomous University of Nuevo León (Monterrey, Mexico). To reactivate the L. lactis strain, the cells were incubated overnight in 50 ml M17 (Difco) medium (supplemented with 10% glucose) at 30˚C without shaking. Subsequently, 1 ml culture was used to inoculate 50 ml M17 medium (10% glucose). The optical density (OD) was measured at 600 nm, and the cells were incubated again until they reached an OD of 0.8. The final bacterial concentration was 1x109 cells/ml.

Animals

Male Wistar rats (age, 6-8 weeks; weight, 150-250 g) were obtained from the Laboratory Animal Service of the Autonomous University of Aguascalientes (Aguascalientes, Mexico). The animals were maintained on a light/dark cycle (12:12) with ad libitum access to Purina® Rodent Chow (Cargill, Inc.) and tap water. All animal experiments were approved by the Research Ethics Committee of the Autonomous University of Aguascalientes (approval no. A1-S-21375) and were conducted in accordance with institutional guidelines for caring for experimental animals and the national regulatory norm (NOM-062-Z00-1999). To prepare the intestinal environment, all animals were previously treated with neomycin sulfate and sulfadimethylpyrimidine for 7 days. For experimentation, the rats were divided into the following 4 groups (n=5 rats/group): i) Control group not treated with L. lactis or CCl4; ii) L. lactis group administered L. lactis; iii) L. lactis-CCl4 group orally treated with L. lactis and induced with CCl4; and iv) CCl4 group intraperitoneally administered CCl4 for cirrhosis induction. All animals were sacrificed by overdose of sodium pentobarbital at 6 weeks, and different sections of the liver, the terminal region of the ileum (Peyer's Patches), the ascending portion of the large intestine and serum samples were obtained. The tissue sections were preserved in 10% formalin in PBS at room temperature and RNAlater (Invitrogen; Thermo Fisher Scientific, Inc.) at -80˚C for histological and molecular analysis, respectively, and the serum was used to conduct liver function tests.

Fibrotic induction

Fibrosis was induced in the L. lactis-CCl4 and CCl4 groups. Based on a pilot experiment in our laboratory, CCl4 was diluted in petrolatum and intraperitoneally administered 3 times per week for 4 weeks as follows (CCl4:petrolatum by volume): Weeks 1, 1:6; 2, 1:5; 3, 1:4; 4, 1:3. These proportions were prepared according to the number of experimental animals (n=5 for each group) and the number of applications per week (3 per week).

Administration of L. lactis

For 6 weeks, 1 ml L. lactis (1x109 cells), was orally administered to the L. lactis and L. lactis-CCl4 groups on a daily basis. In the L. lactis-CCl4 group, the probiotic was administered two weeks prior to CCl4, and was subsequently continued for an additional 4 weeks together with CCl4. For the L. lactis group, the probiotic was administered alone for 6 weeks as a control (Fig. 1).

Histological analysis

Liver damage and Peyer's patches were evaluated histologically by light microscopy. Sirius red staining (with polarized light microscopy) was used to identify collagen fiber deposits (type I, red; type III, green). For histopathological analysis of Peyer's patches. The tissue sections were preserved in 10% formalin in PBS at room temperature for 24 h, and transverse cuts of 5-µm thickness were made in the terminal portion of the ileum to reveal clusters of lymphatic tissue (lymph nodes) that cover the lamina propria, which were then stained with hematoxylin and eosin. The histological preparations were visualized under a Axioskop 40/40 FL light polarized microscope (Carl Zeiss AG) and analyzed using Image-Pro Plus Software 4.5.1 (Media Cybernetics, Inc.). The percentage of fibrosis was determined as the ratio of the fibrotic area to the total tissue area.

Markers of liver damage

To determine the degree of liver damage, serum levels of glucose (cat. no. BSIS19-P), albumin (cat. no. BSIS02-E), bilirubin (cat. no. BSIS92-I) total protein (cat. no. BSIS30-E), urea (cat. no. BSIS35-I), alanine aminotransferase (ALT; cat. no. BEIS11-E) and aspartate transaminase (AST; cat. no. BEIS09-E) were quantified. Kits for all biochemical tests were obtained from Spinreact SAU. Each test was performed according to the manufacturer's instructions. The samples were read on a BTS-350 semi-automatic spectrophotometric analyzer (BioSystems S.A.).

Total RNA isolation and reverse transcription-quantitative PCR (RT-qPCR)

Total RNA was isolated from 100 mg liver tissues using the SV Total RNA Isolation System (Promega Corporation) according to the manufacturer's protocol. The RNA was quantified using NanoDrop-2000 (NanoDrop Technologies; Thermo Fisher Scientific, Inc.) and stored at -80˚C until required. Reverse transcription was performed with 1 µg total RNA using the GoScript™ Reverse Transcription System (Promega Corporation) according to the manufacturer's instructions. Subsequently, qPCR was performed using the qPCR GreenMaster with UNG-clear (Jena Bioscience GmbH) using StepOne™ equipment (Applied Biosystems; Thermo Fisher Scientific, Inc.) with the following thermocycling conditions: 50˚C for 2 min and 95˚C for 45 sec, followed by 40 cycles of 95˚C for 45 sec and 60˚C for 45 sec. The oligonucleotide primers are displayed in Table I. Relative expression levels were normalized to those of β-actin, and the differences were determined using the 2-ΔΔCq method (29).

Table I

Primers used for quantitative PCR.

Table I

Primers used for quantitative PCR.

PrimerSequence (5'→3')
FoxP3F: CGGGAGAGTTTCTCAAGCAC
 R: CACAGGTGGAGCTTTTGTCA
IL-1βF: CTGTGACTCGTGGGATGATG
 R: GGGATTTTGTCGTTGCTTGT
IL-10F: TGGCTCAGCACTGCTATGTT
 R: TTGTCCAGCTGGTCCTTCTT
β-actinF: GTCGTACCACTGGCATTGTG
 R: GCTGTGGTGGTGAAGCTGTA

[i] IL, interleukin; FoxP3, forkhead box protein P3.

Statistical analysis

GraphPad Prism 5.00 (GraphPad Software, Inc.) was used for statistical analysis and figures. Data are presented as the mean ± standard error of the mean for each group. Significant differences between mean values were assessed using one-way ANOVA followed by Tukey's test. P<0.05 was considered to indicate a statistically significant difference.

Results

Macroscopic and histopathological analysis of the livers of control and treated animals

At a macroscopic level, the livers of the control and L. lactis groups exhibited a smooth surface and the classic dark brown color of a healthy liver (Fig. 2A and D). By contrast, the liver tissues of the CCl4 group were rough and irregular, with a lighter brown color (Fig. 2G). The livers of the rats om the L. lactis-CCl4 presented with a similar coloration and texture to those of the control group (Fig. 2J). At the microscopic level (magnification, x10 and x40), the control and L. lactis groups displayed classic liver lobules, with hepatocytes and normal hepatic sinusoids (yellow arrows) that did not affect the liver histology (Figs. 2C and F). In the CCl4 groups, steatosis (black arrows) and pyknotic nuclei (black asterisk) were observed in zone I of the liver acini (Fig. 2I). In the L. lactis-CCl4 group (magnification, x10), a small number of hepatocytes in zone II presented with CCl4-induced damage (to a lesser degree compared with that in the CCl4 group) and a smaller area of steatosis, described as a microvesicular type (black arrowheads) compared with the CCl4 group. Additionally, at x40 magnification, acidophilic cells were observed with a larger cytoplasm; it was therefore speculated that these cells exhibited a degree of incipient damage in the CCl4 and L. lactis-CCl4 groups (yellow asterisk; Fig. 2I and L).

The liver sections stained with Sirius Red and analyzed under a polarized light microscope exhibited normal histological architecture in the control and L. lactis groups, and type III collagen was observed (green arrow; Fig. 3A-a and b). In the CCl4 group, an increase in type I collagen (red) was evident around blood vessels (red arrows; Fig. 3A-c) along with a low level of type III collagen (green arrow), indicating a fibrotic lesion. By contrast, a significant decrease in type I collagen fibers was observed in the L. lactis-CCl4 group (red arrow; Fig. 3A-d). To confirm the degree of fibrosis, a morphometric analysis of the hepatic parenchyma was performed; an increase in collagen fibers was evident in the CCl4 group compared with that in the control group (P<0.001; Fig. 3B). In addition, the percentage of total collagen was lower in the L. lactis-CCl4 group compared with the CCl4 group.

Liver Function

Liver function was evaluated by the quantification of albumin, glucose, bilirubin and total proteins, and no significant differences were observed (Fig. 4). However, increased plasma ALT and AST (indicators of liver damage) levels were observed following induction with CCl4. The L. lactis-CCl4 group exhibited a significant decrease in ALT and AST levels compared with those in the CCl4 group (P<0.001; Fig. 4A and B), indicating that L. lactis improved liver function. Urea is primarily formed in the liver as an end product of protein metabolism (6,11); a significant decrease in the urea level was observed in the CCl4 group compared with that in the control group (P<0.05; Fig. 4C), whereas the L. lactis-CCl4 group presented with similar levels to those of the control group, which suggested that the liver was functionally transforming ammonium to urea for excretion. The recovery of liver functional enzymes may be associated with the histological improvement presented in Fig. 2. No changes in hepatic function were observed in the L. lactis group compared with the control group.

Histopathological analysis of Peyer's Patches

The L. lactis-CCl4 group induced ~8 well-defined nodules in a single tissue portion (black arrows; Fig. 5A); however, the control and CCl4 groups possessed a mean of 3 nodules (P<0.01), which were smaller in size. Although few lymphoid nodules were observed in the L. lactis group, these were larger than those in the control group (Fig. 5A and B). To corroborate these size variations, a morphometric analysis was performed, and no significant differences were apparent between any of the groups. However, the L. lactis-CCl4 group exhibited the largest area of these nodules (Fig. 5B).

Histopathological analysis of the large intestine (cecum)

Transverse cuts of the cecum were made in animals from each of the study groups (Fig. 6). Normal histology was observed in the control group; however, the colonic tissue of the CCl4 group presented with cellular infiltrate (black arrowheads) in the region of the mucosa layer. This infiltrate was diminished in the CCl4 group treated with L. lactis.

Evaluation of inflammatory markers in the liver

L. lactis is known to have an immunomodulatory effect due to its association with IL-10, a potent anti-inflammatory cytokine that represses the expression of inflammatory cytokines such as TNF-α, IL-6 and IL-1β produced by macrophages activated during liver injury (30). To analyze the possible effect of intestinal L. lactis on CCl4-induced liver damage, the levels of specific cytokines were assessed in the liver tissue, such as pro-inflammatory IL-1β, the anti-inflammatory IL-10 and a T-cell regulatory transcription factor forkhead box protein P3 (FoxP3) (Fig. 7A-C); IL-10 expression was also assessed in intestinal tissues; in the L. lactis-CCl4 group, intestinal IL-10 expression was increased compared with the control group (P<0.001), and CCl4 groups (P<0.001), (Fig. 7D). No significant differences in IL-10 expression were observed among any of the experimental groups, although there was a non-significant tendency towards higher expression in the L. lactis-CCl4 group. IL-1β expression was decreased in the liver tissues (P<0.05). FoxP3 is the primary regulator of the development and function of regulatory T cells, and its expression was increased in the L. lactis-CCl4 group compared with that in the CCl4 group (P<0.05). Collectively, these results demonstrated the immunoregulatory effects of intestinal L. lactis on hepatic pathology.

Discussion

In the present study, the inhibitory effect of L. lactis NZ9000 on CCl4-induced hepatic fibrosis was analyzed. Oral administration of L. lactis induced a physiological change and modified the development of CCl4-induced fibrosis in the liver tissue in the following manners: i) Reducing structural liver damage; ii) reducing the area of fibrosis; iii) increasing the number of lymph nodes in the Peyer's patches; iv) decreasing ALT and AST expression; v) increasing the mRNA expression of IL-10 in small intestine samples; vi) increasing FoxP3 levels in liver samples; and vii) decreasing the expression of IL-1β in the liver.

The aim of the present study was to investigate a protective strategy to reverse liver damage using the physiological interconnection between the digestive tract and the liver via the hepatic portal system (31). The human microbiome is defined as the collective genome of >1,000 different types of microorganisms that exist in association with the human body, the vast majority of which reside in the distal intestine (32,33). This ecological system interacts with internal and external organs, factors that help to maintain the overall health of the individual (12). Taking advantage of this physiological association, anatomical-functional communication was investigated with the aim to induce an immunoregulatory response in the intestine, with ultimate effects on liver inflammation.

In cases of colitis, the L. reuteri R2LC strain has been demonstrated to exert an anti-inflammatory effect in the large intestine (13,14,16,17). Different experimental animal models (predominantly of colitis) have demonstrated the benefits of probiotics in controlling intestinal inflammation. In an acetic acid-induced rat colitis model, the administration of L. reuteri R2LC immediately after induction prevented the establishment of colitis (16). Previous reports have demonstrated the effect of probiotics on the gut microbiota under inflammatory process. The oral administration of L. plantarum attenuated inflammatory bowel disease in a mouse model; L. plantarum also affected the proportion of Firmicutes and Bacteroides, which may be associated with the inflammation of the mouse gut (34). The intestinal microbiota has been reported to serve a fundamental role in homeostatic maintenance of the systemic immune system; for example, L. johnsonii of an intestinal origin did not induce the release of TNF-α or IL-1β following downregulation of the transcription factor NF-κB, whereas TGF-β expression was increased, resulting in a global anti-inflammatory profile (15). Specific recognition of commensal microorganisms occurs in the mesenteric lymph nodes. Most antigens or infectious agents pass into the venous system or tissues through mucous membranes, which includes the lining of the gastrointestinal, respiratory and genitourinary tracts. At these mucosal surfaces, the mucus represents the first barrier against the entry of microorganisms, while gut-associated lymphoid tissues (GALT), which include intestinal Peyer's patches, is critical for efficient protective immune response, making the GALT an attractive portion of the small intestine to study (35). In the present study, the probiotic L. lactis generated an anti-inflammatory environment in the small intestine by increasing the expression of IL-10, as well as the number of lymph nodes in the Peyer's patches; these findings suggested a stimulus that may potentially increase the number of regulatory, anti-inflammatory lymphoid cells. However, one of the limitations of the present study was not determining whether L. lactis may influence the proportions of various taxonomic and functional groups of the gut microbiota, which may increase our knowledge about the mechanisms of action of probiotics.

IL-10 decreases and regulates dendritic cell- and macrophage-associated inflammatory responses by activating STAT-3(14). IL-10 also suppresses the adaptive immune response by inhibiting NF-κB secretion by CD4+ T cells and the production of IL-1 and TNF-α by macrophages (14). The results of the present study revealed a notable decrease in hepatic IL-1β expression in the L. lactis-CCL4 group compared with the CCl4 group; this was potentially due to an increase in intestinal IL-10 as a result of CCl4-induced damage, which was subsequently transported to the liver via the portal-hepatic system. Additionally, an increase in the expression of Foxp3 mRNA was observed in the liver, which supports the increase in intestinal IL-10 in the L. lactis-CCL4 group, and may been affected by the downregulation of NF-κB (36,37). This supports the existence of an immunoregulatory process induced by L. lactis in the intestine, which has an inhibitory effect on CCl4-associated fibrosis; thus, L. lactis may exert an anti-fibrotic effect in the early stages of inflammation, which potentially modifies the adhesion properties of epithelial cells, altering the local host immune response (1,38). For this reason, potential new therapies for liver fibrosis may target the recovery of the microbiota to reduce the possible adverse effects associated with pharmacological treatment (18). L. lactis may therefore be an optional co-treatment for decreasing inflammation in the early stages of cirrhosis.

In conclusion, L. lactis prevented liver damage in an animal model of CCl4-induced liver fibrosis. The results of the present study suggested that oral administration of L. lactis in its native form may be a potential means to prevent and protect against CCl4-induced liver damage.

Acknowledgements

We acknowledge to MVZ Karen Estefany Sánchez Hernández, Central Bioterium, Autonomous University of Aguascalientes, for providing and caring for the animals for this study; and LAQB Cintya Esquivel-Dueñas and LAQB Mariana Perez-Villalobos, Department of Chemistry, Autonomous University of Aguascalientes, for their excellent technical assistance.

Funding

Funding: The present study was supported by CONACYT (grant nos. 241312 and A1-S-21375) and the Autonomous University of Aguascalientes (grant no. PIBB18-8). CSDV gratefully acknowledges the financial fellowship granted by CONACYT (grant no. 617146) as part of the master's program in Toxicology Sciences of the Autonomous University of Aguascalientes.

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

SLMH contributed to the analysis and interpretation of the histological data. CSDV developed the histological technique for the intestine and liver tissues. DCG performed reverse transcription-quantitative PCR analysis. RMDOL and MDJLA donated the L. lactis cultures and analyzed the quantitative PCR data. MGMM developed the liver function study. JVJ and MHMO contributed to study conception and design, and the writing and revision of the manuscript. All authors read and approved the final manuscript.

Ethics approval and consent to participate

All animal experiments were approved by the Research Ethics Committee of the Autonomous University of Aguascalientes (approval no. A1-S-21375) and were conducted in accordance with institutional guidelines for caring for experimental animals and the national regulatory norm (NOM-062-Z00-1999).

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Friedman SL: Mechanisms of hepatic fibrogenesis. Gastroenterology. 134:1655–1669. 2008.PubMed/NCBI View Article : Google Scholar

2 

Wick G, Backovic A, Rabensteiner E, Plank N, Schwentner C and Sgonc R: The immunology of fibrosis: Innate and adaptive responses. Trends Immunol. 31:110–119. 2010.PubMed/NCBI View Article : Google Scholar

3 

Wick G, Grundtman C, Mayerl C, Wimpissinger TF, Feichtinger J, Zelger B, Sgonc R and Wolfram D: The immunology of fibrosis. Annu Rev Immunol. 31:107–135. 2013.PubMed/NCBI View Article : Google Scholar

4 

Wynn TA: Cellular and molecular mechanisms of fibrosis. J Pathol. 214:199–210. 2008.PubMed/NCBI View Article : Google Scholar

5 

Kershenobich Stalnikowitz D and Weissbrod AB: Liver fibrosis and inflammation. A review. Ann Hepatol. 2:159–163. 2003.PubMed/NCBI

6 

Romanelli RG and Stasi C: Recent advancements in diagnosis and therapy of liver cirrhosis. Curr Drug Targets. 17:1804–1817. 2016.PubMed/NCBI View Article : Google Scholar

7 

Khan H, Ullah H and Nabavi SM: Mechanistic insights of hepatoprotective effects of curcumin: Therapeutic updates and future prospects. Food Chem Toxicol. 124:182–191. 2019.PubMed/NCBI View Article : Google Scholar

8 

Serna-Salas SA, Navarro-González YD, Martínez-Hernández SL, Barba-Gallardo LF, Sánchez-Alemán E, Aldaba-Muruato LR, Macías-Pérez JR, Ventura-Juárez J and Muñoz-Ortega MH: Doxazosin and carvedilol treatment improves hepatic regeneration in a hamster model of cirrhosis. Biomed Res Int. 2018(4706976)2018.PubMed/NCBI View Article : Google Scholar

9 

Khawar MB, Azam F, Sheikh N and Abdul Mujeeb K: How does interleukin-22 mediate liver regeneration and prevent injury and fibrosis? J Immunol Res. 2016(2148129)2016.PubMed/NCBI View Article : Google Scholar

10 

Abd-Elgawad H, Abu-Elsaad N, El-Karef A and Ibrahim T: Piceatannol increases the expression of hepatocyte growth factor and IL-10 thereby protecting hepatocytes in thioacetamide-induced liver fibrosis. Can J Physiol Pharmacol. 94:779–787. 2016.PubMed/NCBI View Article : Google Scholar

11 

Bajaj JS, Heuman DM, Hylemon PB, Sanyal AJ, White MB, Monteith P, Noble NA, Unser AB, Daita K, Fisher AR, et al: Altered profile of human gut microbiome is associated with cirrhosis and its complications. J Hepatol. 60:940–947. 2014.PubMed/NCBI View Article : Google Scholar

12 

Moraes-Filho JP and Quigley EM: The intestinal microbiota and the role of probiotics in irritable bowel syndrome: A review. Arq Gastroenterol. 52:331–338. 2015.PubMed/NCBI View Article : Google Scholar

13 

Festen EAM, Szperl AM, Weersma RK, Wikmenga C and Wapenaar MC: Inflammatory bowel disease and celiac disease: Overlaps in the pathology and genetics, and their potential drug targets. Endocr Metab Immune Disord Drug Targets. 9:199–218. 2009.PubMed/NCBI View Article : Google Scholar

14 

Lee NK, Kim SY, Han KJ, Eom SJ and Paik HD: Probiotic potential of Lactobacillus strains with anti-allergic effects from kimchi for yogurt starters. LWT Food Sci Technol. 58:130–134. 2014.

15 

Haller D, Bode C, Hammes WP, Pfeifer AM, Schiffrin EJ and Blum S: Non-pathogenic bacteria elicit a differential cytokine response by intestinal epithelial cell/leucocyte co-cultures. Gut. 47:79–87. 2000.PubMed/NCBI View Article : Google Scholar

16 

Fabia R, Ar'Rajab A, Johansssib ML, Willén R, Andersson R, Molin G and Bengmark S: The effect of exogenous administration of Lactobacillus reuteri R2LC and oat fiber on acetic acid-induced colitis in the rat. Scand J Gastroenterol. 28:155–162. 1993.PubMed/NCBI View Article : Google Scholar

17 

Mao Y, Nobaeck S, Kasravi B, Adawi D, Stenram U, Molin G and Jeppsson B: The effects of Lactobacillus strains and oat fiber on methotrexate-induced enterocolitis in rats. Gastroenterology. 111:334–344. 1996.PubMed/NCBI View Article : Google Scholar

18 

Bhat M, Arendt BM, Bhat V, Renner EL, Humar A and Allard JP: Implication of the intestinal microbiome in complications of cirrhosis. World J Hepatol. 8:1128–1136. 2016.PubMed/NCBI View Article : Google Scholar

19 

Parapouli M, Delbès-Paus C, Kakouri A, Koukkou AI, Montel MC and Samelis J: Characterization of a wild, novel nisin a-producing Lactococcus strain with an L. lactis subsp. cremoris genotype and an L. lactis subsp. lactis phenotype, isolated from Greek raw milk. Appl Environ Microbiol. 79:3476–3484. 2013.PubMed/NCBI View Article : Google Scholar

20 

Duwat P, Sourice S, Cesselin B, Lamberet G, Vido K, Gaudu P, Le Loir Y, Violet F, Loubière P and Gruss A: Respiration capacity of the fermenting bacterium Lactococcus lactis and its positive effects on growth and survival. J Bacteriol. 183:4509–4516. 2001.PubMed/NCBI View Article : Google Scholar

21 

Garrigues C, Loubiere P, Lindley ND and Cocaign-Bousquet M: Control of the shift from homolactic acid to mixed-acid fermentation in Lactococcus lactis: Predominant role of the NADH/NAD+ ratio. J Bacteriol. 179:5282–5287. 1997.PubMed/NCBI View Article : Google Scholar

22 

Daniel C, Repa A, Wild C, Pollak A, Pot B, Breiteneder H, Wiedermann U and Mercenier A: Modulation of allergic immune responses by mucosal application of recombinant lactic acid bacteria producing the major birch pollen allergen Bet v 1. Allergy. 61:812–819. 2006.PubMed/NCBI View Article : Google Scholar

23 

Alvarenga DM, Perez DA, Gomes-Santos AC, Miyoshi A, Azevedo V, Coelho-Dos-Reis JG, Martins-Filho OA, Faria AM, Cara DC and Andrade MC: Previous ingestion of Lactococcus lactis by ethanol-treated mice preserves antigen presentation hierarchy in the gut and oral tolerance susceptibility. Alcohol Clin Exp Res. 39:1453–1464. 2015.PubMed/NCBI View Article : Google Scholar

24 

Marinho FA, Pacífico LG, Miyoshi A, Azevedo V, Le Loir Y, Guimarães VD, Langella P, Cassali GD, Fonseca CT and Oliveira SC: An intranasal administration of Lactococcus lactis strains expressing recombinant interleukin-10 modulates acute allergic airway inflammation in a murine model. Clin Exp Allergy. 40:1541–1551. 2010.PubMed/NCBI View Article : Google Scholar

25 

Nishitani Y, Tanoue T, Yamada K, Ishida T, Yoshida M, Azuma T and Mizuno M: Lactococcus lactis subsp. cremoris FC alleviates symptoms of colitis induced by dextran sulfate sodium in mice. Int Immunopharmacol. 9:1444–1451. 2009.PubMed/NCBI View Article : Google Scholar

26 

Luerce TD, Gomes-Santos AC, Rocha CS, Moreira TG, Cruz DN, Lemos L, Sousa AL, Pereira VB, de Azevedo M, Moraes K, et al: Anti-inflammatory effects of Lactococcus lactis NCDO 2118 during the remission period of chemically induced colitis. Gut Pathog. 6(33)2014.PubMed/NCBI View Article : Google Scholar

27 

Ballal SA, Veiga P, Fenn K, Michaud M, Kim JH, Gallini CA, Glickman JN, Quéré G, Garault P, Béal C, et al: Host lysozyme-mediated lysis of Lactococcus lactis facilitates delivery of colitis-attenuating superoxide dismutase to inflamed colons. Proc Natl Acad Sci USA. 112:7803–7808. 2015.PubMed/NCBI View Article : Google Scholar

28 

Steidler L, Hans W, Schotte L, Neirynck S, Obermeier F, Falk W, Fiers W and Remaut E: Treatment of murine colitis by Lactococcus lactis secreting interleukin-10. Science. 289:1352–1355. 2020.PubMed/NCBI View Article : Google Scholar

29 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001.PubMed/NCBI View Article : Google Scholar

30 

Williams LM, Ricchetti G, Sarma U, Smallie T and Foxwell BM: Interleukin-10 suppression of myeloid cell activation-a continuing puzzle. Immunology. 113:281–292. 2004.PubMed/NCBI View Article : Google Scholar

31 

Aller MA, Vara E, Garcia C, Palma MD, Arias JL, Nava MP and Arias J: Proinflammatory liver and antiinflammatory intestinal mediators involved in portal hypertensive rats. Mediators Inflamm. 2005:101–111. 2005.PubMed/NCBI View Article : Google Scholar

32 

US National Institutes of Health: NIH human microbiome project. https://www.hmpdacc.org/overview/.

33 

Kibe R, Sakamoto M, Yokota H, Ishikawa H, Aiba Y, Koga Y and Benno Y: Movement and fixation of intestinal microbiota after administration of human feces to germfree mice. Appl Environ Microbiol. 71:3171–3178. 2005.PubMed/NCBI View Article : Google Scholar

34 

Chen H, Xia Y, Zhu S, Yang J, Yao J, Di J, Liang Y, Gao R, Wu W, Yang Y, et al: Lactobacillus plantarum LP-nlly alters the gut flora and attenuates colitis by inducing microbiome alteration in interleukin-10 knockout mice. Mol Med Rep. 16:5979–5985. 2017.PubMed/NCBI View Article : Google Scholar

35 

Macpherson AJ and Uhr T: Induction of protective IgA by intestinal dendritic cells carrying commensal bacteria. Science. 303:1662–1665. 2004.PubMed/NCBI View Article : Google Scholar

36 

Liu X, Lou J, Chen Y and Duan Z: Changes of regulatory T cells related to CCl4-induced liver fibrosis in mice. Zhonghua Gan Zang Bing Za Zhi. 22:277–280. 2014.PubMed/NCBI View Article : Google Scholar : (In Chinese).

37 

Rios DA, Valva P, Casciato PC, Frias S, Soledad Caldirola M, Gaillard MI, Bezrodnik L, Bandi J, Galdame O, et al: Chronic hepatitis C liver microenvironment: Role of the Th17/Treg interplay related to fibrogenesis. Sci Rep. 7(13283)2017.PubMed/NCBI View Article : Google Scholar

38 

Schiffin EJ, Brassart D, Servin AL, Rochat F and Donnet-Hughes A: Immune modulation of blood leukocytes in humans by lactic acid bacteria: Criteria for strain selection. Am J Clin Nutr. 66:515S–520S. 1997.PubMed/NCBI View Article : Google Scholar

Related Articles

Journal Cover

April-2021
Volume 21 Issue 4

Print ISSN: 1792-0981
Online ISSN:1792-1015

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Delgado‑Venegas CS, Martínez‑Hernández SL, Cervantes‑García D, Montes de Oca‑Luna R, Loera‑Arias M, Mata‑Martínez MG, Ventura‑Juárez J and Muñoz‑Ortega MH: Modulating effects of the probiotic <em>Lactococcus lactis</em> on the hepatic fibrotic process induced by CCl<sub>4</sub> in Wistar rats. Exp Ther Med 21: 339, 2021
APA
Delgado‑Venegas, C.S., Martínez‑Hernández, S.L., Cervantes‑García, D., Montes de Oca‑Luna, R., Loera‑Arias, M., Mata‑Martínez, M.G. ... Muñoz‑Ortega, M.H. (2021). Modulating effects of the probiotic <em>Lactococcus lactis</em> on the hepatic fibrotic process induced by CCl<sub>4</sub> in Wistar rats. Experimental and Therapeutic Medicine, 21, 339. https://doi.org/10.3892/etm.2021.9770
MLA
Delgado‑Venegas, C. S., Martínez‑Hernández, S. L., Cervantes‑García, D., Montes de Oca‑Luna, R., Loera‑Arias, M., Mata‑Martínez, M. G., Ventura‑Juárez, J., Muñoz‑Ortega, M. H."Modulating effects of the probiotic <em>Lactococcus lactis</em> on the hepatic fibrotic process induced by CCl<sub>4</sub> in Wistar rats". Experimental and Therapeutic Medicine 21.4 (2021): 339.
Chicago
Delgado‑Venegas, C. S., Martínez‑Hernández, S. L., Cervantes‑García, D., Montes de Oca‑Luna, R., Loera‑Arias, M., Mata‑Martínez, M. G., Ventura‑Juárez, J., Muñoz‑Ortega, M. H."Modulating effects of the probiotic <em>Lactococcus lactis</em> on the hepatic fibrotic process induced by CCl<sub>4</sub> in Wistar rats". Experimental and Therapeutic Medicine 21, no. 4 (2021): 339. https://doi.org/10.3892/etm.2021.9770