Introduction
Cellular senescence was initially hypothesized to be
caused by the limited proliferative capacity of cells and the
arrest of the cell cycle. The arrest of the cell cycle is
irreversible and triggers various phenotypic changes, such as the
production of an active secretory group, known as the
senescence-associated secretory phenotype (SASP) (1). A study had listed 14 hallmarks of
aging (2), and among them,
cellular senescence was the foundation during the aging biological
process. In addition, mitochondrial dysfunction is an important
factor leading to cellular aging (3) and the metabolic patterns of abnormal
mitochondria differ notably from those of normal mitochondria
(4). Following with the global
trend of population aging, the larger aging population has resulted
in notable issues and become a burden to the society. Therefore,
delaying aging and preventing aging related diseases has been a
topic of long-term research among humans.
Traditional Chinese medicine (TCM) has a history of
use in treating diseases and improving health among the elderly.
The TCM system focuses on the human body as a whole and the
connections between its various organ systems (5). TCM and therapies (such as
acupuncture) are characterized by their wide range of therapeutic
effects and demonstrate unique advantages in treating complex
diseases (6). For instance,
resveratrol, a non-flavonoid polyphenol initially isolated from
Veratrum album, has been confirmed to potentially delay
aging and improve cell senescence (7). Saffron, another well-known herbal
medicine of TCM, is derived from the dried stigmas of Crocus
sativus L (8). Saffron also
has a history of use as a ‘food medicine’ and dietary supplement to
improve life span (9). For
example, in addition to regulating menstrual cycles and
tranquilizing the mind, saffron also serves as a functional
ingredient in gastronomy and herbal tea. Crocin I (the structure
displayed in Fig. 1A), a notable
active component of saffron (10),
has shown to have good therapeutic effects on various central
nervous system diseases such as neurodegenerative diseases, mental
disorders, epilepsy, convulsions and insomnia, as well as various
cardiovascular diseases such as hypertension, hyperlipidemia and
atherosclerosis (11). A previous
study also showed that Crocin-enriched tomato extracts exert
pleiotropic physiological effects in Drosophila
melanogaster, modulating development, lifespan, locomotor
activity, transcriptomic profiles and mitochondrial function.
Notably, Crocin prevented the mitochondrial decay caused by
H2O2 which showed the protective senescence
effect against oxidative stress of Crocin in a human glioblastoma
cell line (12O150) (12). In
addition, Crocin protected SHSY5Y cells against D-galactose (D-gal)
induced aging probably through the reduction of intracellular
reactive oxygen species (ROS) and advanced glycation end-products
(AGEs) formation (13).
Our previous study demonstrated that saffron showed
protective effect against D-gal-induced aging in a rat model
(14). However, the direct
evidence of Crocin regarding its efficacy on cellular senescence
and underlying mechanisms are not yet well understood. Thus, the
present study aimed to investigate the specific mechanisms on
delaying cellular senescence induced by Crocin I. A well-accepted
cellular senescence model, human embryonic lung diploid fibroblast
(WI-38), was used to investigate the effect of Crocin I on both of
the replicative senescence and premature senescence. The premature
senescence model was induced by 2,2'-azobis-2-methy-propanimidamide
dihydrochloride (AAPH). In addition, RNA-sequencing analysis was
performed to explore the potential molecular mechanisms regarding
its effect on modulating cellular senescence.
Materials and methods
Reagents
Crocin Ⅰ (cat no. ST02900120) and Shikonin (cat no.
ST78490220) were purchased from Shanghai Standard Biotech Co., Ltd.
Dulbecco's modified Eagle's medium (DMEM; cat no. 11965092), Ham's
F-12 medium (F12; cat no. 11765054), fetal bovine serum (FBS; cat
no. 16140071) and trypsin (cat no. 25200072) were provided by the
Invitrogen (Thermo Fisher Scientific, Inc.). The primary antibodies
for SIRT1 and p21Waf1 (cat no. 2310S; 64016S) were from
Cell Signaling Technology Company, Inc. The primary antibodies for
p53 and GAPDH (cat no. SC-126; SC-32233) were purchased from the
Santa Cruz Biotechnology, Inc. The primary antibody for PKM2 (cat
no. HA723370) was purchased from HUABIO. Kits for the cell counting
kit (CCK)-8 assay and senescence associated β-galactosidase
(SA-β-Gal) staining (cat nos. C0037 and C0602) were purchased from
Beyotime Biotechnology. The QIAamp DNA Mini Kit (cat no. 51304) was
purchased from Qiagen GmbH. AAPH (cat no. 440914) was purchased
from the MilliporeSigma. The L-lactic acid (L-LA) content detection
kit and the pyruvate kinase (PK) activity assay kit (cat nos.
BC2235 and BC0545) was purchased from Beijing Solarbio Science
& Technology Co., Ltd. Sirtinol (cat no. 410536-97-9) was
purchased from TargetMol. Super ECL Detection Reagent (cat no.
36208ES60) was purchased from Shanghai Yeasen Biotechnology Co.,
Ltd.
Cell culture
WI-38 cells were obtained from the American Type
Culture Collection (cat. no. VR-977). WI-38 cells are a widely
recognized cell model to explore cell senescence (15). WI-38 cells were cultured in
DMEM-high glucose medium containing 10% FBS under standard culture
conditions of 5% CO2, 37˚C. When the cells reached
80-90% confluence they were passaged at a ratio of 1:2 or 1:4. The
cells were counted before and after passage, and the cell adherence
rate (R) was calculated by sampling and counting the cells 20 h
after passage. The cumulative population doubling was calculated as
∑log2(D/D0), where D and D0 are
the cell densities at harvest and inoculation, respectively. It is
generally considered that cells up to PD30 are young cells; cells
with ≥PD55 are replicative senescent cells (16). When the cells reached 80-90%
confluence, they were treated with 5 µM shikonin for 24 h to
inhibit PKM2 enzyme activity. The cells were pretreated with
Sirtinol for 4 h, followed by addition of Crocin I or untreated
medium for 24 h. To enhance the generalizability of the findings,
Human Renal Proximal Tubule Epithelial (HK-2) cells were used. HK-2
is an immortalized cell line with minimal variation between
passages and batches; they are currently widely used in the
establishment of oxidative stress models (17). HK-2 cells were cultured in F12
medium containing 10% FBS under standard conditions of 5%
CO2 and 37˚C. After the cells adhered, the medium was
replaced with medium containing 0.8 mM H2O2
to treat the cells for 24 h, followed by a 48-h recovery period in
medium containing Crocin I or no drug.
CCK-8 cell viability assay
Cell viability was detected using the CCK-8 kit as
follows: WI-38 cells were seeded at a density of 1x104
cells/well in a 96-well culture plate. After 24 h of culture,
different concentrations of Crocin Ⅰ (1, 2, 5, 10, 20, 40 µM) were
added to each well, with 6 parallel wells set for each
concentration. After 3 days of culture with Crocin Ⅰ treatment, 10
µl of CCK-8 solution was added to each well, and the cells were
cultured at 37˚C with 5% CO2 for 1-2 h. The absorbance
value was measured using an enzyme reader at 450 nm, and the
relative cell viability was calculated, with the viability of the
blank group without drugs set as 100%.
SA-β-Gal staining
SA-β-Gal staining was detected by SA-β-Gal staining
kit. Cells were treated according to the indicated experiments and
the supernatant was removed. Then, the fixation solution from the
kit was added and incubated at room temperature for 15 min. After
washing with PBS, the staining solution was added and the cells
were incubated with the staining solution at 37˚C for 3-16 h. The
positive cells appeared blue-green after staining. After staining,
the cells were counted and observed under a microscope.
Western blotting
The cells were lysed with RIPA lysis buffer (cat no.
P0013B; Beyotime Biotechnology) to extract total protein. The
protein concentration was determined by a BCA assay, and the
loading buffer was prepared. A total of 20 µg of protein were added
to each well for SDS-PAGE using 10% gels. The separated proteins
were transferred onto a PVDF membrane, and the membrane was blocked
with 5% skimmed milk in TBST (Tris-Borate-Sodium Tween-20) for 1 h
at 4˚C. Then, the PVDF membrane was incubated with the primary
antibodies (dilution, 1:1,000) overnight at 4˚C. The next day, the
PVDF membrane was incubated with the secondary antibodies
(HRP-conjugated Goat anti-Rabbit IgG, cat no. AS014, Abclonal
Biotech Co., Ltd.; and HRP-conjugated Goat anti-Mouse IgG, cat no.
AS003, Abclonal Biotech Co., Ltd.; both at 1:1,000 dilution) at
room temperature for 1 h. Finally, chemiluminescence enhancement
technique (Super ECL Detection Reagent; Shanghai Yeasen
Biotechnology Co., Ltd.) was used for color development.
Quantitative PCR
Total RNA was extracted using the QIAamp DNA Mini
Kit (cat no. 51304; Qiagen GmbH). The reverse transcription
experiment was performed using the SuperScript™ IV
First-Strand Synthesis System Kit (cat no. 18091050; Invitrogen;
Thermo Fisher Scientific, Inc.). The primer sequences were
synthesized by Beijing Qingke Biotechnology Co., Ltd., and are
shown in Table I. For reverse
transcription, the mixed sample was preheated at 37˚C for 15 min,
then heated to 85˚C for 5 sec, and finally cooled to 4˚C and held
at that temperature. The samples were mixed with SYBR Green I (cat
no. S7563; Thermo Fisher Scientific, Inc.), and the expression of
the PKM gene was quantified using the real-time PCR system
LightCycler 480 [Roche Diagnostics (Shanghai) Co., Ltd.]. qPCR was
performed under the following thermal cycling conditions: Initial
hold at 95˚C for 5 min, followed by 40 cycles of denaturation at
95˚C for 10 sec and annealing at 60˚C for 30 sec. Gene expression
levels were defined by threshold cycles, and data analysis was
performed using the 2-ΔΔCq method (18). The primers required for the present
study are shown in Table I.
 | Table IQuantitative PCR primers. |
Table I
Quantitative PCR primers.
| Primer name | Primer sequence
(5'-3') |
|---|
| PKM-F |
ATTATTTGAGGAACTCCGCCGCCT |
| PKM-R |
ATTCCGGGTCACAGCAATGATGG |
| GAPDH-F |
CTGTTGCTGTAGCCAAATTCGT |
| GAPDH-R |
ACCCACTCCTCCACCTTTGAC |
ROS analysis
Cells to be tested were washed with PBS, then
incubated with DMEM containing 10 µM reactive oxygen free radical
fluorescent probe (DCFH-DA; Beyotime Biotechnology) for 20 min in a
37˚C incubator. Cells washed with DMEM, digested with trypsin,
centrifuged to collect cells and resuspend in PBS. The
intracellular ROS content was detected using a BD FACSCanto Flow
Cytometer (Waters Biosciences).
RNA sequencing (RNA-seq) analysis
Total RNA was extracted from WI-38 cells utilizing
TRIzol™ reagent (cat no. 15596026; Thermo Fisher
Scientific, Inc.) according to the manufacturer's procedure. RNA
sequencing, data processing and analysis were outsourced to LC-Bio
Technologies Co., Ltd. (project no. LC-P20260525063), following
these steps: The total RNA quantity and purity were analyzed by
Thermo Fisher Qubit3.0 (Q33216; Thermo Fisher Scientific, Inc.) and
Agilent 5300 Fragment Analyzer (M5311AA; Agilent Technologies,
Inc.). High-quality RNA samples with RNA integrity number >7.0
were used to construct the sequencing library, followed by
quantification on a NanoDrop ND-1000 (concentration >50 ng/µl,
total amount >1 µg). Library construction involved two rounds of
polyadenylated [poly(A)] mRNA enrichment using oligo(dT) magnetic
beads (Thermo Fisher Scientific, Inc.). mRNA was fragmented at 94˚C
for 6 min (NEBNext Magnesium RNA Fragmentation Module; E6150; New
England BioLabs, Inc.), then reverse-transcribed to cDNA using
SuperScript II Reverse Transcriptase. During second-strand
synthesis, double-stranded cDNA was constructed by incorporating
dUTP (Thermo Fisher Scientific, Inc.) with E. coli DNA
Polymerase I and RNase H (both New England BioLabs, Inc.). After
end repair and adapter ligation, strand-specific libraries were
prepared via UDG enzyme (New England BioLabs, Inc.) digestion.
Final libraries (300±50 bp) were amplified through 8 PCR cycles
(98˚C/15, 60˚C/15 and 72˚C/30 sec). Sequencing was performed on the
Illumina Novaseq™ X Plus (Novaseq X Plus; Illumina,
Inc.) in 150-bp paired-end mode. Raw data were processed by fastp
to remove adapter sequences and low-quality bases, followed by
alignment to the human reference genome GRCh38 using HISAT2.
Transcript assembly and FPKM quantification were conducted with
StringTie. Differentially expressed genes (DEGs) were identified by
DESeq2 analysis (|log<sub>2</sub> fold change| >1,
adjusted P<0.05).
Molecular docking
The Crocin I compound was docked with the potential
target to analyze their binding affinities. The crystal structure
of the PKM2 protein (PDB ID: 9HIC) was downloaded from the RCSB
Protein Data Bank (http://www.pdb.org/), and then the Crocin Ⅰ MOL.2
format was downloaded from the TCMSP database (https://www.tcmsp-e.com/molecule.php?qn=1405). Both
the protein and Crocin Ⅰ structures were modified using the
Autodock tools 1.5.6 software (https://autodock.scripps.edu/), including water
removal, hydrogen and Kollman charges addition. Both the modified
files were saved in pdbqt format. And then, Autodock Vina was used
for docking. The final docking result was visualized by using PyMOL
3.1 software (https://www.pymol.org/).
PK activity analysis
The PK activity assay kit was used to measure PKM2
enzyme activity. After removing the culture medium from the cells
to be tested, the cells were washed once with PBS, then extraction
buffer (1 ml of extraction buffer per 5x106 cells) was
added. The cells were scraped off and collected into a centrifuge
tube. The solution containing the cells was then sonicated on an
ice bath with the following setting: Power 200 W, sonicate for 3
sec, pause for 10 sec and repeat 30 times. This was then
centrifuged at 8,000 x g and 4˚C for 10 min, and once this was
complete the supernatant was collected and placed on ice until
ready for analysis. The microplate reader was preheated to 37˚C for
30 min. Then 10 µl of sample, 10 µl of Reagent 3 and 180 µl of
buffer, were mixed well, and the absorbance (A1) was quickly
measured at 37˚C and 340 nm. The absorbance (A2) was then measured
again after 2 min. ΔA=A1-A2 was calculated based off of these
readings.
PK activity was calculated using the following
formula: PK activity (U/104
cell)=[ΔAxV1/(εxd)/109]÷(NxV2/V3)/T. Definition of the
units: One enzyme activity unit is defined as the consumption of 1
nmol of NADH per minute per 1x104 cells in the reaction
system; V1, total volume of the reaction system, 2x10-4
L; ε, molar extinction coefficient of NADH, 6.22x10³ l/mol/cm; d,
path length of the 24-well plate, 1.5 cm; V2, volume of sample
added (0.01 ml); V3, volume of extraction solution added, (1 ml);
T, reaction time (2 min); N, total number of cells
(104).
L-lactate production rate
analysis
The test was conducted using the L-LA content
detection kit. The procedure was performed according to the
manufacture's instructions. The cells were collected and suspended
in 1 ml of extraction solution 1 at a concentration of
5x106 cells/ml. After ultrasonic disruption, the mixture
was centrifuged at 12,000 x g for 10 min at room temperature. A
total of 0.8 ml was pipetted from the supernatant and 0.15 ml of
extraction solution 2 was added. Then, the mixture was centrifuged
at 12,000 x g for 10 min at room temperature. The supernatant was
pipetted for testing. The working solutions 2, 4 and 5 were added
to the sample and were mixed thoroughly. Then, use the absorbance
value was recorded at 570 nm.
The L-LA content was calculated using the following
formula: LA content (µmol/ml)=C1xΔ1/Δ2x(V1+V2)/[V4xV1/(V3+V4)]xF.
The definitions are as follows: C1, standard concentration (2
µmol/ml); Δ1=test group-blank group; Δ2=standard group-blank group;
V1, volume of supernatant (0.8 ml); V2, volume of extract 2 (0.15
ml); V3, volume of extract 1 (1 ml); V4, volume of liquid sample
(0.1 ml); F, dilution factor.
Statistical analysis
All experimental results were independently repeated
three times. Data are presented as the mean ± standard deviation.
All data were analyzed and plotted using Graph Pad 8.4.3
(Dotmatics). One-way analysis of variance (ANOVA) was used for
comparisons among multiple groups supplemented with a Dunnett's
post hoc test (suitable for comparing multiple experimental groups
to a single control group) and Tukey's post hoc test (suitable for
pairwise comparisons among all groups). P<0.05 was considered to
indicate a statistically significant difference.
Results
Effect of Crocin Ⅰ on replicative
senescence of WI-38 cells
As shown in Fig.
1B, 30PD WI-38 cells treated with Crocin I for 3 days showed an
increased cell viability in the dose of 5, 10, 20, 40 µM, with 10
µM showing an optimal efficacy. This concentration was then
selected for further long-term culture of WI-38 cells. Starting
from 30PD, a solvent control group (0.1% DMSO) and a dosing group
(10 µM Crocin I) were established to culture WI-38 cells. The cells
were then cultured by the conventional method until 55PD. Compared
with the young cells at 30PD, the SA-β-Gal staining positive rate
in the solvent control group at 55PD was ~90%, while it was
significantly lower in 10 µM Crocin I treated group than that of
the solvent control group at 55PD (Fig. 1C and D). Meanwhile, compared with 55PD control
group, the intracellular ROS levels were significantly decreased in
the Crocin I treatment group (Fig.
1E and F); a decrease in
intracellular ROS levels indicates reduced oxidative stress
(19). Furthermore, western
blotting analysis revealed that the expression of the aging-related
proteins p53 and p21 was significantly lower in the Crocin I group
than that of the solvent control group, low expression levels
similar to those in young cells, shown as in Fig. 1G, H and I.
The above results indicate that Crocin I reduces intracellular ROS
levels and oxidative stress, and induces a decrease in p53/p21
expression, resulting in delayed cellular senescence.
To determine whether Crocin I has similar effects in
other cell lines, HK-2 cells were selected for further experiments.
HK-2 is an immortalized cell line that can be induced to undergo
premature senescence by 0.8 mM H2O2 (20). As shown in Fig. S1A, Crocin I exhibited no
cytotoxicity toward HK-2 cells; therefore, the same concentration
(10 µM) was used, as in the previous experiments. After treating
HK-2 cells with 0.8 mM H2O2 for 24 h, the
medium was replaced with fresh medium containing 10 µM Crocin I,
and the cells were allowed to recover for 24 h. As shown in
Fig. S1B, the SA-β-Gal staining
positivity rate was significantly increased in
H2O2-treated HK-2 cells, while Crocin I
effectively reduced this positivity rate. Furthermore, Crocin I
inhibited the H2O2-induced increase in p53
and p21 protein expression levels (Fig. S1C-E).
Effect of Crocin Ⅰ on premature
senescence induced by AAPH
In order to explore the effect of Crocin Ⅰ on cells
senescence a premature senescent cell model in WI-38 cells induced
by AAPH, a reagent widely used for the induction of premature
senescence, was used (21). The
present results showed that AAPH ranged 3-5 mM induced a robust
decline of cell viability ≤50% (Fig.
2A). Moreover, there was no significant difference in the rate
of positive of SA-β-Gal staining induced by AAPH among 4 and 5 mM
(Fig. 2B, C, D and
G). Therefore, AAPH at 4 mM was
then chosen to construct the premature cellular senescence model
for the subsequent experiments. After AAPH treatment of 30PD WI-38
cells for 24 h, the medium was replaced with fresh medium
containing each concentration of Crocin I (5, 10, 20 µM) for 3 days
of recovery. N-acetylcysteine reduces intracellular ROS levels and
serves as a positive control at a concentration of 2 mM (22). As shown in Fig. 2E and F, the results of SA-β-Gal staining showed
that the intervention of Crocin I (5, 10, 20 µM) effectively
reduced the positive rate of staining. In addition, Crocin I
dose-dependently suppressed the elevation of p53 and p21 protein
expressions induced by AAPH (Fig.
2H and I).
Effect of Crocin I on SIRT1/PKM2
expression and lactate production in late PD WI-38 cells
For further discovery of potential target molecules
for Crocin I intervention in cellular senescence, RNA-seq analysis
was performed. As shown in the Fig.
3A, Crocin I intervention induced genes alteration in genes
such as pyruvate kinase (pyruvate kinase M1/2 type, PKM) as well as
other genes. As shown in Fig. 3B
and C, gene ontology (GO) analysis
indicated that the differentially expressed genes induced by Crocin
I at the dose of 10 µM were enriched in GO terms such as
‘phosphorylation’, ‘oxidoreductase activity’, ‘glucose metabolic
process’ and ‘replicative senescence’. In addition, KEGG analysis
revealed that the differentially expressed genes were enriched in
‘glycolysis/gluconeogenesis’, ‘hippo signaling pathway’ and
‘pyruvate metabolism’. As emphasized by Gorgoulis et al
(23), cellular senescence not
only involves DNA damage responses and protein stress but is also
frequently accompanied by metabolic shifts towards glycolysis.
While the PKM gene was mainly involved in the process of
glycolysis, which could encode two forms of enzymes, M1 and
M2(24). Compared with the solvent
control group, PKM gene expression was significantly decreased in
the Crocin I group (Fig. 3A and
D). Meanwhile, molecular docking
between PKM2 and Crocin I was performed, which demonstrated that
the binding energy was -8.3 kJ/mol. As shown in Fig. 3E, Crocin I mainly interacts with
PKM2 at the residues VAL508, CYS424 and ASP160. To verify whether
Crocin I binding affects PKM2 enzyme activity, a PK enzyme activity
assay was conducted. A kit for detection of total PK enzymatic
activity (PKM1 and PKM2) was used. The experiment was designed
using the PKM2 inhibitor shikonin to detect the effect of Crocin I
on PKM1 or PKM2 enzymatic activity. Previous studies have shown
that 5 µM Shikonin markedly inhibits intracellular PKM2 enzymatic
activity (25); therefore, cells
were co-treated with Shikonin and Crocin I to determine whether
Crocin I inhibits PKM1 enzymatic activity. As shown in Fig. 3F, compared with the with Shikonin
alone treatment group, co-treatment with Shikonin and Crocin I did
not further reduce the overall enzymatic activity of pyruvate
kinase, demonstrating that the inhibitory effect of Crocin I on
PKM1 was undetectable in current experiment. While Crocin I alone
induced an obvious reduction on PKM2 enzymatic activity.
Additionally, Crocin I was found to suppress the expression level
of PKM2 by western blotting (Fig.
3G and H). Moreover,
significantly lower levels of lactate were observed after Crocin I
intervention (Fig. 3K), suggesting
a reduced contribution of glycolysis during the cellular
senescence. A previous study has confirmed that SIRT1 interacts
with and deacetylates PKM2 at K135 and K206, thus leading to
reduced PKM2 enzyme activity and lactate production (26). Consistently, the present study also
illustrated that Crocin I intervention could enhance the level of
SIRT1 expression (Fig. 3I and
J), revealing that Crocin I
intervention may improve cellular senescence through SIRT1/PKM2
mediated glycolysis pathway. Moreover, the inhibition of Crocin I
on the PKM2 protein expression was partly reversed by sirtinol
(Fig. 3L, M and N),
an inhibitor of SIRT1(27), which
indicated that Crocin I could directly regulate PKM2 expression via
SIRT1, at least in part. A schematic diagram of the delays
senescence mechanism of Crocin I is shown in Figure 4.
 | Figure 3Effect of Crocin I on SIRT1/PKM2
expression and lactate production in late PD WI-38 cells. (A)
Heatmap of the gene expression changes in WI-38 cells. Young: 30PD
cells; Old: 55PD cells; Crocin I: 55PD cells treated with 10 µM
Crocin I for 48 h. (B) GO and (C) KEGG enrichment analysis of
alteration genes. (D) Effect of Crocin I on expression level of PKM
gene in 55PD WI-38 cells. (E) Molecular docking of PKM2 protein and
Crocin I predicted by Autodock tools. (F) Effect of Crocin I on PK
enzyme activity. PK enzyme activity was measured after 30PD WI-38
cells were treated with the respective drugs (Shk 5 µM; CR 10 µM)
for 24 h. (G and H) Effect of Crocin I on PKM2 protein expression
in 55PD WI-38 cells. (I and J) Effect of Crocin I on SIRT1 protein
expression in 55PD WI-38 cells. (K) Effect of Crocin I on lactate
content in senescent WI-38 cells. (L-N) The effect of Crocin I on
SIRT1 and PKM2 protein expression in WI-38 cells after Sirtinol
treatment (Sirtinol 10 µM; Crocin I 10 µΜ). WI-38 cells were
pretreated with Sirtinol for 4 h, followed by treatment with Crocin
I for 24 h. (##P<0.01, vs. Ctrl 30PD;
#P<0.05, vs. Ctrl 30PD; **P<0.01, vs.
Ctrl 55PD; *P<0.05, vs. Ctrl 55PD). Shk, Shikonin;
CR, Crocin I; GO, gene ontology; KEGG, Kyoto encyclopedia of genes
and genomes; PK, pyruvate kinase. |
Discussion
Saffron (Crocus sativus L.) has a wide range
of biological properties with multiple applications in different
industrial sectors as pharmaceuticals and nutrients (28,29).
Currently, the commercial production of Crocin is based on
purification from saffron stigmas and gardenia fruits (30). Moreover, saffron is not only used
as a classical TCM but also universally recognized as a safe and
valuable spice (31). For
instance, it is used as dietary supplement in the culinary
traditions in European, Middle Eastern and Asian countries
(32). Ouahhoud et al
(33) had revealed that saffron
stigmas exhibited vigorous biological activity, with an IC50 value
of 1,554.37 µg/ml. In addition, administration of a high dose of
Crocin (150 mg/kg) to tumor-bearing mice showed no reported adverse
toxic effects. Thus, it is a safe drug at an average dose, but an
overdose of Crocin exhibited adverse effect including nausea,
vomiting, stomach upset, dizziness, constipation, restlessness,
headaches, collapse, liver and kidney impairments (34). Cytotoxic effect analysis showed an
IC50 of 20 µM in HeLa cells (34).
In the present study, the effect of Crocin Ⅰ against cellular
senescence both in replicative senescence model and AAPH-induced
premature cellular senescence model was preliminarily explored. It
was found that Crocin Ⅰ could significantly reduce the protein
levels of the aging-related molecular p53 and p21 in the WI-38
cells; meanwhile, Crocin Ⅰ suppressed the production of
intracellular ROS. PKM was further identified as the potential
target molecule of Crocin Ⅰ intervention during cellular
senescence, following with enhancing of the level of SIRT1
expression. Furthermore, Crocin Ⅰ significantly reduced the level
of cellular lactate in late PD fibroblasts, indicating that Crocin
Ⅰ may regulate the level of glycolysis to alleviate cellular
senescence.
Cellular senescence is a dynamic biological process
illustrated by a gradual decline in multiple cellular activities,
resulting to the whole-body aging as well as age-related diseases
(35). Notably, the dysfunction in
glucose metabolism, such as enhanced glycolysis and alteration in
glucose transporter activity, are frequently observed in senescent
cells (36). For instance,
vascular endothelial cells (ECs) undergo changing metabolic
reprogramming, including glycolysis, redox homeostasis alteration,
mitochondrial dysfunction following with body aging (37). On the other hand, healthy ECs
commonly maintain metabolic homeostasis primarily relying on the
energy provided by glycolysis pathway (37). Glycolysis process could enhance the
production of lactic acid by producing pyruvate relying on the high
level of lactate dehydrogenase (LDH), PKM and hexokinase (38). While PKM is responsible for the
last conversion step of glycolysis to produce pyruvate (39). Meanwhile, the enhanced of LDH
resulted by PKM produced a higher level of lactate in senescent
cells than young cells (40),
leading to multiple senescence-associated events, such as cancers
and evasion of immune responses (41,42).
In addition, the PKM gene encodes two forms of proteins, PKM1 and
PKM2(43), and PKM2 also exists
two forms, dimer and tetramer, each with distinct biological
functions (44). The dimer form
can enter the cell nucleus to participate in regulation and serves
as a switch for energy metabolism and substance synthesis; the
tetramer form mainly functions as an enzyme to regulate glycolysis
(45). Consistent with previous
studies, it was observed in the present study that elevating the
level of PKM2 enhanced glucose metabolism through increasing
production of lactate in those senescent cells, while Crocin I
treatment partly decreased the levels of PKM2 and lactate which may
result in delaying senescence.
Beside to the regulation on glycolysis of Crocin I,
the RNA seq data indicated several other pathways including Hippo
signaling and pyruvate metabolism. The Hippo pathway is an
evolutionarily conserved signaling cascade pathway to regulate
tissue growth and cell fate (46-48),
including cell differentiation, proliferation as well as cell
senescence. For example, YAP and its paralog, TAZ are well-known
transcriptional coactivators that activate transcription in Hippo
pathway. YAP can transcriptionally regulate cyclin D-dependent
kinase 6 gene expression to maintain normal cell growth and
suppress cellular senescence (49). These results suggest that Crocin I
delays cellular senescence, possibly via multiple pathways rather
than glycolysis pathway specially.
Previous study had indicated that PKM2 had been
identified as a downstream target of SIRT1(26), which is a member of the sirtuin
family. SIRT1 is an NAD+-dependent protein deacetylase
(50) to illustrate essential
roles in a series of cellular biological processes, including DNA
repair, apoptosis, senescence and autophagy (51). Furthermore, SIRT1 has also showed
notable function in energy balance through affecting mitochondrial
biogenesis, calcium homeostasis and oxidative phosphorylation
(52,53). In line with this respect, the
present study found that SIRT1 was decreased in senescent WI-38
cells, with a high level of cellular ROS, while Crocin I decreased
the level of ROS and enhanced the expression of SIRT1. Moreover, it
was observed that PKM2 was decreased in the presence of high
expressing of SIRT1. A previous study had indicated that SIRT1
inhibited lactate accumulation through the deacetylation-induced
PKM2 inhibition to alleviate neuroinflammation (26). Specifically, SIRT1 could
deacetylate two lysine residues of PKM2, K135 and K206, which
markedly blocked PKM2 enzyme activity (26). PKM2 is responsible for the first
step in manipulating lactate production, which was consistent with
the present finding. However, there is a need to further explore
the detailed molecular mechanisms for the interaction between SIRT1
and PKM2 during Crocin Ⅰ delaying cellular senescence.
Consist with the present study, Crocin also could
effectively inhibit the generation of ROS in mouse retinal
photoreceptor (661W) cells. In addition, treatment with 200 µM of
Crocin could alleviate mitochondrial aggregation and notably
prevented an all-trans-retinal (atRAL)-induced decrease in
mitochondrial membrane potential levels (54). In addition, Crocin remarkably
attenuated an increase in mitochondrial superoxide levels in
atRAL-treated 661W cells. Meanwhile, Crocin notably inhibits
atRAL-induced apoptosis in photoreceptor cells by reducing damage
and oxidative stress (54). A
clinical trial showed that 8 weeks of treatment of Crocin capsule
is effective in reducing oxidative stress in serum samples and
decreasing DNA damage (55).
This study preliminarily proved that Crocin Ⅰ has
the functions of regulating the level of glycolysis and delaying
cellular senescence. However, there are still some limitations that
remain unresolved. First, it is not known whether Crocin Ⅰ directly
regulates the PKM gene, and its upstream or downstream genes still
need further exploration. And molecular docking illustrated that
Crocin I could bind with PKM2, however functional assays of PKM2
enzymatic activity was not performed. Second, the association
between regulating the level of glycolysis and delaying cellular
senescence has not been fully verified, and subsequent work should
address this issue. Third, the reduction of PKM2 expression levels
was observed, however, the oligomeric state, dimer or tetramer,
remains unconfirmed. Lastly, the specific acetylation site(s) of
PKM2 regulated by SIRT1 have not been fully identified in the
present experimental system.
In conclusion, the present results indicate that
Crocin I has an anti-senescence effect. Crocin I regulated PKM2
expression by upregulating SIRT1; since PKM2 is a key molecule in
the regulation of glycolysis, this may be one of the factors
contributing to the anti-senescence effect. A limitation of the
present study is that the specific mechanisms by which Crocin I
regulates glycolysis in a cellular senescence model have not yet
been thoroughly investigated, and therefore further research is
needed.
Supplementary Material
Effect of Crocin I on premature
senescent HK-2 cells induced by H2O2. (A) The effect of Crocin I on
the viability of HK-2 cells detected by the cell counting kit-8
assay. (B) Effect of Crocin I (10 μM) on SA-β-Gal staining
in HK-2 cells. All cells were observed under a 10X objective lens.
(C-E) The change in senescence-related proteins in prematurely
senescent HK-2 cells dosed with 10 μM Crocin I.
##P<0.01 vs. Ctrl; *P<0.05, vs. Ctrl
H2O2. Ctrl, control group; Ctrl (H2O2), HK-2 cells dosed with 0.8
mM H2O2; Crocin I, H2O2-induced prematurely senescent HK-2 cells
dosed with 10 μM Crocin I.
Acknowledgements
Not applicable.
Funding
Funding: The present study was supported by the project from the
Traditional Chinese Medicine Administration of Zhejiang Province
(grant no. 2025ZL161) and Joint TCM Science & Technology
Project of National Demonstration Zones for Comprehensive TCM
Reform (grant no. GZY-ZJ-KJ-24055).
Availability of data and materials
The RNA-seq data generated in the present study may
be found in the Gene Expression Omnibus database under accession
number GSE335498 or at the following URL: https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE335498.
The other data generated in the present study may be requested from
the corresponding author.
Authors' contributions
YF designed the present research and wrote the
original manuscript draft. ZD and CW analyzed the experimental
data. YC developed the methodology. SW participated in the
conception and design of the study and provided guidance. GM
reviewed and edited the manuscript, supervised the project,
acquired funding and contributed to the conceptualization of the
study. HS acquired funding and contributed to the conceptualization
of the study. YF, ZD, CW, YC, SW and GM confirm the authenticity of
all the raw data. All authors have read and approved the
manuscript.
Ethics approval and consent to
participate
Not applicable.
Patient consent for publication
Not applicable.
Competing interests
The authors declare that they have no competing
interests.
References
|
1
|
Birch J and Gil J: Senescence and the
SASP: Many therapeutic avenues. Genes Dev. 34:1565–1576.
2020.PubMed/NCBI View Article : Google Scholar
|
|
2
|
Kroemer G, Maier AB, Cuervo AM, Gladyshev
VN, Ferrucci L, Gorbunova V, Kennedy BK, Rando TA, Seluanov A,
Sierra F, et al: From geroscience to precision geromedicine:
Understanding and managing aging. Cell. 188:2043–2062.
2025.PubMed/NCBI View Article : Google Scholar
|
|
3
|
Zhu Y, Liu X, Ding X, Wang F and Geng X:
Telomere and its role in the aging pathways: Telomere shortening,
cell senescence and mitochondria dysfunction. Biogerontology.
20:1–16. 2019.PubMed/NCBI View Article : Google Scholar
|
|
4
|
Mas-Bargues C: Mitochondria pleiotropism
in stem cell senescence: Mechanisms and therapeutic approaches.
Free Radic Biol Med. 208:657–671. 2023.PubMed/NCBI View Article : Google Scholar
|
|
5
|
Gao Y, Shen S, Wang Y and Tian M: Organ
crosstalk: The role of spleen. Phenomics. 5:192–207.
2024.PubMed/NCBI View Article : Google Scholar
|
|
6
|
Yang YN, Zhan JG, Cao Y and Wu CM: From
ancient wisdom to modern science: Gut microbiota sheds light on
property theory of traditional Chinese medicine. J Integr Med.
22:413–444. 2024.PubMed/NCBI View Article : Google Scholar
|
|
7
|
Cai M, Guo Q, Li J, Dai X, Su H, Zhang W,
Qiang N, Li G, Jin Z and Zhu H: Resveratrol attenuates
H2O2-induced aging and apoptosis in mouse
hippocampal neuron HT22 cells by activating autophagy via the
SIRT1/FoxO1 signaling pathway. Mol Neurobiol. 63(12)2025.PubMed/NCBI View Article : Google Scholar
|
|
8
|
Javadi B, Sahebkar A and Emami SA: A
survey on saffron in major islamic traditional medicine books. Iran
J Basic Med Sci. 16:1–11. 2013.PubMed/NCBI
|
|
9
|
Geng Lei WG and Liu Shaoqing: Optimization
on formula parameters of Crocus sativus oral liquid by
response surface methodology and its anti-fatigue function. Food
Sci Technol. 43:156–160. 2018.
|
|
10
|
Karkoula E, Dagla IV, Baira E, Kokras N,
Dalla C, Skaltsounis AL, Gikas E and Tsarbopoulos A: A novel
UHPLC-HRMS-based metabolomics strategy enables the discovery of
potential neuroactive metabolites in mice plasma, following i.p.
administration of the main Crocus sativus L. bioactive
component. J Pharm Biomed Anal. 177(112878)2020.PubMed/NCBI View Article : Google Scholar
|
|
11
|
Pourmousavi L, Asadi RH, Zehsaz F and
Jadidi RP: Potential therapeutic effects of crocin. Naunyn
Schmiedebergs Arch Pharmacol. 397:7395–7420. 2024.PubMed/NCBI View Article : Google Scholar
|
|
12
|
García-Ricote I, Jiménez AJL, Megías D,
Gavira-O Neill CE, Gómez-Gómez L, Ahrazem O and Casas-Tintó S:
Protective effects of crocin-enriched tomato in ageing and brain
mitochondrial function using Drosophila melanogaster. Biomed
Pharmacother. 196(119119)2026.PubMed/NCBI View Article : Google Scholar
|
|
13
|
Heidari S, Mehri S, Shariaty V and
Hosseinzadeh H: Preventive effects of crocin on neuronal damages
induced by D-galactose through AGEs and oxidative stress in human
neuroblastoma cells (SH-SY5Y). J Pharmacopuncture. 21:18–25.
2018.PubMed/NCBI View Article : Google Scholar
|
|
14
|
Wang Q, Zhang L, Su H and Wan X: Effect of
saffron on antioxidant capacity of D-galactose-induced aging rat
model. Chin Arch Tradit Chin Med. 38:18–21. 2020.
|
|
15
|
Legrain Y, Touat-Hamici Z and Chavatte L:
Interplay between selenium levels, selenoprotein expression, and
replicative senescence in WI-38 human fibroblasts. J Biol Chem.
289:6299–6310. 2014.PubMed/NCBI View Article : Google Scholar
|
|
16
|
Mao G, Li H, Ding X, Meng X, Wang G and
Leng SX: Suppressive effects of sirtinol on human cytomegalovirus
(hCMV) infection and hCMV-induced activation of molecular
mechanisms of senescence and production of reactive oxygen species.
Mech Ageing Dev. 158:62–69. 2016.PubMed/NCBI View Article : Google Scholar
|
|
17
|
Kim HY, Park JS, Jeon BH, Choi HS, Kim CS,
Ma SK, Kim SW and Bae EH: Role of APE1/Ref-1 in hydrogen
peroxide-induced apoptosis in human renal HK-2 cells. Kidney Res
Clin Pract. 43:186–201. 2024.PubMed/NCBI View Article : Google Scholar
|
|
18
|
Livak KJ and Schmittgen TD: Analysis of
relative gene expression data using real-time quantitative PCR and
the 2(-Delta Delta C(T)) method. Methods. 25:402–408.
2001.PubMed/NCBI View Article : Google Scholar
|
|
19
|
Schieber M and Chandel NS: ROS function in
redox signaling and oxidative stress. Curr Biol. 24:R453–R462.
2014.PubMed/NCBI View Article : Google Scholar
|
|
20
|
Rattananinsruang P, Noonin C, Yoodee S and
Thongboonkerd V: Comparative analysis of markers for
H2O2-induced senescence in renal tubular
cells. Environ Toxicol Pharmacol. 97(104039)2023.PubMed/NCBI View Article : Google Scholar
|
|
21
|
Tang D, Yan R, Sun Y, Kai G, Chen K and Li
J: Material basis, effect, and mechanism of ethanol extract of
Pinellia ternata tubers on oxidative stress-induced cell
senescence. Phytomedicine. 77(153275)2020.PubMed/NCBI View Article : Google Scholar
|
|
22
|
Kalyanaraman B: NAC, NAC, Knockin' on
Heaven's door: Interpreting the mechanism of action of
N-acetylcysteine in tumor and immune cells. Redox Biol.
57(102497)2022.PubMed/NCBI View Article : Google Scholar
|
|
23
|
Gorgoulis VG, Pefani DE, Pateras IS and
Trougakos IP: Integrating the DNA damage and protein stress
responses during cancer development and treatment. J Pathol.
246:12–40. 2018.PubMed/NCBI View Article : Google Scholar
|
|
24
|
Zhang Z, Deng X, Liu Y, Liu Y, Sun L and
Chen F: PKM2, function and expression and regulation. Cell Biosci.
9(52)2019.PubMed/NCBI View Article : Google Scholar
|
|
25
|
Chen J, Xie J, Jiang Z, Wang B, Wang Y and
Hu X: Shikonin and its analogs inhibit cancer cell glycolysis by
targeting tumor pyruvate kinase-M2. Oncogene. 30:4297–4306.
2011.PubMed/NCBI View Article : Google Scholar
|
|
26
|
Lian B, Zhang J, Yin X, Wang J, Li L, Ju
Q, Wang Y, Jiang Y, Liu X, Chen Y, et al: SIRT1 improves lactate
homeostasis in the brain to alleviate parkinsonism via
deacetylation and inhibition of PKM2. Cell Rep Med.
5(101684)2024.PubMed/NCBI View Article : Google Scholar
|
|
27
|
Wang J, Kim TH, Ahn MY, Lee J, Jung JH,
Choi WS, Lee BM, Yoon KS, Yoon S and Kim HS: Sirtinol, a class III
HDAC inhibitor, induces apoptotic and autophagic cell death in
MCF-7 human breast cancer cells. Int J Oncol. 41:1101–1109.
2012.PubMed/NCBI View Article : Google Scholar
|
|
28
|
Ali A, Yu L, Kousar S, Khalid W, Maqbool
Z, Aziz A, Arshad MS, Aadil RM, Trif M, Riaz S, et al: Crocin:
Functional characteristics, extraction, food applications and
efficacy against brain related disorders. Front Nutr.
9(1009807)2022.PubMed/NCBI View Article : Google Scholar
|
|
29
|
Guo ZL, Li MX, Li XL, Wang P, Wang WG, Du
WZ, Yang ZQ, Chen SF, Wu D and Tian XY: Crocetin: A systematic
review. Front Pharmacol. 12(745683)2022.PubMed/NCBI View Article : Google Scholar
|
|
30
|
Morote L, Moreno Giménez E, López Jiménez
AJ, Rubio-Moraga Á, Aragonés V, Ahrazem O, Daròs JA and Gómez-Gómez
L: Biotechnological production of crocetin and crocins using a
carotenoid cleavage dioxygenase (CCD4) from Nyctanthes
arbor-tristis. Front Plant Sci. 16(1671592)2025.PubMed/NCBI View Article : Google Scholar
|
|
31
|
Abu-Izneid T, Rauf A, Khalil AA, Olatunde
A, Khalid A, Alhumaydhi FA, Aljohani ASM, Sahab Uddin M, Heydari M,
Khayrullin M, et al: Nutritional and health beneficial properties
of saffron (Crocus sativus L): A comprehensive review. Crit
Rev Food Sci Nutr. 62:2683–2706. 2022.PubMed/NCBI View Article : Google Scholar
|
|
32
|
Zou Z, Lei D, Wang X, Yin Y, Li H, Di X
and Li X: Crocin ameliorates cognitive impairment and pathological
changes in Alzheimer's disease model mice by regulating gut
microbiota. Food Sci Nutr. 13(e71117)2025.PubMed/NCBI View Article : Google Scholar
|
|
33
|
Ouahhoud S, Khoulati A, Kadda S, Bencheikh
N, Mamri S, Ziani A, Baddaoui S, Eddabbeh FE, Lahmass I, Benabbes
R, et al: Antioxidant activity, metal chelating ability and DNA
protective effect of the hydroethanolic extracts of Crocus
sativus stigmas, tepals and leaves. Antioxidants (Basel).
11(932)2022.PubMed/NCBI View Article : Google Scholar
|
|
34
|
Jiang Z, Gu M, Liu J, Li H, Peng J and
Zhang Y: Anticancer activity of crocin against cervical carcinoma
(HeLa cells): Bioassessment and toxicity evaluation of crocin in
male albino rats. J Photochem Photobiol B. 180:118–124.
2018.PubMed/NCBI View Article : Google Scholar
|
|
35
|
Wechter N, Rossi M, Anerillas C,
Tsitsipatis D, Piao Y, Fan J, Martindale JL, De S, Mazan-Mamczarz K
and Gorospe M: Single-cell transcriptomic analysis uncovers diverse
and dynamic senescent cell populations. Aging (Albany NY).
15:2824–2851. 2023.PubMed/NCBI View Article : Google Scholar
|
|
36
|
Mun H, Shin CH, Kim M, Chang JH and Yoon
JH: RNA-binding protein AUF1 suppresses cellular senescence and
glycolysis by targeting PDP2 and PGAM1 mRNAs. Aging (Albany NY).
17:1746–1761. 2025.PubMed/NCBI View Article : Google Scholar
|
|
37
|
Wang WL, Shih YT, Wei SY and Chiu JJ:
Impacts of aging and fluid shear stress on vascular endothelial
metabolism and atherosclerosis development. J Biomed Sci.
32(83)2025.PubMed/NCBI View Article : Google Scholar
|
|
38
|
Lund J, Aas V, Tingstad RH, Van Hees A and
Nikolić N: Utilization of lactic acid in human myotubes and
interplay with glucose and fatty acid metabolism. Sci Rep.
8(9814)2018.PubMed/NCBI View Article : Google Scholar
|
|
39
|
Pan Y, Zheng Q, Ni W, Wei Z, Yu S, Jia Q,
Wang M, Wang A, Chen W and Lu Y: Breaking glucose transporter
1/pyruvate kinase M2 glycolytic loop is required for cantharidin
inhibition of metastasis in highly metastatic breast cancer. Front
Pharmacol. 10(590)2019.PubMed/NCBI View Article : Google Scholar
|
|
40
|
Bhargava P and Schnellmann RG:
Mitochondrial energetics in the kidney. Nat Rev Nephrol.
13:629–646. 2017.PubMed/NCBI View Article : Google Scholar
|
|
41
|
Lu X, Wu J, Agborbesong E and Li X:
P16-positive senescent cells promote DKD by the dysregulation of
glycolysis and mitochondrial metabolism. Cell Death Discov.
11(355)2025.PubMed/NCBI View Article : Google Scholar
|
|
42
|
Nacarelli T and Sell C: Targeting
metabolism in cellular senescence, a role for intervention. Mol
Cell Endocrinol. 455:83–92. 2017.PubMed/NCBI View Article : Google Scholar
|
|
43
|
Gupta V and Bamezai RN: Human pyruvate
kinase M2: A multifunctional protein. Protein Sci. 19:2031–2044.
2010.PubMed/NCBI View Article : Google Scholar
|
|
44
|
Israelsen WJ, Dayton TL, Davidson SM,
Fiske BP, Hosios AM, Bellinger G, Li J, Yu Y, Sasaki M, Horner JW,
et al: PKM2 isoform-specific deletion reveals a differential
requirement for pyruvate kinase in tumor cells. Cell. 155:397–409.
2013.PubMed/NCBI View Article : Google Scholar
|
|
45
|
Muñoz-Colmenero A, Fernández-Suárez A,
Fatela-Cantillo D, Ocaña-Pérez E, Domínguez-Jiménez JL and
Díaz-Iglesias JM: Plasma tumor M2-pyruvate kinase levels in
different cancer types. Anticancer Res. 35:4271–4276.
2015.PubMed/NCBI
|
|
46
|
Dupont S, Morsut L, Aragona M, Enzo E,
Giulitti S, Cordenonsi M, Zanconato F, Le Digabel J, Forcato M,
Bicciato S, et al: Role of YAP/TAZ in mechanotransduction. Nature.
474:179–183. 2011.PubMed/NCBI View Article : Google Scholar
|
|
47
|
Park J and Hansen CG: Cellular feedback
dynamics and multilevel regulation driven by the hippo pathway.
Biochem Soc Trans. 49:1515–1527. 2021.PubMed/NCBI View Article : Google Scholar
|
|
48
|
Harvey KF, Zhang X and Thomas DM: The
Hippo pathway and human cancer. Nat Rev Cancer. 13:246–257.
2013.PubMed/NCBI View Article : Google Scholar
|
|
49
|
Miyajima C, Nagasaka M, Aoki H, Toriuchi
K, Yamanaka S, Hashiguchi S, Morishita D, Aoyama M, Hayashi H and
Inoue Y: The Hippo signaling pathway manipulates cellular
senescence. Cells. 14(13)2024.PubMed/NCBI View Article : Google Scholar
|
|
50
|
Sauve AA, Wolberger C, Schramm VL and
Boeke JD: The biochemistry of sirtuins. Annu Rev Biochem.
75:435–465. 2006.PubMed/NCBI View Article : Google Scholar
|
|
51
|
Nakagawa T and Guarente L: SnapShot:
Sirtuins, NAD, and aging. Cell Metab. 20:192–192.e1.
2014.PubMed/NCBI View Article : Google Scholar
|
|
52
|
Cantó C, Gerhart-Hines Z, Feige JN,
Lagouge M, Noriega L, Milne JC, Elliott PJ, Puigserver P and Auwerx
J: AMPK regulates energy expenditure by modulating NAD+ metabolism
and SIRT1 activity. Nature. 458:1056–1060. 2009.PubMed/NCBI View Article : Google Scholar
|
|
53
|
Iwabu M, Yamauchi T, Okada-Iwabu M, Sato
K, Nakagawa T, Funata M, Yamaguchi M, Namiki S, Nakayama R, Tabata
M, et al: Adiponectin and AdipoR1 regulate PGC-1alpha and
mitochondria by Ca(2+) and AMPK/SIRT1. Nature. 464:1313–1319.
2010.PubMed/NCBI View Article : Google Scholar
|
|
54
|
Yang B, Yang K, Chen J and Wu Y: Crocin
protects the 661W murine photoreceptor cell line against the toxic
effects of all-trans-retinal. Int J Mol Sci.
25(10124)2024.PubMed/NCBI View Article : Google Scholar
|
|
55
|
Mohammad Soleymani S, Assarzadegan F,
Habibi SAH, Mahboubi A and Esmaily H: The effect of crocin on
movement disorders and oxidative DNA damage in Parkinson's disease:
Insights from a randomized controlled trial. Parkinsonism Relat
Disord. 126(107051)2024.PubMed/NCBI View Article : Google Scholar
|
