Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Molecular Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1107-3756 Online ISSN: 1791-244X
Journal Cover
May-2017 Volume 39 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
May-2017 Volume 39 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

SphK1 modulates cell migration and EMT-related marker expression by regulating the expression of p-FAK in colorectal cancer cells

  • Authors:
    • Chun-Yan Xu
    • Shi-Quan Liu
    • Meng-Bin Qin
    • Chun-Feng Zhuge
    • Lin Qin
    • Nan Qin
    • Ming-Yu Lai
    • Jie-An Huang
  • View Affiliations / Copyright

    Affiliations: Department of Gastroenterology, Τhe First Affiliated Hospital of Guangxi Medical University, Nanning, Guangxi 530021, P.R. China
  • Pages: 1277-1284
    |
    Published online on: March 17, 2017
       https://doi.org/10.3892/ijmm.2017.2921
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Sphingosine kinase 1 (SphK1) plays an important role in colorectal carcinoma metastasis. However, whether SphK1 modulates epithelial-mesenchymal transition (EMT)-related marker expression and the underlying mechanisms remain unclear. In this study, in order to clarify this issue, we used various colorectal cancer (CRC) cell lines, Caco2, HT29, RKO and HCT116. Each of the cell lines was divided into 3 groups as follows: the control group, SKI-Ⅱ (SphK1 inhibitor) group and PF-562271 [focal adhesion kinase (FAK) inhibitor] group. The migratory ability of the cells was examined by Transwell chamber assay. The mRNA and protein expression levels of SphK1, FAK (p-FAK), Slug, vimentin, N-cadherin and E-cadherin were detected by PCR and western blot analysis, respectively. The results revealed that the suppression of SphK1 reduced the cell migratory ability, and decreased the expression of Slug, vimentin and N-cadherin; however, the expression of E-cadherin was increased. Moreover, the inhibition of SphK1 reduced the expression of p-FAK. The inhibition of FAK (p-FAK) also decreased the cell migratory ability, and decreased the expression of Slug, vimentin and N-cadherin, whereas the expression of E-cadherin was increased. Thus, our data suggest that SphK1 modulates the expression of EMT-related markers and cell migration by regulating the expression of p-FAK in CRC cells. Thus, SphK1 may play a functional role in mediating the EMT process in CRC.

Introduction

Colorectal cancer (CRC) is a leading cause of cancer-related mortality (1). Metastasis is the most related cause of the majority of human cancer-related deaths (2). Metastasis is a complex process and many scientists have strived to understand the mechanisms behind this phenomenon over the years (3); however, the mechanisms responsible for the occurrence of metastasis remain to be fully elucidated. The treatment of colon cancer involves a comprehensive therapeutic approach (4). Thus, the more in depth understanding of the mechanisms responsible for CRC metastasis may provide valuable direction and an experimental basis for its treatment in future.

Epithelial-mesenchymal transition (EMT) had been highlighted as a process through which epithelial cells lose their characteristics and gain mesenchymal properties to be motile, playing a critical role in the metastasis of cancer cells (5,6). Among the EMT-related transcription factors, the Snail family of zing finger transcription factors is prominent, particularly Slug (Snail2) (7,8). Stimulating Slug expression has been shown to suppress E-cadherin and to concomitantly upregulate N-cadherin expression (9,10). Moreover, Slug induces vimentin expression (11). Therefore, Slug regulates E-cadherin and N-cadherin, and vimentin expression.

Sphingosine kinase 1 (SphK1) is an oncogenic enzyme which promotes the transformation, proliferation and angiogenesis of a number of human tumors (12,13). Recent studies have indicated that SphK1 is involved in regulating the NF-κB pathways (14,15), AKT (16) and focal adhesion kinase (FAK) (17) in cancer. We wished to determine whether SphK1 potentially promotes the EMT process in CRC cells, as it has been previously shown to promote EMT in lung cancer cells (18).

To date, some researchers have discovered that FAK plays an important role in EMT and influences the expression of EMT-related makers (19–21). Thus, we hypothesized that SphK1 may affect metastasis, and the expression of Slug, E-cadherin, N-cadherin and vimentin via the FAK pathway in CRC cells. In order to confirm our hypothesis, in this study, we used various CRC cells, and we found indeed, that SphK1 modulates the expression of EMT-related markers by regulating the expression of p-FAK in CRC cells.

Materials and methods

Cell lines and cell culture

The human colorectal carcinoma cell lines, Caco2 (Boster, Wuhan, China), HT29, RKO and HCT116 (R&S Biotechnology Co., Ltd., Shanghai, China) were routinely cultured in DMEM containing 100 ml/l fetal bovine serum (FBS; ExCell Bio, Shanghai, China) and incubated at 37°C with 5% CO2.

Each of the cell lines was divided into 3 groups as follows: the control group (N group), the SKI-II (an inhibitor of SphK1) intervention group (SK group) and PF-562271 (an inhibitor of FAK) intervention group (PF group). The cells in the SK group were cultured for 24 h and then incubated with SKI-II (Selleck, Houston, TX, USA) at 20 µM (22) for 48 h. The cells in the PF group were also cultured for 24 h and then incubated with PF-562271 (Selleck) 5 µM (23) for 48 h.

Transwell chamber assay

The cells were cultured in serum-free medium to produce suspension, and the cell density was adjusted to 5×105/ml. Subsequently, 200 µl cell suspension were added to the upper chamber of the Transwell (Corning, Inc., Corning, NY, USA), while 600 µl medium including 10% FBS were added to the bottom chamber, followed by incubation for a period of 24 h at 37°C. The assay was terminated as a result of the removal of the medium from the upper well and the filter was fixed with methanol for 10 min. The cells in the upper chamber were wiped off and the cells migrating to the lower side of the upper chamber were stained with 0.1% crystal violet (Beyotime, Shanghai, China) for 30 min. Random fields were scanned (6 fields/filter) under a fluorescent inverted phase contrast microscope (magnification, ×200; TS100-F; Nikon, Tokyo, Japan) for the presence of the cells at the lower membrane side only.

RNA isolation, cDNA synthesis and quantitative PCR (qPCR)

RNA isolation was performed using a RNA extraction kit (Tiangen, Beijing, China) according to the manufacturer's instruction. cDNA synthesis was performed using a reverse transcription kit (Takara, Dalian, Japan). Fluorescence-based qPCR was performed using 2 µl of cDNA and SYBR-Green (Takara) in a total volume of 20 µl and using the ABI 7500 Real-time PCR system (Applied Biosystems, Rockford, IL, USA). The cycling parameters were: 95°C for 30 sec followed by 40 cycles at 95°C for 5 sec and 60°C for 34 sec, and a dissociation program that included 95°C for 15 sec, 60°C for 1 min,and 95°C for 15 sec ramping up at 0.2°C/sec. Gene expression levels were determined with the 2−ΔΔCq method using glyceraldehyde 3-phosphate dehydrogenase (GAPDH) as a reference and the non-stimulated condition was set to 1. The forward and reverse primers (Takara) of the genes are listed in Table I.

Table I

The primers used in this study.

Table I

The primers used in this study.

Gene name (protein name)Sequence primers (5′→3′)
GAPDH (GAPDH)F: GCACCGTCAAGGCTGAGAAC
R: TGGTGAAGACGCCAGTGGA
SPHK1 (SphK1)F: GGCTTCATTGCTGATGTGGA
R: AGGAAGGTGCCCAGAGTGAA
FAK (FAK)F: CAACCACCTGGGCCAGTATTATC
R: CCATAGCAGGCCACATGCTTTA
SLUG (Slug)F: TTTGCAAGATCTGCGGCAAG
R: CTGCAAATGCTCTGTTGCAGTG
VIM (vimentin)F: TGACATTGAGATTGCCACCTACAG
R: TCAACCGTCTTAATCAGAAGTGTCC
CDH2 (N-cadherin)F: AGCACAGTGGCCACCTACAAAG
R: CAGCTCCTGGCCCAGTTACA
CDH1 (E-cadherin)F: GAGTGCCAACTGGACCATTCAGTA
R: AGTCACCCACCTCTAAGGCCATC

[i] GAPDH, glyceraldehyde 3-phosphate dehydrogenase; SPHK1, sphingosine kinase 1; FAK, focal adhesion kinase.

Western blot analysis

The cells were collected using cell scrapers and lysed with RIPA lysis buffer supplemented with 1% protease and 1% phosphatase inhibitor for 30 min following 2 washes with cold phosphate-buffered saline (PBS). The cells were subjected to centrifugation at 12,000 × g/min for 15 min at 4°C to remove the cell debris. Protein concentrations were measured by bicinchoninic acid (BCA) assay (Solarbio, Beijing, China) according to the standard protocol.

Equal amounts of protein were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and then blotted onto 0.45 nitrocellulose membranes. The membranes were subsequently blocked in non-fat milk [dissolved in Tris-buffered saline with 5% Tween-20 (TBST)] buffer at room temperature for 30 min to block non-specific binding and incubated with antibodies diluted by western blot antibody diluents overnight at 4°C, and subsequently incubated with secondary fluorescent antibodies (IRDye® 680RD Goat anti-Rabbit 925-68071; C60329-11; dilution, 1:10,000; LI-COR Biosciences, Lincoln, NE, USA) for 1 h at room temperature following 3 washes with TBST. The membranes were scanned using an Odyssey infrared imaging system (LI-COR Biosciences). Relevant signal intensity was determined using LI-COR imaging software (LI-COR Biosciences). The strips were analyzed using Quantity One software (Bio-Rad, Shanghai, China). Antibodies against E-cadherin (3195S; 1:1,000) and p-FAK (Tyr397; 8556P; 1:1,000) were purchased from Cell Signaling Technology (CST, Beverly, MA, USA). Antibodies against SphK1 (10670-1-AP; 1:500), FAK (12636-1-AP; 1:1,000), Slug (12129-1-AP; 1:500), N-cadherin (66219-1-1g; 1:500), vimentin (10366-1-AP; 1:500) and GAPDH (10494-1-AP; 1:1,000) were purchased from Proteintech Group (PTG, Rosemont, IL, USA).

Statistical analysis

Each experiment was repeated at least 3 times. Data were presented as the means ± SD. The results of Transwell chamber assay and western blot analysis were analyzed using the t-test. The Mann-Whitney U test was used to analyze the results of PCR. Results were considered statistically significant at P<0.05.

Results

Suppression of SphK1 reduces the migratory ability of CRC cells

To examine the effect of SphK1 on the migration of human CRC cells, the cells were exposed to 20 µM SKI-II for 48 h, in order to inhibit SphK1 expression. The migrating cells were observed under an inverted microscope. The results revealed that the number of migrating cells in the SK group was significantly lower than that of the cells in the N group in all 4 CRC cell lines (P<0.05; Fig. 1), indicating that SphK1 plays an important role in CRC cell migration.

Figure 1

Sphingosine kinase 1 (SphK1) affects colorectal cancer cell migration. The suppression of SphK1 by SKI-II (20 µM) for 48 h (SK group) significantly decreased the number of cells penetrating through the porous membrane. (A) Caco2 cell line. (B) HT29 cell line. (C) RKO cell line. (D) HCT116 cell line. The images are representative of cell penetration (crystal violet staining, magnification, ×200) and the data are shown as the means ± SD (*P<0.05 vs. N group).

mRNA expression of SphK1, Slug, vimentin, N-cadherin and E-cadherin detected by fluorescence-based qPCR

In order to investigate the signaling pathways involved in the regulatory effects of SphK1 on the migratory abitlity of CRC cells, some EMT-related markers were examined in the present study. EMT is known to play a critical role in the metastasis of cancer cells (24,25). The mRNA expression of EMT-related makers was detected, including the expression of the transcription factor, Slug (26), the mesenchymal cell markers, vimentin and N-cadherin, and the epithelial cell marker, E-cadherin (27–29). As shown in Fig. 2, the mRNA levels of Slug, vimentin and N-cadherin decreased, whereas that of E-cadherin increased (P<0.05). This indicated that the suppression of SphK1 suppressed Slug, vimentin and N-cadherin gene expression, while it promoted E-cadherin gene expression.

Figure 2

Suppression of sphingosine kinase 1 (SphK1) by SKI-II 20 µM for 48 h (SK group) significantly decreased the mRNA levels of SphK1 (SPHK1), Slug (SLUG), vimentin (VIM), N-cadherin (CDH2), while it increased E-cadherin (CDH1) expression. GAPDH was used as a reference and the unstimulated control (N group) was set to 1. (A) Caco2 cell line. (B) HT29 cell line. (C) RKO cell line. (D) HCT116 cell line. The data were analyzed using the Mann-Whitney U test and are shown as the means ± SD (*P<0.05 vs. N group).

Protein expression of SphK1, Slug, vimentin, N-cadherin and E-cadherin detected by western blot analysis

The results revealed that the expression of Slug, vimentin and N-cadherin decreased, whereas that of E-cadherin increased following the suppression of SphK1 (P<0.05; Figs. 3 and 4). These results were consistent with those obtained by PCR.

Figure 3

Protein expression of sphingosine kinase 1 (SphK1), FAK, p-FAK, Slug, vimentin, N-cadherin, E-cadherin in Caco2, HT29, RKO, HCT116 cells. '−' indicates culture without SKI-II or PF-562271, while '+' indicates treatment with SKI-II 20 µM for 48h or PF-562271 5 µM for 48 h.

Figure 4

Relative protein expression levels of sphingosine kinase 1 (SphK1), Slug, vimentin, N-cadherin, E-cadherin. GAPDH was used as an internal control. (A) Caco2 cell line. (B) HT29 cell line. (C) RKO cell line. (D) HCT116 cell line. The data were analyzed by the t-test and are shown as the means ± SD (*P<0.05, SK group vs. N group).

SphK1 is involved in modulating the expression of p-FAK

Compared to the N group, although in the SK group FAK mRNA and total FAK protein expression exhibited no significant difference (P>0.05; Fig. 5B and D), p-FAK protein expression was markedly decreased (P<0.05; Figs. 3 and 5E). This indicated that SphK1 regulated the expression of p-FAK, suggesting that SphK1 is involved in modulating the FAK pathway.

Figure 5

(A and B) The mRNA expression of sphingosine kinase 1 (SphK1) and FAK was detected by fluorescence-based quantitative PCR. GAPDH was used as a reference and the unstimulated control (N group) was set to 1. The data were analyzed using the Mann-Whitney U test. (C–E) Relative protein expression levels of SphK1, FAK, p-FAK. GAPDH was used as an internal control. The data were analyzed using the t-test. All data are shown as the means ± SD (*P<0.05 vs. N group).

Inhibition of FAK affects the migratory ability, and the mRNA and protein expression of Slug, vimentin, N-cadherin and E-cadherin in CRC cells

To date, some researchers have demonstrated that FAK is involved in regulating the EMT process in cancer cells (30). Moreover, FAK affects the expression of Slug (31). In this study, our results revealed that the numbers of migrating cells in the PF group were lower than those in the N group in the Caco2, HT29, RKO and HCT116 cells (P<0.05; Fig. 1 and 6A). In addition, compared with the N group, the mRNA expression levels of FAK, Slug, vimentin and N-cadherin in the PF group were decreased, whereas the mRNA expression level of E-cadherin was increased (P<0.05; Fig. 6B). Moreover, the protein expression levels of FAK, p-FAK, Slug, vimentin and N-cadherin in the PF group were lower than the levels in the N group (P<0.05; Figs. 3 and 6C). Similar with the mRNA expression, the protein expression of E-cadherin in the PF group was higher than that in the N group (P<0.05; Figs. 3 and 6C). Thus, the results revealed that FAK may affect the mRNA and protein expression levels of Slug, vimentin, N-cadherin and E-cadherin, as well as the cell migratory ability.

Figure 6

Effects of FAK inhibition of the expression of epithelial-mesenchymal transition (EMT)-related markers. PF group indicates the suppression of FAK by PF-562271 at 5 µM for 48 h. (A) Cell migratory ability was examined by Transwell chamber assay (the N group is shown in Fig. 1). The data were analyzed using the t-test. (B) The mRNA expression of FAK and EMT-related markers was detected by fluorescence-based qPCR. GAPDH was used as a reference and the N group was set to 1. The PCR data were analyzed using the Mann-Whitney U test. (C) Relative protein expression levels of FAK, p-FAK and EMT-related markers. GAPDH was used as an internal control. The data were analyzed using the t-test. (a) Caco2 cell line. (b) HT29 cell line. (c) RKO cell line. (d) HCT116 cell line. All data are shown as the means ± SD (*P<0.05, PF group vs. N group).

On the whole, according to our data, it can be suggested that SphK1 modulates the expression of Slug, E-cadherin, N-cadherin and vimentin, as well as CRC cell metastasis by regulating the expression of p-FAK in Caco2, HT29, RKO, HCT116 CRC cell lines.

Discussion

SphK1 is a lipid kinase which catalyzes the phosphorylation of sphingosine to S1P. There is evidence to indicate that SphK1 is an oncogenic enzyme, and its activation is closely associated with the transformation, proliferation and survival of tumor cells (32). In a previous study, SphK1 was shown to be overexpressed in colon cancer tissue compared with normal colonic tissue. In addition, the expression of SphK1 was found to correlate with the Dukes' stage, histological grading, lymphnode metastasis and distant metastasis. These data indicate that SphK1 may contribute to the metastasis and the malignant phenotype of colon cancer (17).

EMT has been confirmed to be an important step in metastasis and in the change to the malignant phenotype. After EMT has occurred in the cell, cell migratory ability increases, along with an increase in the expression of mesenchymal cell surface markers, and a decrease in the expression of epithelial cell surface markers and vice versa (33–35). Slug is one of the important transcription factors of EMT (26,36). E-cadherin is the molecular marker of epithelial cells (27–29). N-cadherin and vimentin are molecular markers of mesenchymal cells. In a word, they are all indispensable biological markers in the process of EMT. However, it is not yet clear whether SphK1 modulates the expression of EMT-related markers, though SphK1 may contribute to metastasis and to the change to the malignant phenotype.

A previous study demonstrated that the silencing of SphK1 decreased the expression of vimentin and enhanced the expression of E-cadherin in non-small cell lung cancer. Regretfully, Slug and N-cadherin expression was not detected (18). In the present study, the expression of Slug, N-cadherin and vimentin was decreased, whereas that of E-cadherin was increased following the inhibition of SphK1. These results indicate that SphK1 plays a role in regulating the EMT process. Moreover, the migratory ability of CRC cells was found to weaken following the inhibition of the expression of SphK1, which is consistent with the findings of other researchers (37). Thus, SphK1 may regulate cell migration and the EMT process in CRC cells.

However, it is also important to determine the potential mechanism behind the modulatory effects of SphK1 on the expression of EMT-related markers. It was previously found that the FAK pathway is involved in the SphK1-mediated acquisition of the malignant phenotype in colon cancer cells (17). FAK is a 125 kDa non-receptor protein tyrosine kinase that has been shown to be important in the tumorigenesis and development of human tumors (38). Studies have suggested that the FAK pathway positively participates in the EMT process, which is accompanied by a decrease in the expression of E-cadherin, and an increase in the expression of Slug, N-cadherin and vimentin (32,39,40). In our study, the expression of E-cadherin increased, while the expression of Slug, N-cadherin and vimentin decreased following the suppression of FAK. This study also confirmed that the inhibition of SphK1 suppressed the expression of p-FAK in the CRC cell lines, Caco2, HT29, RKO and HCT116, suggesting that SphK1 may be involved in the modulation of the FAK pathway in CRC cells. On the other hand, the results revealed that the inhibition of SphK1 and FAK expression using specific inhibitors had similar effects on the cell migratory ability and on the expression of EMT-related markers. This suggests that SphK1 modulates the EMT process and cell migration by regulating the expression of p-FAK in CRC cells.

In conclusion, in this study, we demonstrated that SphK1 modulated the expression of EMT-related markers and cell migration by regulating the expression of p-FAK in the CRC cell lines, Caco2, HT29, RKO and HCT116. Our results provide evidence of the functional role of SphK1 in mediating the EMT process in colon cancer. Thus, SphK1 may be a promising therapeutic target in CRC.

Acknowledgments

This study was supported in part by grants from the National Nature Science Foundation of China (nos. 81260365 and 81460380), and the Nature Science Foundation of Guangxi (no. 2013GXNSFAA019159).

References

1 

American Cancer Society: Cancer Facts & Figures 2015. Atlanta: American Cancer Society; 2015, https://www.cancer.org/research/cancer-facts-statistics.html.

2 

Xie J, Dong H, Chen H, Zhao R, Sinko PJ, Shen W, Wang J, Lu Y, Yang X, Xie F, et al: Exploring cancer metastasis prevention strategy: Interrupting adhesion of cancer cells to vascular endothelia of potential metastatic tissues by antibody-coated nanomaterial. J Nanobiotechnology. 13:92015. View Article : Google Scholar : PubMed/NCBI

3 

Arvelo F, Sojo F and Cotte C: Cancer and the metastatic substrate. Ecancermedicalscience. 10:7012016. View Article : Google Scholar

4 

Xu J, Qin X, Wang J, Zhang S, Zhong Y, Ren L, Wei Y, Zeng S, Wan D and Zheng S; Society of Surgery; Chinese Medical Association; Committee of Colorectal Cancer, Chinese Anticancer Association: Chinese guidelines for the diagnosis and comprehensive treatment of hepatic metastasis of colorectal cancer. J Cancer Res Clin Oncol. 137:1379–1396. 2011. View Article : Google Scholar : PubMed/NCBI

5 

Liu Y, Wang G, Yang Y, Mei Z, Liang Z, Cui A, Wu T, Liu CY and Cui L: Increased TEAD4 expression and nuclear localization in colorectal cancer promote epithelial-mesenchymal transition and metastasis in a YAP-independent manner. Oncogene. 35:2789–2800. 2015. View Article : Google Scholar : PubMed/NCBI

6 

Ma H, Gao L, Li S, Qin J, Chen L, Liu X, Xu P, Wang F, Xiao H, Zhou S, et al: CCR7 enhances TGF-β1-induced epithelial-mesenchymal transition and is associated with lymph node metastasis and poor overall survival in gastric cancer. Oncotarget. 6:24348–24360. 2015. View Article : Google Scholar : PubMed/NCBI

7 

Atmaca A, Wirtz RW, Werner D, Steinmetz K, Claas S, Brueckl WM, Jäger E and Al-Batran SE: SNAI2/SLUG and estrogen receptor mRNA expression are inversely correlated and prognostic of patient outcome in metastatic non-small cell lung cancer. BMC Cancer. 15:3002015. View Article : Google Scholar : PubMed/NCBI

8 

Yuan H, Kajiyama H, Ito S, Chen D, Shibata K, Hamaguchi M, Kikkawa F and Senga T: HOXB13 and ALX4 induce SLUG expression for the promotion of EMT and cell invasion in ovarian cancer cells. Oncotarget. 6:13359–13370. 2015. View Article : Google Scholar : PubMed/NCBI

9 

Palma-Nicolás JP and López-Colomé AM: Thrombin induces slug-mediated E-cadherin transcriptional repression and the parallel upregulation of N-cadherin by a transcription-independent mechanism in RPE cells. J Cell Physiol. 228:581–589. 2013. View Article : Google Scholar

10 

Xie Y, Liu S, Lu W, Yang Q, Williams KD, Binhazim AA, Carver BS, Matusik RJ and Chen Z: Slug regulates E-cadherin repression via p19Arf in prostate tumorigenesis. Mol Oncol. 8:1355–1364. 2014. View Article : Google Scholar : PubMed/NCBI

11 

Vuoriluoto K, Haugen H, Kiviluoto S, Mpindi JP, Nevo J, Gjerdrum C, Tiron C, Lorens JB and Ivaska J: Vimentin regulates EMT induction by Slug and oncogenic H-Ras and migration by governing Axl expression in breast cancer. Oncogene. 30:1436–1448. 2011. View Article : Google Scholar

12 

Xia J, Wu Z, Yu C, He W, Zheng H, He Y, Jian W, Chen L, Zhang L and Li W: miR-124 inhibits cell proliferation in gastric cancer through downregulation of SPHK1. J Pathol. 227:470–480. 2012. View Article : Google Scholar : PubMed/NCBI

13 

Pan J, Tao YF, Zhou Z, Cao BR, Wu SY, Zhang YL, Hu SY, Zhao WL, Wang J, Lou GL, et al: An novel role of sphingosine kinase-1 (SPHK1) in the invasion and metastasis of esophageal carcinoma. J Transl Med. 9:1572011. View Article : Google Scholar : PubMed/NCBI

14 

Zhang Z, Yan Z, Yuan Z, Sun Y, He H and Mai C: SPHK1 inhibitor suppresses cell proliferation and invasion associated with the inhibition of NF-κB pathway in hepatocellular carcinoma. Tumour Biol. 36:1503–1509. 2015. View Article : Google Scholar

15 

Chen K, Pan Q, Gao Y, Yang X, Wang S, Peppelenbosch MP and Kong X: DMS triggers apoptosis associated with the inhibition of SPHK1/NF-κB activation and increase in intracellular Ca2+ concentration in human cancer cells. Int J Mol Med. 33:17–24. 2014.

16 

Xiong H, Wang J, Guan H, Wu J, Xu R, Wang M, Rong X, Huang K, Huang J, Liao Q, et al: SphK1 confers resistance to apoptosis in gastric cancer cells by downregulating Bim via stimulating Akt/FoxO3a signaling. Oncol Rep. 32:1369–1373. 2014.PubMed/NCBI

17 

Liu SQ, Su YJ, Qin MB, Mao YB, Huang JA and Tang GD: Sphingosine kinase 1 promotes tumor progression and confers malignancy phenotypes of colon cancer by regulating the focal adhesion kinase pathway and adhesion molecules. Int J Oncol. 42:617–626. 2013.

18 

Ni M, Shi XL, Qu ZG, Jiang H, Chen ZQ and Hu J: Epithelial mesenchymal transition of non-small-cell lung cancer cells A549 induced by SPHK1. Asian Pac J Trop Med. 8:142–146. 2015. View Article : Google Scholar : PubMed/NCBI

19 

Golubovskaya VM: Targeting FAK in human cancer: From finding to first clinical trials. Front Biosci (Landmark Ed). 19:687–706. 2014. View Article : Google Scholar

20 

Wilson C, Nicholes K, Bustos D, Lin E, Song Q, Stephan JP, Kirkpatrick DS and Settleman J: Overcoming EMT-associated resistance to anti-cancer drugs via Src/FAK pathway inhibition. Oncotarget. 5:7328–7341. 2014. View Article : Google Scholar : PubMed/NCBI

21 

Kuo TC, Tan CT, Chang YW, Hong CC, Lee WJ, Chen MW, Jeng YM, Chiou J, Yu P, Chen PS, et al: Angiopoietin-like protein 1 suppresses SLUG to inhibit cancer cell motility. J Clin Invest. 123:1082–1095. 2013. View Article : Google Scholar : PubMed/NCBI

22 

Gassowska M, Cieslik M, Wilkaniec A and Strosznajder JB: Sphingosine kinases/sphingosine-1-phosphate and death Signalling in APP-transfected cells. Neurochem Res. 39:645–652. 2014. View Article : Google Scholar : PubMed/NCBI

23 

Crompton BD, Carlton AL, Thorner AR, Christie AL, Du J, Calicchio ML, Rivera MN, Fleming MD, Kohl NE, Kung AL, et al: High-throughput tyrosine kinase activity profiling identifies FAK as a candidate therapeutic target in Ewing sarcoma. Cancer Res. 73:2873–2883. 2013. View Article : Google Scholar : PubMed/NCBI

24 

Li X, Gao D, Wang H, Li X, Yang J, Yan X, Liu Z and Ma Z: Negative feedback loop between p66Shc and ZEB1 regulates fibrotic EMT response in lung cancer cells. Cell Death Dis. 6:e17082015. View Article : Google Scholar : PubMed/NCBI

25 

Tiwari N, Gheldof A, Tatari M and Christofori G: EMT as the ultimate survival mechanism of cancer cells. Semin Cancer Biol. 22:194–207. 2012. View Article : Google Scholar : PubMed/NCBI

26 

Li Y, Zhao Z, Xu C, Zhou Z, Zhu Z and You T: HMGA2 induces transcription factor Slug expression to promote epithelial-to-mesenchymal transition and contributes to colon cancer progression. Cancer Lett. 355:130–140. 2014. View Article : Google Scholar : PubMed/NCBI

27 

Rogers CD, Saxena A and Bronner ME: Sip1 mediates an E-cadherin-to-N-cadherin switch during cranial neural crest EMT. J Cell Biol. 203:835–847. 2013. View Article : Google Scholar : PubMed/NCBI

28 

Zhang X, Liu G, Kang Y, Dong Z, Qian Q and Ma X: N-cadherin expression is associated with acquisition of EMT phenotype and with enhanced invasion in erlotinib-resistant lung cancer cell lines. PLoS One. 8:e576922013. View Article : Google Scholar : PubMed/NCBI

29 

da Silva SD, Morand GB, Alobaid FA, Hier MP, Mlynarek AM, Alaoui-Jamali MA and Kowalski LP: Epithelial-mesenchymal transition (EMT) markers have prognostic impact in multiple primary oral squamous cell carcinoma. Clin Exp Metastasis. 32:55–63. 2015. View Article : Google Scholar

30 

Taliaferro-Smith L, Oberlick E, Liu T, McGlothen T, Alcaide T, Tobin R, Donnelly S, Commander R, Kline E, Nagaraju GP, et al: FAK activation is required for IGF1R-mediated regulation of EMT, migration, and invasion in mesenchymal triple negative breast cancer cells. Oncotarget. 6:4757–4772. 2015. View Article : Google Scholar : PubMed/NCBI

31 

John JK, Paraiso KH, Rebecca VW, Cantini LP, Abel EV, Pagano N, Meggers E, Mathew R, Krepler C, Izumi V, et al: GSK3β inhibition blocks melanoma cell/host interactions by downregulating N-cadherin expression and decreasing FAK phosphorylation. J Invest Dermatol. 132:2818–2827. 2012. View Article : Google Scholar : PubMed/NCBI

32 

Datta A, Loo SY, Huang B, Wong L, Tan SS, Tan TZ, Lee SC, Thiery JP, Lim YC, Yong WP, et al: SPHK1 regulates proliferation and survival responses in triple-negative breast cancer. Oncotarget. 5:5920–5933. 2014. View Article : Google Scholar : PubMed/NCBI

33 

Huo C, Kao YH and Chuu CP: Androgen receptor inhibits epithelial-mesenchymal transition, migration, and invasion of PC-3 prostate cancer cells. Cancer Lett. 369:103–111. 2015. View Article : Google Scholar : PubMed/NCBI

34 

Cheng G, Liu C, Sun X, Zhang L, Liu L, Ouyang J and Li B: Visfatin promotes osteosarcoma cell migration and invasion via induction of epithelial-mesenchymal transition. Oncol Rep. 34:987–994. 2015.PubMed/NCBI

35 

Räsänen K and Vaheri A: TGF-beta1 causes epithelial-mesenchymal transition in HaCaT derivatives, but induces expression of COX-2 and migration only in benign, not in malignant keratinocytes. J Dermatol Sci. 58:97–104. 2010. View Article : Google Scholar : PubMed/NCBI

36 

Lamouille S, Xu J and Derynck R: Molecular mechanisms of epithelial-mesenchymal transition. Nat Rev Mol Cell Biol. 15:178–196. 2014. View Article : Google Scholar : PubMed/NCBI

37 

Chen MB, Yang L, Lu PH, Fu XL, Zhang Y, Zhu YQ and Tian Y: MicroRNA-101 downregulates sphingosine kinase 1 in colorectal cancer cells. Biochem Biophys Res Commun. 463:954–960. 2015. View Article : Google Scholar : PubMed/NCBI

38 

Stewart JE, Ma X, Megison M, Nabers H, Cance WG, Kurenova EV and Beierle EA: Inhibition of FAK and VEGFR-3 binding decreases tumorigenicity in neuroblastoma. Mol Carcinog. 54:9–23. 2015. View Article : Google Scholar :

39 

Hsieh YS, Chu SC, Hsu LS, Chen KS, Lai MT, Yeh CH and Chen PN: Rubus idaeus L. reverses epithelial-to-mesenchymal transition and suppresses cell invasion and protease activities by targeting ERK1/2 and FAK pathways in human lung cancer cells. Food Chem Toxicol. 62:908–918. 2013. View Article : Google Scholar : PubMed/NCBI

40 

Chen KS, Shi MD, Chien CS and Shih YW: Pinocembrin suppresses TGF-β1-induced epithelial-mesenchymal transition and metastasis of human Y-79 retinoblastoma cells through inactivating αvβ3 integrin/FAK/p38α signaling pathway. Cell Biosci. 4:412014. View Article : Google Scholar

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Xu C, Liu S, Qin M, Zhuge C, Qin L, Qin N, Lai M and Huang J: SphK1 modulates cell migration and EMT-related marker expression by regulating the expression of p-FAK in colorectal cancer cells. Int J Mol Med 39: 1277-1284, 2017.
APA
Xu, C., Liu, S., Qin, M., Zhuge, C., Qin, L., Qin, N. ... Huang, J. (2017). SphK1 modulates cell migration and EMT-related marker expression by regulating the expression of p-FAK in colorectal cancer cells. International Journal of Molecular Medicine, 39, 1277-1284. https://doi.org/10.3892/ijmm.2017.2921
MLA
Xu, C., Liu, S., Qin, M., Zhuge, C., Qin, L., Qin, N., Lai, M., Huang, J."SphK1 modulates cell migration and EMT-related marker expression by regulating the expression of p-FAK in colorectal cancer cells". International Journal of Molecular Medicine 39.5 (2017): 1277-1284.
Chicago
Xu, C., Liu, S., Qin, M., Zhuge, C., Qin, L., Qin, N., Lai, M., Huang, J."SphK1 modulates cell migration and EMT-related marker expression by regulating the expression of p-FAK in colorectal cancer cells". International Journal of Molecular Medicine 39, no. 5 (2017): 1277-1284. https://doi.org/10.3892/ijmm.2017.2921
Copy and paste a formatted citation
x
Spandidos Publications style
Xu C, Liu S, Qin M, Zhuge C, Qin L, Qin N, Lai M and Huang J: SphK1 modulates cell migration and EMT-related marker expression by regulating the expression of p-FAK in colorectal cancer cells. Int J Mol Med 39: 1277-1284, 2017.
APA
Xu, C., Liu, S., Qin, M., Zhuge, C., Qin, L., Qin, N. ... Huang, J. (2017). SphK1 modulates cell migration and EMT-related marker expression by regulating the expression of p-FAK in colorectal cancer cells. International Journal of Molecular Medicine, 39, 1277-1284. https://doi.org/10.3892/ijmm.2017.2921
MLA
Xu, C., Liu, S., Qin, M., Zhuge, C., Qin, L., Qin, N., Lai, M., Huang, J."SphK1 modulates cell migration and EMT-related marker expression by regulating the expression of p-FAK in colorectal cancer cells". International Journal of Molecular Medicine 39.5 (2017): 1277-1284.
Chicago
Xu, C., Liu, S., Qin, M., Zhuge, C., Qin, L., Qin, N., Lai, M., Huang, J."SphK1 modulates cell migration and EMT-related marker expression by regulating the expression of p-FAK in colorectal cancer cells". International Journal of Molecular Medicine 39, no. 5 (2017): 1277-1284. https://doi.org/10.3892/ijmm.2017.2921
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team