Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Molecular Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1107-3756 Online ISSN: 1791-244X
Journal Cover
December-2017 Volume 40 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
December-2017 Volume 40 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Angiogenic effects of apigenin on endothelial cells after hypoxia-reoxygenation via the caveolin-1 pathway

  • Authors:
    • Fengxia Tu
    • Qiongyi Pang
    • Xiang Chen
    • Tingting Huang
    • Meixia Liu
    • Qiongxiang Zhai
  • View Affiliations / Copyright

    Affiliations: Southern Medical University, Guangzhou, Guangdong 510515, P.R. China, Department of Pediatrics, Second Affiliated Hospital and Yuying Children's Hospital of Wenzhou Medical University, Wenzhou, Zhejiang 325000, P.R. China
    Copyright: © Tu et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 1639-1648
    |
    Published online on: September 28, 2017
       https://doi.org/10.3892/ijmm.2017.3159
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

In the present study, we aimed to elucidate whether apigenin contributes to the induction of angiogenesis and the related mechanisms in cell hypoxia-reoxygenation injury. The role of apigenin was examined in human umbilical vein endothelial cell (HUVEC) viability, migration and tube formation in vitro. To investigate the related mechanisms, we used caveolin-1 short interfering RNA. The viability of HUVECs was measured using Cell Counting Kit-8 assays, HUVEC migration was analyzed by crystal violet staining, and a tube formation assay was performed using the branch point method. Expression of caveolin-1, vascular endothelial growth factor (VEGF), and endothelial nitric oxide synthase (eNOS) in HUVECs was examined by polymerase chain reaction and western blotting. Our data revealed that apigenin induced angiogenesis in vitro by increasing the tube formation ability of HUVECs, which was counteracted by caveolin-1 silencing. Compared to the NC group, Caveolin-1 and eNOS expression was upregulated by apigenin, whereas compared to the NC group, eNOS expression was increased upon caveolin-1 silencing. The expression of VEGF was increased by treatment with apigenin; however, compared to the NC group, caveolin-1 silencing did not affect VEGF expression, and apigenin did not increase VEGF expression in HUVECs after caveolin-1 silencing. These data suggest that apigenin may be a candidate therapeutic target for stroke recovery by promoting angiogenesis via the caveolin-1 signaling pathway.

Introduction

Recent studies have suggested that angiogenesis in the ischemic penumbra area may play a crucial role in neural protection and tissue recovery. Angiogenesis is an important structural adaptation to increase vascular perfusion, sprouting, cell proliferation, migration and maturation (1,2). Numerous regulatory angiogenic factors have been identified, and their molecular modulations are associated with several angiogenic disorders (3,4). Vascular endothelial growth factor (VEGF) and nitric oxide (NO) from activated endothelial nitric oxide synthase (eNOS) are key regulators of normal and pathological angiogenesis (5,6). The survey and development of new agents, which promote angiogenesis via growth factors, have become a focus of therapeutic strategies for ischemic diseases (7).

Caveolin-1, a coat protein of caveolae, is involved in many signaling pathways and functions of endothelial cells (8,9). The caveolin-1 signaling pathway is widely known for its role in regulating cellular functions, including signal transduction, endocytosis, transcytosis, molecular transport, embryonic vessel development, normal tissue growth, and wound healing, as well as pathological processes such as ischemia and tumor growth (10,11). The importance of caveolin-1 has been confirmed in endothelial cells during angiogenesis. Gao et al (12) found that caveolin-1 and VEGF expression induced by treadmill exercise after middle cerebral artery occlusion was consistent with the good neurological outcomes of decreased infarct volumes and increased microvessel densities. In addition, the expression of VEGF could be significantly inhibited by a caveolin-1 inhibitor. Caveolin-1 overexpression has been reported to enhance endothelial capillary tubule formation (13). Despite a number of studies on the involvement of caveolin-1 in VEGF-stimulated angiogenesis, whether caveolin-1 is a stimulator or inhibitor of angiogenesis is still controversial. Thus, further studies are needed to identify the mechanism by which caveolin-1 regulates VEGF. eNOS localized to the inner leaflet of caveolar membranes and in the Golgi of endothelial cells is believed to be maintained in an inactive state owing to a direct interaction with caveolin-1 (14,15). It has been documented that decreasing the association of caveolin-1 with eNOS results in activation of eNOS (16,17). However, the mechanism of caveolin-1-mediated inhibition of eNOS activation is unclear. Regulation of eNOS by caveolin-1 is an important physiological mechanism to control vascular reactivity.

Apigenin is a naturally occurring flavonoid that has a variety of pharmacological activities, mainly including antitumor, anti-oxidative stress, and anti-DNA damage activities (18). Furthermore, apigenin has vasorelaxing and anti-platelet properties that may reduce the risk of coronary heart disease and improve endothelial functions (19–21). Even though apigenin has potential effects on both endothelial cells and neurons, it is unclear whether there is an effect on the promotion of angiogenesis and the underlying mechanisms. Nevertheless, recent data have indicated that apigenin inhibits VEGF expression and tumor angiogenesis (22,23). However, normal cells and cancer cells have different characteristics, and the potential effects of apigenin on the expression of VEGF have not been clarified in a normal biological system. We previously demonstrated that treatment of rats with apigenin after stroke enhanced the expression of both VEGF and caveolin-1 at the brain-infarct border zone, and that caveolin-1 expression correlates with improved functional recovery (24,25). However, we have not further explored the angiogenic effect of apigenin.

These findings suggest that caveolin-1 may also be involved in apigenin-induced angiogenesis after hypoxia-reoxygenation (HR) of human umbilical vein endothelial cells (HUVECs). To test this hypothesis and explore the mechanisms involved in apigenin-induced angiogenesis, we determined the effects of apigenin on the caveolin-1-dependent signaling pathway upon caveolin-1 silencing, as well as the expression of VEGF and eNOS in vitro. This study may provide the basis for the novel therapeutic management of stroke by angiogenesis.

Materials and methods

Chemicals, reagents and culture medium

Apigenin (≥99% pure) was purchased from Sigma-Aldrich (St. Louis, MO, USA). It was diluted in dimethyl sulfoxide purchased from Sigma-Aldrich at a final concentration of 40 mM. HUVECs were purchased from the Cell Bank of the Chinese Academy of Sciences. Dulbecco's modified Eagle's medium (DMEM) was purchased from Gibco (Thermo Fisher Scientific, Waltham, MA, USA). Fetal bovine serum (FBS) was purchased from Biosun Biotech (Shanghai, China). Phosphate-buffered saline was purchased from Yuanpei (Shanghai, China). Trypsin was purchased from Boguang Biotech (Shanghai, China). Trizol was purchased from Takara Bio (Dalian, China). Glutamine was purchased from Amresco (Solon, OH, USA). Reverse transcriptase was purchased from Fermentas China (Shanghai, China). Anti-caveolin-1 (ab2910) and -eNOS (ab199956) antibodies were obtained from Abcam (Cambridge, MA, USA). An anti-VEGF antibody (sc-1876) was obtained from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, USA). SYBR-Green Mix was purchased from Dongsheng Biotech (Guangzhou, China). Transwells were purchased from Corning, Inc. (Corning, NY, USA). Crystal violet was purchased from Genmed Scientifics Inc. (Shanghai, China).

Cell culture and HR injury

HUVECs were cultured in DMEM containing 10% FBS, 1% penicillin/streptomycin and 1% glutamine. For exposure to hypoxia, the HUVECs were incubated in 1% O2 plus 5% CO2 balanced with N2 for 0, 2 and 6 h. Following exposur to hypoxia, the cells were returned to a standard incubator with the normoxic condition of humidified air with 5% CO2 for 24 and 48 h. Zero hours was defined as the onset after cells were exposed to hypoxia.

Cell viability assay

Cell viability was measured by the Cell Counting Kit-8 (CCK-8) assay (Dojindo Laboratories, Kumamoto, Japan) as described previously (26). Briefly, HUVECs were subcultured in a 96-well plate at 5×103 cells/well in DMEM. Then, the cells were treated with increasing concentrations of apigenin (10, 20, 50 and 80 µM). After hypoxia for 6 h and oxygenation for 24 h, 10 µl CCK-8 solution was added to each well. After incubation for 2 h at 37°C in the dark, the absorbance was measured at 450 nm using a Multiskan MK3 microplate reader (Thermo Labsystems, Paris, France). Cells cultured in serum-free DMEM were used as a background control. The absorbance for each apigenin concentration alone in serum-free DMEM and CCK-8 solution was also measured at 450 nm. The appropriate concentration was chosen for the following experiment. The cell viabilities of four groups (NC, NC + apigenin, caveolin-1-KD and caveolin-1-KD + apigenin) were tested at 1, 2, 3, 4, 5 and 6 days after treatment with apigenin, caveolin-1 short interfering RNA (siRNA), or negative control siRNA. The NC group was the negative control group. The NC + apigenin group was the negative control treated with apigenin. The caveolin-1-KD group was subjected to caveolin-1 silencing. The caveolin-1-KD + apigenin group was subjected to caveolin-1 silencing and treatment with apigenin. Cell viability was calculated using the following formula: cell viability (%) = (ODsample − ODbackground)/(ODcontrol − ODbackground) ×100%, where ODcontrol and ODsample are the optical density (OD) of the negative control and apigenin-treated groups, respectively. The absorbance was directly correlated with the number of metabolically active HUVECs. All conditions were measured in at least three independent experiments. Data analysis was performed in a blinded manner.

Caveolin-1 siRNA generation and transduction

Caveolin-1 was silenced in the HUVECs by lentiviral siRNA transfection. The lentiviral vectors for caveolin-1 and control siRNAs were obtained from R&S Biotechnology Co., Ltd. (Shanghai China). Briefly, caveolin-1 was amplified and subcloned into the pcDNA6.2 vector with the enhanced green fluorescent protein (EGFP) gene, and then EGFP-caveolin-1 was cloned into the pLenti6.3-MCS/V5 DEST vector. The resulting plasmid was analyzed and verified by gel electrophoresis and sequencing. To obtain lentiviruses, 293T cells were co-transfected with caveolin-1 or control siRNA lentivirus expression plasmids and a packaging plasmid mix (Invitrogen; Thermo Fisher Scientific Inc.) using POLOdeliverer™ 3000 transfection reagent (Ruisai Inc., Shanghai, China) according to the instructions provided by the manufacturer. Following lentivirus infection for 48 h, HUVECs transduced with fluorescently tagged proteins were selected and verified by fluorescence microscopy. The cells were applied to the following experiments.

Transwell migration assay

The bottom chambers of Transwells were filled with DMEM and the top chambers were seeded with HUVECs transfected with siRNA for 72 h and then treated with 10 µM apigenin, hypoxia for 6 h, and reoxygenation 24 h. Cells on the top surface of the membrane (non-migrated cells) were removed with a cotton swab, and cells that had migrated onto the bottom sides of the membrane were fixed in 4% paraformaldehyde and stained with 2% crystal violet. The absorbance was measured at 570 nm using a Multiskan MK3 microplate reader. The OD value indicated the number of migrated cells. Each experiment was performed in triplicate. All data analysis was performed in a blinded manner.

Tube formation assay

An endothelial cell tube formation assay is a useful indicator of angiogenesis potential. In the present study, the tube formation assay was performed using the branch point method (27). In brief, HUVECs (5×104/well) were seeded onto a 96-well plate pre-coated with Matrigel (50 µl) and cultured at 37°C in a 5% CO2 incubator. The formed network of tubes was visualized at ×100 magnification by light microscopy. The number of branch points was counted to calculate the branch point density. Each experiment was performed in triplicate. All data analysis was performed in a blinded manner.

Quantitative polymerase chain reaction (qPCR) analysis of caveolin-1

Gene expression was measured by qPCR in endothelial cells harvested after treatments. qPCR was performed to investigate the expression of caveolin-1. Total RNA was isolated and purified using TRIzol® Plus RNA purification kit (Takara Bio), according to the manufacturer's instructions. RNA was reverse transcribed into cDNA that was utilized as a template in the subsequent qPCR amplifications using a SYBR-Green Mix kit (Dongsheng Biotech). The qPCR primers included: caveolin-1 (forward, CGCAGGGACATCTCTACACC and reverse, CTTCCAAATGCCGTCAAAAC, 233 bp). Each experiment was repeated at least three times.

Western blot analysis of caveolin-1, VEGF and eNOS levels

Cells subjected to various treatments were lysed in lysis buffer. Equal amounts of total proteins were separated on sodium dodecyl sulfate polyacrylamide gels (caveolin-1, 12%; VEGF, 10%; eNOS, 8%) and then electrophoretically transferred to a polyvinylidene difluoride membrane. The membrane was blocked with 5% dry skim milk for 1 h, incubated with anti-caveolin-1 (1:800), anti-VEGF (1:200), and anti-eNOS (1:500) antibodies at 4°C overnight, and then incubated with HRP-labeled goat anti-rabbit antibody (1:3,000; A0208, Beyotime Biotech, Jiangsu, China) for 1 h. Labeled proteins were detected using an enhanced chemiluminescence detection kit. The relative quantity of proteins was analyzed using Quantity One software and normalized to the loading control. Each experiment was repeated at least three times.

Statistical analyses

Data are presented as the mean ± standard error of the mean (SEM). The results were analyzed by SPSS 20.0 software (SPSS Inc. Chicago, IL, USA). Mean values were derived from at least three independent experiments. Statistical comparisons between experimental groups were performed by one-way analysis of variance. The level of statistical significance was set at P<0.05.

Results

Determination of optimal durations for HR

To determine appropriate durations for HR, HUVECs were subjected to HR for various times, and then expression of caveolin-1, VEGF and eNOS was assessed by qPCR and western blotting. The results showed that the mRNA expression levels of caveolin-1, VEGF, and eNOS at 6 h of hypoxia were lower than those at 0 h. After 48 h of reoxygenation, the mRNA expression of caveolin-1, VEGF, and eNOS was recovered for any duration of hypoxia (Fig. 1A). The protein expression of caveolin-1 declined slightly, but the expression of VEGF and eNOS increased during hypoxia for 6 h and reoxygenation for 24 h, indicating that the protein expression was not consistent with the mRNA expression. After 48 h of reoxygenation for any duration of hypoxia, expression was restored for all three proteins (Fig. 1B). Cell viability was markedly decreased and cell necrosis was increased by hypoxia for 6 h and reoxygenation for 24 h (Fig. 1C). Considering these results, we induced hypoxia for 6 h and reoxygenation for 24 h in further experiments.

Figure 1

Expression of caveolin-1, vascular endothelial growth factor (VEGF), and endothelial nitric oxide synthase (eNOS) in human umbilical vein endothelial cells (HUVECs) after various durations of hypoxia-reoxygenation (HR). Cells were incubated under hypoxic conditions (1% O2) for 0, 2 or 6 h and then reoxygenated for 24 or 48 h. (A) RT-PCR analysis of caveolin-1, VEGF and eNOS in HUVECs. mRNA expression of caveolin-1, VEGF and eNOS was decreased after hypoxia for 6 h and reoxygenation for 24 h. The mRNA expression of caveolin-1, VEGF and eNOS was restored after reoxygenation for 48 h compared with reoxygenation for 24 h. (B) Western blot analysis of caveolin-1, VEGF and eNOS in HUVECs. The protein expression of caveolin-1 was decreased slightly, while VEGF and eNOS protein expression was increased after hypoxia for 6 h and reoxygenation for 24 h. However, compared with reoxygenation for 24 h, VEGF and eNOS protein expression was recovered after reoxygenation for 48 h. (C) Cell viability at various durations of HR. The example shown is representative of six independent experiments. The cell viability was markedly decreased and cell necrosis was increased by hypoxia for 6 h and reoxygenation for 24 h.

Determination of the appropriate concentration of apigenin

To ascertain the appropriate non-toxic concentration of apigenin for the treatment of HUVECs, the effect of apigenin on HUVEC viability was examined by CCK-8 assays. The results showed that 10 and 20 µM apigenin had protective effects on HUVECs after HR, while apigenin reduced cell viability at concentrations ≥50 (Fig. 2). The viability of HUVECs treated with 10 µM apigenin was higher than that of HUVECs treated with 20 µM apigenin. Therefore, we chose 10 µM as the appropriate concentration of apigenin for the following experiments.

Figure 2

Effects of apigenin on human umbilical vein endothelial cell (HUVEC) viability after hypoxia-reoxygenation (HR). Cell viability is presented as a percentage of the control (untreated cells). (A) The status of HUVECs after treatment with 10 µM apigenin was better than that after treatment with 20 µM apigenin. The cells were necrotic after treatment with 50 and 80 µM apigenin. (B) HUVEC viability after HR and treatment with various concentrations of apigenin. CCK-8 assay results showed that 10 and 20 µM apigenin had protective effects on HUVECs after HR. However, cell damage was induced at ≥50 µM apigenin. **P<0.01 vs. control group.

Transfection of caveolin-1 siRNA into HUVECs

Cells were transfected with caveolin-1 or control siRNAs for 72 h. EGFP-positive cells were observed by fluorescence microscopy. The positive cells (Fig. 3) showed that the HUVECs were successfully transfected with the siRNA vectors.

Figure 3

Human umbilical vein endothelial cell (HUVEC) transfection with caveolin-1 short interfering RNA (siRNA). Cells were transfected with a specific caveolin-1 siRNA or control siRNA for 72 h, followed by treatment with apigenin (10 µM) or solvent (dimethyl sulfoxide), and then subjected to hypoxia for 6 h and reoxygenation for 24 h. Enhanced green fluorescent protein (EGFP)-positive cells were observed by fluorescence microscopy at ×100 magnification. (A) Cells transfected with specific caveolin-1 siRNA or control siRNA. (B) The EGFP-positive cells are shown in four different groups: NC group (normal conditions), caveolin-1-KD group (transfection with caveolin-1 siRNA), NC + apigenin group (transfection with negative control siRNA + treatment with apigenin), and caveolin-1-KD + apigenin group (transfection with caveolin-1 siRNA + treatment with apigenin).

Effects of apigenin on caveolin-1-induced angiogenesis of HUVECs after HR

Cell viability, migration and tube formation were analyzed as indicators of angiogenesis. To investigate the effects of apigenin on HUVEC viability, we performed CCK-8 assays. We found that cell viability was markedly decreased after HR. However, apigenin did not promote the viability of HUVECs reoxygenated for more than 3 days (Fig. 4A). HUVEC viability was increased by treatment with apigenin (Fig. 4B). Caveolin-1 silencing inhibited the viability of HUVECs, and apigenin recovered their viability (Fig. 4B).

Figure 4

Effect of apigenin and caveolin-1 silencing on human umbilical vein endothelial cell (HUVEC) viability after hypoxia-reoxygenation (HR). Cells were analyzed after hypoxia for 6 h and reoxygenation for 24 h under three conditions: normal conditions (NC group), transfection of caveolin-1 short interfering RNA (siRNA) (caveolin-1-KD group), and treatment with apigenin (NC + Apigenin and caveolin-1-KD + apigenin groups). (A and B) Cell viability was measured by Cell Counting Kit-8 (CCK-8) assays. Values are the mean ± SEM of three experiments (n=3). *P<0.05 vs. NC group; ##P<0.01 vs. caveolin-1-KD group.

Migration of endothelial cells plays a key role in angiogenesis. Therefore, we determined the effects of apigenin on HUVEC migration after HR (Fig. 5). We found that apigenin promoted the migration of HUVECs. Caveolin-1 siRNA suppressed the HUVEC migration. However, the inhibition of HUVEC migration was reversed following treatment with apigenin.

Figure 5

Effect of apigenin and caveolin-1 silencing on human umbilical vein endothelial cell (HUVEC) migration after hypoxia-reoxygenation (HR). Cells were analyzed after hypoxia for 6 h and reoxygenation for 24 h under three conditions: normal conditions (NC group), transfection of caveolin-1 short interfering RNA (siRNA) (caveolin-1-KD group), and treatment with apigenin (NC + apigenin and caveolin-1-KD + apigenin groups). (A) Migration was assessed by crystal violet staining (magnification, ×100). (B) The OD was measured by a microplate reader indicating the number of migrated cells. All values are presented as the mean ± SEM of three experiments (n=3). **P<0.01 vs. NC group; ##P<0.01 vs. caveolin-1-KD group; ΔΔP<0.01 vs. NC + apigenin group.

To evaluate the role of apigenin in regulating angiogenesis, we next assessed the effects of apigenin on tube formation of HUVECs. As expected, apigenin promoted tube formation after HR. To verify the involvement of caveolin-1 in the process of tube formation, we used RNA interference to selectively silence caveolin-1. The tube formation was decreased after caveolin-1 silencing. Apigenin had no effect on tube formation inhibited by caveolin-1 silencing (Fig. 6).

Figure 6

Effect of apigenin and caveolin-1 silencing on tube formation of human umbilical vein endothelial cells (HUVECs) after hypoxia-reoxygenation (HR). Cells were analyzed after hypoxia for 6 h and reoxygenation for 24 h under three conditions: normal conditions (NC group), transfection of caveolin-1 short interfering RNA (siRNA) (caveolin-1-KD group), and treatment with apigenin (NC + apigenin and caveolin-1-KD + apigenin groups). (A) Representative light microscopy images of tube formation were obtained after treatment with apigenin and caveolin-1 siRNA. Arrows indicate new tube formation. (B) The tube formation assay was performed by counting branch points. All values are presented as the mean ± SEM of three experiments (n=3). **P<0.01 vs. NC group; ΔΔP<0.01 vs. NC + apigenin group.

Effects of apigenin on caveolin-1 levels in HUVECs

Caveolin-1 expression levels were evaluated by western blotting and qPCR. Apigenin did not affect caveolin-1 mRNA expression (Fig. 7A), but it increased caveolin-1 protein expression in HUVECs after HR (Fig. 7B and C). To verify the effects of apigenin on caveolin-1 expression, we transfected the HUVECs with caveolin-1 siRNA. The results showed that caveolin-1 silencing inhibited the mRNA (Fig. 7A) and protein expression of caveolin-1 (Fig. 7B and C). Apigenin increased caveolin-1 protein expression after the transfection of HUVECs with caveolin-1 siRNA (Fig. 7B and C), but it did not upregulate the expression of caveolin-1 mRNA (Fig. 7A). These results indicated that apigenin may regulate translation and/or post-translational processing of caveolin-1 protein but not the transcription of caveolin-1 mRNA.

Figure 7

Effects of apigenin and caveolin-1 silencing on caveolin-1, vascular endothelial growth factor (VEGF) and endothelial nitric oxide synthase (eNOS) levels in human umbilical vein endothelial cells (HUVECs) after hypoxia-reoxygenation (HR). Cells were analyzed after hypoxia for 6 h and reoxygenation for 24 h under three conditions: normal conditions (NC group), transfection of caveolin-1 short interfering RNA (siRNA) (caveolin-1-KD group), and treatment with apigenin (NC + apigenin and caveolin-1-KD + apigenin groups). (A) RT-PCR analysis of caveolin-1 in HUVECs. Caveolin-1 silencing affected caveolin-1 mRNA expression. Apigenin did not recover caveolin-1 mRNA expression after caveolin-1 silencing. (B) Western blot analysis of protein levels of caveolin-1, VEGF and eNOS in HUVECs. (C) Apigenin promoted caveolin-1 protein expression after HR. Caveolin-1 silencing affected caveolin-1 protein expression. Apigenin restored caveolin-1 protein expression after caveolin-1 silencing. (D) Apigenin promoted VEGF expression after HR. Caveolin-1 silencing did not affect the expression of VEGF. Apigenin did not increase VEGF expression after HUVECs were transfected with caveolin-1 siRNA. (E) Apigenin promoted eNOS expression after HR. Caveolin-1 silencing downregulated eNOS expression. Apigenin did not upregulate eNOS expression after caveolin-1 silencing. All values are presented as the mean ± SEM of three experiments (n=3). **P<0.01 vs. NC group; #P<0.05 vs. caveolin-1-KD group; ##P<0.01 vs. caveolin-1-KD group; ΔΔP<0.01 vs. NC + apigenin group.

Effects of apigenin on VEGF levels in HUVECs

To examine the effect of apigenin on angiogenesis, we assessed the well-established pro-angiogenic mediator VEGF by western blot analysis. We found that apigenin promoted VEGF expression after HR. The results revealed that transfection with caveolin-1 siRNA did not significantly affect VEGF protein expression; apigenin increased VEGF expression, but it did not upregulate VEGF expression after caveolin-1 silencing (Fig. 7B and D).

Effects of apigenin on eNOS levels in HUVECs

Since eNOS also plays a critical role in angiogenesis and vascular permeability, we next examined the role of eNOS in apigenin-induced angiogenesis. Incubation of HUVECs with apigenin rapidly increased the protein expression of eNOS. Compared with the NC group, blocking the caveolin-1 pathway with caveolin-1 siRNA significantly increased the protein level of eNOS, whereas compared with the caveolin-1-KD group, apigenin downregulated the level of eNOS (Fig. 7B and E).

Discussion

Angiogenesis is involved in physiological processes, such as development, and pathological states such as stroke, cancer, and inflammatory diseases. Recent studies suggest that angiogenesis in the ischemic penumbra area may play a crucial role in neural protection and tissue recovery. Apigenin is orally bioavailable and non-toxic (28) and has potential effects on both endothelial and nerve cells. We previously showed that apigenin increases the expression of both VEGF and caveolin-1 at the brain-infarct border zone after stroke in rats, and that caveolin-1 expression correlates with improved functional recovery. However, we did not investigate the angiogenic effects of apigenin after stroke. Therefore, in the present study, we first investigated the angiogenic effects of apigenin on HUVECs after HR injury and the underlying mechanism. Caveolin-1 has attracted attention due to its contribution to angiogenesis. Caveolin-1 plays an important role in the mechanisms of cellular repair in many pathological conditions including stroke (10,29). Previous studies, including our own, have demonstrated that ischemia/reperfusion increases caveolin-1 protein expression in association with increased microvessel density and better outcomes (24,25,30). In the present study, we explored the involvement of caveolin-1 in the angiogenic effects of apigenin.

For this purpose, we examined the effects of apigenin on the viability, migration and tube formation of HUVECs after HR. In vitro angiogenesis can be evaluated by migration and tube formation assays. As expected, our results showed that apigenin promoted cell viability, migration, and tube formation. However, this stimulatory effect was significantly inhibited by caveolin-1 siRNA, suggesting that caveolin-1 induction by apigenin is important to control angiogenesis. Apigenin could not recover tube formation, but increased the migration and proliferation of HUVECs, which were inhibited by caveolin-1 siRNA.

The underlying mechanisms of the angiogenic effect of apigenin remain unclear. In the present study, we demonstrated for the first time that apigenin promotes angiogenesis via caveolin-1 in HUVECs after HR. As shown previously, caveolin-1 is downregulated in the core and penumbra in ischemic brains (31,32). Our results showed that HR decreased caveolin-1 expression in HUVECs. We also found that apigenin treatment restored high caveolin-1 protein levels. Although the protein level was increased in cells treated with apigenin and exposed to HR, transcription of caveolin-1 was unaltered, suggesting that apigenin may affect post-translational processes of caveolin-1 expression.

We also investigated the involvement of apigenin in promotion of angiogenesis through VEGF and eNOS pathways. VEGF and eNOS-derived NO are important regulators of angio-genesis. However, the underlying mechanism regarding the modulation of caveolin-1 in the secretion of VEGF and eNOS remain ambiguous. VEGF is an angiogenesis accelerator, and caveolin-1 may play an important role in angiogenesis induced by VEGF (33). It is well established that VEGF is induced when tissue is subjected to hypoxic and ischemic attack. VEGF stimulates the proliferation and migration of vascular endothelial cells and increases the permeability of vessels as well as the differentiation of endothelial cells into capillary tubes (34,35). In this study, VEGF expression was increased in HUVECs after HR, and apigenin upregulated VEGF expression, indicating that apigenin may directly activate angiogenic signaling pathways. Intriguingly, after treatment of endothelial cells with caveolin-1 siRNA, the expression of VEGF protein did not significantly change. This result may be attributed to the association of VEGF with other molecules in the cells. It has been demonstrated that VEGF enhances the expression of eNOS in native and cultured endothelial cells, an effect that may be important in the process of VEGF-induced angiogenesis. VEGF-induced vascular permeability and angiogenesis were found to be markedly reduced in eNOS-deficient mice (36). In this study, the increased expression of eNOS may have upregulated VEGF expression. Therefore, further studies are needed to confirm the involvement of the eNOS-VEGF pathway in the angiogenic effect of apigenin. However, apigenin-increased VEGF protein expression was inhibited by caveolin-1 silencing. Therefore, the increase in angiogenesis by apigenin may be partly mediated via caveolin-1 regulating VEGF expression.

Several lines of evidence have shown upregulation of eNOS activation by hypoxia (37). This study produced the same results. The only direct protein-protein interaction demonstrated in vivo between caveolin-1 and a non-homologous protein is with eNOS. Studies have demonstrated that caveolin-1 functions as an endogenous negative regulator of eNOS activity (38–41). Binding of eNOS to caveolin-1 often leads to its inactivation (42). Our results demonstrated that apigenin promoted eNOS protein expression in HUVECs after HR, suggesting the involvement of eNOS in angiogenesis after HR injury. Furthermore, our data showed an increase in the protein expression of eNOS after caveolin-1 silencing, which is supported by a previous study (43). They showed that caveolin-1 deficiency induced the activation of eNOS and the generation of NO. It is important that eNOS is downregulated when cells are treated with apigenin. We believe that upon treatment with apigenin after caveolin-1 silencing, caveolin-1 was upregulated by apigenin, which bound to eNOS and inhibited its activity. Activation of eNOS promoted caveolin-1 phosphorylation and eNOS/caveolin-1 binding, creating an inhibitive feedback loop for eNOS (44). Nevertheless, our data suggest that caveolin-1 modulated angiogenesis of HUVECs after HR in part through its negative regulation of eNOS activity. Therefore, apigenin may promote angiogenesis through the caveolin-1/eNOS pathway.

Although apigenin treatment enhanced angiogenesis of HUVECs via caveolin-1 after HR, other studies showed that apigenin is a natural chemopreventive agent with clear anti-angiogenic effects in tumors (45,46). Tong et al (47) showed that 50 µM apigenin affected ultraviolet B-induced cutaneous proliferation and angiogenesis. In the present study, we examined the viability of HUVECs treated with various concentrations of apigenin after HR. The results showed that ≥50 µM apigenin had a cytotoxic effect, but had protective effects on cells at lower concentrations. Therefore, we speculate that the effects were dose-dependent in these assays. Furthermore, the effects of apigenin may be different in various tissues and cell types.

Taken together, our findings suggest that apigenin may be a novel agent to promote angiogenesis after HR injury. However, there are several important caveats to consider. Although our data provide cellular and pharmacological proof of principle for apigenin in endothelial cell angiogenesis, in vitro endothelial cell cultures may not recapitulate similar changes occurring in primary cultures or stroke models in vivo. Therefore, the pro-angiogenic utility of apigenin as a potential stroke recovery therapy should be explored in future studies.

Acknowledgments

This study was supported by the Medical Research Project of Zhejiang Province (2016KYB201), and the Wenzhou Municipal Science and Technology Bureau Project Funding (Y20150017), and the Key Construction Disciplines (Children's Rehabilitation) at the Second Affiliated Hospital of Wenzhou Medical University.

Glossary

Abbreviations

Abbreviations:

HUVECs

human umbilical vein endothelial cells

HR

hypoxia-reoxygenation

VEGF

vascular endothelial growth factor

NO

nitric oxide

eNOS

endothelial nitric oxide synthase

References

1 

Semenza GL: Vasculogenesis, angiogenesis, and arteriogenesis: Mechanisms of blood vessel formation and remodeling. J Cell Biochem. 102:840–847. 2007. View Article : Google Scholar : PubMed/NCBI

2 

Carmeliet P: Mechanisms of angiogenesis and arteriogenesis. Nat Med. 6:389–395. 2000. View Article : Google Scholar : PubMed/NCBI

3 

Kofler S, Nickel T and Weis M: Role of cytokines in cardiovascular diseases: A focus on endothelial responses to inflammation. Clin Sci (Lond). 108:205–213. 2005. View Article : Google Scholar

4 

Papetti M and Herman IM: Mechanisms of normal and tumor-derived angiogenesis. Am J Physiol Cell Physiol. 282:C947–C970. 2002. View Article : Google Scholar : PubMed/NCBI

5 

Shergill U, Das A, Langer D, Adluri R, Maulik N and Shah VH: Inhibition of VEGF- and NO-dependent angiogenesis does not impair liver regeneration. Am J Physiol Regul Integr Comp Physiol. 298:R1279–R1287. 2010. View Article : Google Scholar : PubMed/NCBI

6 

Yoshida D, Akahoshi T, Kawanaka H, Yamaguchi S, Kinjo N, Taketomi A, Tomikawa M, Shirabe K, Maehara Y and Hashizume M: Roles of vascular endothelial growth factor and endothelial nitric oxide synthase during revascularization and regeneration after partial hepatectomy in a rat model. Surg Today. 41:1622–1629. 2011. View Article : Google Scholar : PubMed/NCBI

7 

Fan TP, Yeh JC, Leung KW, Yue PY and Wong RN: Angiogenesis: From plants to blood vessels. Trends Pharmacol Sci. 27:297–309. 2006. View Article : Google Scholar : PubMed/NCBI

8 

Rahman A and Swärd K: The role of caveolin-1 in cardiovascular regulation. Acta Physiol (Oxf). 195:231–245. 2009. View Article : Google Scholar

9 

Sowa G: Caveolae, caveolins, cavins, and endothelial cell function: New insights. Front Physiol. 2:1202012. View Article : Google Scholar : PubMed/NCBI

10 

Mundy DI, Machleidt T, Ying YS, Anderson RG and Bloom GS: Dual control of caveolar membrane traffic by microtubules and the actin cytoskeleton. J Cell Sci. 115:4327–4339. 2002. View Article : Google Scholar : PubMed/NCBI

11 

Navarro A, Anand-Apte B and Parat MO: A role for caveolae in cell migration. FASEB J. 18:1801–1811. 2004. View Article : Google Scholar : PubMed/NCBI

12 

Gao Y, Zhao Y, Pan J, Yang L, Huang T, Feng X, Li C, Liang S, Zhou D, Liu C, et al: Treadmill exercise promotes angiogenesis in the ischemic penumbra of rat brains through caveolin-1/VEGF signaling pathways. Brain Res. 1585:83–90. 2014. View Article : Google Scholar : PubMed/NCBI

13 

Liu J, Wang XB, Park DS and Lisanti MP: Caveolin-1 expression enhances endothelial capillary tubule formation. J Biol Chem. 277:10661–10668. 2002. View Article : Google Scholar

14 

Frank PG, Woodman SE, Park DS and Lisanti MP: Caveolin, caveolae, and endothelial cell function. Arterioscler Thromb Vasc Biol. 23:1161–1168. 2003. View Article : Google Scholar : PubMed/NCBI

15 

Gratton JP, Bernatchez P and Sessa WC: Caveolae and caveolins in the cardiovascular system. Circ Res. 94:1408–1417. 2004. View Article : Google Scholar : PubMed/NCBI

16 

Fleming I and Busse R: Molecular mechanisms involved in the regulation of the endothelial nitric oxide synthase. Am J Physiol Regul Integr Comp Physiol. 284:R1–R12. 2003. View Article : Google Scholar

17 

Ju H, Zou R, Venema VJ and Venema RC: Direct interaction of endothelial nitric-oxide synthase and caveolin-1 inhibits synthase activity. J Biol Chem. 272:18522–18525. 1997. View Article : Google Scholar : PubMed/NCBI

18 

Wang QQ, Cheng N, Yi WB, Peng SM and Zou XQ: Synthesis, nitric oxide release, and α-glucosidase inhibition of nitric oxide donating apigenin and chrysin derivatives. Bioorg Med Chem. 22:1515–1521. 2014. View Article : Google Scholar : PubMed/NCBI

19 

Woodman OL and Chan EC: Vascular and anti-oxidant actions of flavonols and flavones. Clin Exp Pharmacol Physiol. 31:786–790. 2004. View Article : Google Scholar : PubMed/NCBI

20 

Olszanecki R, Gebska A, Kozlovski VI and Gryglewski RJ: Flavonoids and nitric oxide synthase. J Physiol Pharmacol. 53:571–584. 2002.

21 

Guerrero JA, Lozano ML, Castillo J, Benavente-García O, Vicente V and Rivera J: Flavonoids inhibit platelet function through binding to the thromboxane A2 receptor. J Thromb Haemost. 3:369–376. 2005. View Article : Google Scholar : PubMed/NCBI

22 

Liu LZ, Fang J, Zhou Q, Hu X, Shi X and Jiang BH: Apigenin inhibits expression of vascular endothelial growth factor and angiogenesis in human lung cancer cells: Implication of chemo-prevention of lung cancer. Mol Pharmacol. 68:635–643. 2005.PubMed/NCBI

23 

Ansó E, Zuazo A, Irigoyen M, Urdaci MC, Rouzaut A and Martínez-Irujo JJ: Flavonoids inhibit hypoxia-induced vascular endothelial growth factor expression by a HIF-1 independent mechanism. Biochem Pharmacol. 79:1600–1609. 2010. View Article : Google Scholar : PubMed/NCBI

24 

Li XM, Niu WZ and Chen X: Effect of apigenin on expression of VEGF in cerebral ischemia and reperfusion rats. Chin J Pathophysiol. 26:2473–2477. 2010.

25 

Niu WZ, Li XM, Wang G, Han X and Chen X: Effects of apigenin on caveolin -1 expression of focal cerebral ischemia-reperfusion in rats. Chin Tradit Herbal Drugs. 41:1658–1662. 2010.

26 

Li Q, Wu J, Wei P, Xu Y, Zhuo C, Wang Y, Li D and Cai S: Overexpression of forkhead Box C2 promotes tumor metastasis and indicates poor prognosis in colon cancer via regulating epithelial-mesenchymal transition. Am J Cancer Res. 5:2022–2034. 2015.PubMed/NCBI

27 

Taylor AC, Seltz LM, Yates PA and Peirce SM: Chronic whole-body hypoxia induces intussusceptive angiogenesis and microvascular remodeling in the mouse retina. Microvasc Res. 79:93–101. 2010. View Article : Google Scholar : PubMed/NCBI

28 

Lopez-Jornet P, Camacho-Alonso F, Gómez-Garcia F, Molina Miñano F, Cañas X, Serafín A, Castillo J and Vicente-Ortega V: Effects of potassium apigenin and verbena extract on the wound healing process of SKH-1 mouse skin. Int Wound J. 11:489–495. 2014. View Article : Google Scholar

29 

Liu P, Rudick M and Anderson RG: Multiple functions of caveolin-1. J Biol Chem. 277:41295–41298. 2002. View Article : Google Scholar : PubMed/NCBI

30 

Chidlow JH Jr and Sessa WC: Caveolae, caveolins, and cavins: Complex control of cellular signalling and inflammation. Cardiovasc Res. 86:219–225. 2010. View Article : Google Scholar : PubMed/NCBI

31 

Shen J, Ma S, Chan P, Lee W, Fung PC, Cheung RT, Tong Y and Liu KJ: Nitric oxide down-regulates caveolin-1 expression in rat brains during focal cerebral ischemia and reperfusion injury. J Neurochem. 96:1078–1089. 2006. View Article : Google Scholar : PubMed/NCBI

32 

Li Y, Luo J, Lau WM, Zheng G, Fu S, Wang TT, Zeng HP, So KF, Chung SK, Tong Y, et al: Caveolin-1 plays a crucial role in inhibiting neuronal differentiation of neural stem/progenitor cells via VEGF signaling-dependent pathway. PLoS One. 6:e229012011. View Article : Google Scholar : PubMed/NCBI

33 

Tahir SA, Park S and Thompson TC: Caveolin-1 regulates VEGF-stimulated angiogenic activities in prostate cancer and endothelial cells. Cancer Biol Ther. 8:2286–2296. 2009. View Article : Google Scholar : PubMed/NCBI

34 

Roy S and Sen CK: miRNA in wound inflammation and angiogenesis. Microcirculation. 19:224–232. 2012. View Article : Google Scholar : PubMed/NCBI

35 

Peng W, Yu Y, Li T, Zhu Y and Chen H: The effects of small interfering RNA-targeting tissue factor on an in vitro model of neovascularization. Mol Vis. 19:1296–1303. 2013.PubMed/NCBI

36 

Fukumura D, Gohongi T, Kadambi A, Izumi Y, Ang J, Yun CO, Buerk DG, Huang PL and Jain RK: Predominant role of endothelial nitric oxide synthase in vascular endothelial growth factor-induced angiogenesis and vascular permeability. Proc Natl Acad Sci USA. 98:2604–2609. 2001. View Article : Google Scholar : PubMed/NCBI

37 

Qing M, Görlach A, Schumacher K, Wöltje M, Vazquez-Jimenez JF, Hess J and Seghaye MC: The hypoxia-inducible factor HIF-1 promotes intramyocardial expression of VEGF in infants with congenital cardiac defects. Basic Res Cardiol. 102:224–232. 2007. View Article : Google Scholar : PubMed/NCBI

38 

Drab M, Verkade P, Elger M, Kasper M, Lohn M, Lauterbach B, Menne J, Lindschau C, Mende F, Luft FC, et al: Loss of caveolae, vascular dysfunction, and pulmonary defects in caveolin-1 gene-disrupted mice. Science. 293:2449–2452. 2001. View Article : Google Scholar : PubMed/NCBI

39 

Razani B, Engelman JA, Wang XB, Schubert W, Zhang XL, Marks CB, Macaluso F, Russell RG, Li M, Pestell RG, et al: Caveolin-1 null mice are viable but show evidence of hyper-proliferative and vascular abnormalities. J Biol Chem. 276:38121–38138. 2001.PubMed/NCBI

40 

Zhao YY, Liu Y, Stan RV, Fan L, Gu Y, Dalton N, Chu PH, Peterson K, Ross J Jr and Chien KR: Defects in caveolin-1 cause dilated cardiomyopathy and pulmonary hypertension in knockout mice. Proc Natl Acad Sci USA. 99:11375–11380. 2002. View Article : Google Scholar : PubMed/NCBI

41 

Maniatis NA, Shinin V, Schraufnagel DE, Okada S, Vogel SM, Malik AB and Minshall RD: Increased pulmonary vascular resistance and defective pulmonary artery filling in caveolin-1−/−mice. Am J Physiol Lung Cell Mol Physiol. 294:L865–L873. 2008. View Article : Google Scholar : PubMed/NCBI

42 

Mehta D and Malik AB: Signaling mechanisms regulating endothelial permeability. Physiol Rev. 86:279–367. 2006. View Article : Google Scholar

43 

Siddiqui MR, Komarova YA, Vogel SM, Gao X, Bonini MG, Rajasingh J, Zhao YY, Brovkovych V and Malik AB: Caveolin-1-eNOS signaling promotes p190RhoGAP-A nitration and endothelial permeability. J Cell Biol. 193:841–850. 2011. View Article : Google Scholar : PubMed/NCBI

44 

Chen Z, Bakhshi FR, Shajahan AN, Sharma T, Mao M, Trane A, Bernatchez P, van Nieuw Amerongen GP, Bonini MG, Skidgel RA, et al: Nitric oxide-dependent Src activation and resultant caveolin-1 phosphorylation promote eNOS/caveolin-1 binding and eNOS inhibition. Mol Biol Cell. 23:1388–1398. 2012. View Article : Google Scholar : PubMed/NCBI

45 

Tong X and Pelling JC: Targeting the PI3K/Akt/mTOR axis by apigenin for cancer prevention. Anticancer Agents Med Chem. 13:971–978. 2013. View Article : Google Scholar : PubMed/NCBI

46 

Fang J, Zhou Q, Liu LZ, Xia C, Hu X, Shi X and Jiang BH: Apigenin inhibits tumor angiogenesis through decreasing HIF-1alpha and VEGF expression. Carcinogenesis. 28:858–864. 2007. View Article : Google Scholar

47 

Tong X, Mirzoeva S, Veliceasa D, Bridgeman BB, Fitchev P, Cornwell ML, Crawford SE, Pelling JC and Volpert OV: Chemopreventive apigenin controls UVB-induced cutaneous proliferation and angiogenesis through HuR and thrombospondin-1. Oncotarget. 5:11413–11427. 2014. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Tu F, Pang Q, Chen X, Huang T, Liu M and Zhai Q: Angiogenic effects of apigenin on endothelial cells after hypoxia-reoxygenation via the caveolin-1 pathway. Int J Mol Med 40: 1639-1648, 2017.
APA
Tu, F., Pang, Q., Chen, X., Huang, T., Liu, M., & Zhai, Q. (2017). Angiogenic effects of apigenin on endothelial cells after hypoxia-reoxygenation via the caveolin-1 pathway. International Journal of Molecular Medicine, 40, 1639-1648. https://doi.org/10.3892/ijmm.2017.3159
MLA
Tu, F., Pang, Q., Chen, X., Huang, T., Liu, M., Zhai, Q."Angiogenic effects of apigenin on endothelial cells after hypoxia-reoxygenation via the caveolin-1 pathway". International Journal of Molecular Medicine 40.6 (2017): 1639-1648.
Chicago
Tu, F., Pang, Q., Chen, X., Huang, T., Liu, M., Zhai, Q."Angiogenic effects of apigenin on endothelial cells after hypoxia-reoxygenation via the caveolin-1 pathway". International Journal of Molecular Medicine 40, no. 6 (2017): 1639-1648. https://doi.org/10.3892/ijmm.2017.3159
Copy and paste a formatted citation
x
Spandidos Publications style
Tu F, Pang Q, Chen X, Huang T, Liu M and Zhai Q: Angiogenic effects of apigenin on endothelial cells after hypoxia-reoxygenation via the caveolin-1 pathway. Int J Mol Med 40: 1639-1648, 2017.
APA
Tu, F., Pang, Q., Chen, X., Huang, T., Liu, M., & Zhai, Q. (2017). Angiogenic effects of apigenin on endothelial cells after hypoxia-reoxygenation via the caveolin-1 pathway. International Journal of Molecular Medicine, 40, 1639-1648. https://doi.org/10.3892/ijmm.2017.3159
MLA
Tu, F., Pang, Q., Chen, X., Huang, T., Liu, M., Zhai, Q."Angiogenic effects of apigenin on endothelial cells after hypoxia-reoxygenation via the caveolin-1 pathway". International Journal of Molecular Medicine 40.6 (2017): 1639-1648.
Chicago
Tu, F., Pang, Q., Chen, X., Huang, T., Liu, M., Zhai, Q."Angiogenic effects of apigenin on endothelial cells after hypoxia-reoxygenation via the caveolin-1 pathway". International Journal of Molecular Medicine 40, no. 6 (2017): 1639-1648. https://doi.org/10.3892/ijmm.2017.3159
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team