Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
International Journal of Oncology
Join Editorial Board Propose a Special Issue
Print ISSN: 1019-6439 Online ISSN: 1791-2423
Journal Cover
February-2022 Volume 60 Issue 2

Full Size Image

Cover Legend PDF

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
February-2022 Volume 60 Issue 2

Full Size Image

Cover Legend PDF

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML

  • Supplementary Files
    • Supplementary_Data1.pdf
    • Supplementary_Data2.xlsx
Article

Extracellular domain of semaphorin 5A serves a tumor‑suppressing role by activating interferon signaling pathways in lung adenocarcinoma cells

  • Authors:
    • Ming-Zhen Chen
    • Li-Yu Su
    • Pin-Hao Ko
    • Ming-Hsuan Hsu
    • Li-Ling Chuang
    • Li-Han Chen
    • Tzu-Pin Lu
    • Eric Y. Chuang
    • Lu-Ping Chow
    • Mong-Hsun Tsai
    • Hsao-Hsun Hsu
    • Liang-Chuan Lai
  • View Affiliations / Copyright

    Affiliations: Graduate Institute of Physiology, College of Medicine, National Taiwan University, Taipei 100, Taiwan, R.O.C., Department of Traditional Chinese Medicine, Taoyuan General Hospital, Ministry of Health and Welfare, Taoyuan 330, Taiwan, R.O.C., School of Physical Therapy and Graduate Institute of Rehabilitation Science, College of Medicine, Chang Gung University, Taoyuan 333, Taiwan, R.O.C., Institute of Fisheries Science, College of Life Science, National Taiwan University, Taipei 106, Taiwan, R.O.C., Institute of Epidemiology and Preventive Medicine, National Taiwan University, Taipei 106, Taiwan, R.O.C., Bioinformatics and Biostatistics Core, Center of Genomic and Precision Medicine, National Taiwan University, Taipei 106, Taiwan, R.O.C., Graduate Institute of Biochemistry and Molecular Biology, College of Medicine, National Taiwan University, Taipei 106, Taiwan, R.O.C., Division of Thoracic Surgery, Department of Surgery, National Taiwan University Hospital and National Taiwan University College of Medicine, Taipei 100, Taiwan, R.O.C.
  • Article Number: 21
    |
    Published online on: January 19, 2022
       https://doi.org/10.3892/ijo.2022.5311
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Semaphorin 5A (SEMA5A), which was originally identified as an axon guidance molecule in the nervous system, has been subsequently identified as a prognostic biomarker for lung cancer in nonsmoking women. SEMA5A acts as a tumor suppressor by inhibiting the proliferation and migration of lung cancer cells. However, the regulatory mechanism of SEMA5A is not clear. Therefore, the purpose of the present study was to explore the roles of different domains of SEMA5A in its tumor‑suppressive effects in lung adenocarcinoma cell lines. First, it was revealed that overexpression of full length SEMA5A or its extracellular domain significantly inhibited the proliferation and migration of both A549 and H1299 cells using MTT, colony formation and gap closure assays. Next, microarray analyses were performed to identify genes regulated by different domains of SEMA5A. Among the differentially expressed genes, the most significant function of these genes that were enriched was the ‘Interferon Signaling’ pathway according to Ingenuity Pathway Analysis. The activation of the ‘Interferon Signaling’ pathway was validated by reverse transcription‑quantitative PCR and western blotting. In summary, the present study demonstrated that the extracellular domain of SEMA5A could upregulate genes in interferon signaling pathways, resulting in suppressive effects in lung adenocarcinoma cells.

Introduction

Lung cancer is the most commonly diagnosed cancer worldwide (11.6% of all cases) and is a leading cause of cancer-related mortality in both males and females due to the poor 5-year overall survival rate and high recurrence rate (1,2). Non-small cell lung cancer, including large cell carcinoma, squamous cell carcinoma and adenocarcinoma, is the major subtype (~80%) among lung cancer cases (3). Among these histological subtypes, adenocarcinoma is the most common one to be diagnosed in Taiwan (1,4,5).

In Western countries, 70–90% of lung cancer cases are attributed to cigarette smoking; however, in Taiwan, only 7% of female lung cancer cases are associated with smoking (6,7). Several previous studies have identified genes (e.g., KRAS, phosphoinositide-3-kinase, catalytic, α polypeptide and EGFR) (7–12) that are associated with lung cancer in non-smokers. Our previous studies revealed that one of the semaphorins, semaphorin (SEMA)5A, could potentially serve as a therapeutic biomarker (13) and demonstrated that SEMA5A inhibited tumor proliferation and migration in lung adenocarcinoma (14). However, to the best of our knowledge, the mechanism by which SEMA5A serves these roles is still unknown.

Semaphorins are a large protein family, which is divided into eight classes based on structural features and the distribution among different phyla (15). The sema domain is the distinctive structural and functional element of semaphorins (16) and is present as a single copy located at the N-terminus of semaphorins. It is crucial for signaling (17). Semaphorins were first identified as axon guidance molecules in the nervous system, participating in neuron growth and helping to determine neuronal polarity (18). Several studies have revealed that semaphorins are also involved in the immune system (19,20), the cardiovascular system (21), the musculoskeletal system (22) and tumor progression (23). For example, SEMA4D has been characterized as a pro-tumorigenic factor, inducing tumor angiogenesis in head and neck cancer cells (24). SEMA3B has been identified as a tumor suppressor gene, which inhibits lung cancer cell proliferation and induces apoptosis (25). SEMA6A has been demonstrated to regulate lung cancer cell apoptosis through its extracellular sema domain that attenuates intracellular signaling (26). Several studies have reported that SEMA5A can inhibit cancer cell proliferation by various mechanisms, such as the inhibition of human glioma cell motility (27), the suppression of pancreatic tumor burden (28) and the maintenance of an epithelial phenotype in malignant pancreatic cancer cells (29). However, whether SEMA5A employs similar mechanisms in lung adenocarcinoma requires further investigation.

The present study explored the roles of different domains of SEMA5A in its tumor-suppressive effects in lung adenocarcinoma cell lines using several in vitro assays and revealed that different SEMA5A domains have different functions in regulating tumor cell proliferation.

Materials and methods

Cell culture and treatments

A549 and H1299 lung carcinoma cell lines (Bioresource Collection and Research Center, Food Industry Research and Development Institute, Hsinchu, Taiwan) were cultured in RPMI-1640 medium (Gibco; Thermo Fisher Scientific, Inc.) supplemented with 10% FBS (MilliporeSigma) and 1% penicillin-streptomycin (Gibco; Thermo Fisher Scientific, Inc.). The cell lines were incubated at 37°C in a humidified atmosphere with 5% CO2.

Cell line authentication

Cell experiments were performed on cells that were passaged <20 times and were routinely tested for mycoplasma using a PCR Mycoplasma Detection Kit (Applied Biological Materials, Inc.) according to the manufacturer's protocol. The cell lines were authenticated by short-tandem repeat analysis (Mission Biotech Inc.).

Plasmid construction

To overexpress the various SEMA5A domains, different plasmids were constructed by the BioMed Resource Core of the 1st Core Facility Lab, National Taiwan University College of Medicine (Taipei, Taiwan). The constructs of 5A-Full, 5A-ECD and 5A-ICD were individually inserted into a pN1 vector, which was modified from the pEGFP-N1 vector (National Taiwan University College of Medicine, Taipei, Taiwan). pN1-6×His/5A-Full/FLAG/Kan was constructed to overexpress SEMA5A full length with a His-tag at the N-terminus and a Flag-tag at the C-terminus. pN1-18×His/5A-ECD/Kan was constructed to overexpress the extracellular domain with a His-tag at the N-terminus. pN1-5A-ICD/18×His/Kan was constructed to overexpress the intracellular domain with a His-tag at the C-terminus. A schematic graph of constructs of SEMA5A Full, ECD and ICD is shown in Fig. S1.

Transfection

The A549 and H1299 cells were transfected with different SEMA5A-expressing plasmids [pN1-6×His/5A-Full/FLAG/Kan (7,225 bp; 200 ng/µl), pN1-18×His/5A-ECD/Kan (6,919 bp; 200 ng/µl) and pN1-5A-ICD/18×His/Kan (4,336 bp; 200 ng/µl)] and control plasmid (pN1 vector; 3,957 bp; 200 ng/µl) using jetPRIME transfection reagent (Polyplus-transfection SA) for 10 min at room temperature according to the manufacturer's protocol. The A549 and H1299 cells were seeded in a 6-cm dish (2.5×105 cells/well) and incubated at 37°C for 24 h before transfection. Cells were transfected with different SEMA5A domain plasmids using jetPRIME transfection reagent (Polyplus-transfection SA). Transfection reagent was mixed with plasmids for 10 min at room temperature, and then added into 6-cm dish along with cell culture medium. Cells were then incubated at 37°C for 24 h for RNA extraction or at 37°C for 48 h for protein extraction. Cells transfected with SEMA5A full length, SEMA5A extracellular domain and SEMA5A intracellular domain were the SEMA5A full length (5A-Full), SEMA5A extracellular domain (5A-ECD) and SEMA5A intracellular domain (5A-ICD) groups, respectively.

RNA extraction and reverse transcription-quantitative PCR (RT-qPCR) analysis

Total RNA was extracted from cultured A549 and H1299 cells using NucleoZOL reagent (Machery-Nagel GmbH) according to the manufacturer's protocol. Total RNA (1 µg) was reverse transcribed using a High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems; Thermo Fisher Scientific, Inc.). The temperature protocol for reverse transcription was as follows: 25°C for 10 min, 37°C for 120 min and 85°C for 5 min, followed by 4°C forever. Subsequently, 5% of each cDNA reaction was used as the template for qPCR using OmicsGreen qPCR MasterMix (OmicsBio). The primers are shown in Table I. RT-qPCR was performed using a Step One Plus Real-Time PCR System (Thermo Fisher Scientific, Inc.). The thermocycling conditions for qPCR were: 95°C for 15 min, followed by 40 cycles of 95°C for 15 sec, 60°C for 20 sec and 72°C for 20 sec. The mRNA expression levels were normalized using GAPDH, and relative mRNA levels were measured using the 2−ΔΔCq method (30).

Table I.

Primers used for reverse transcription-quantitative PCR.

Table I.

Primers used for reverse transcription-quantitative PCR.

GeneSequence (5′-3′)
5A-FullF: GTGCGTCTTCAACCTGAGCG
R: CCTGGTCCACGGTGCCAC
5A-ECDF: GTGCGTCTTCAACCTGAGCG
R: CCTGGTCCACGGTGCCAC
5A-ICDF: CCTGCCCCCCTTAATACCAGC
R: CTTCCCAGTGAGATGTGGGTTG
JAK1F: TCCAAGAACCTGAGTGTGGC
R: CCTGCACCGGCTTTCATAGA
JAK2F: CCTTTTTAGAGGGGAAATGAGGT
R: ATGGTGTCTAAAGTGGAGTAGC
TYK2F: CCATCATTCCGCACCATCCT
R: GTTGGTCGGATCGTAGCAGT
STAT1F: GGACCGCACCTTCAGTCTTT
R: TCTCATTCACATCTCTCAACTTCAC
STAT2F: TTCTGCCGGGACATTCAGGA
R: TGGCTCTCCACAGGTGTTTC
IRF9F: AGCTTGAGAGGGGCATCCTA
R: GGCCCTGAAAGTACCTGACC
G1P2F: GTGGACAAATGCGACGAACC
R: GAAGGTCAGCCAGAACAG
G1P3F: AATGCGGGTAAGGATGCAGG
R: CCATTCAGGATCGCAGACCA
IFIT1F: CTCTGCCTATCGCCTGGATG
R: AGCTTCAGGGCAAGGAGAAC
IFITM1F: CATGTCGTCTGGTCCCTGTT
R: GTCACAGAGCCGAATACCAGT
IFITM2F: TGAGAAAACGGAACTACTGGGG
R: GAGCATCTCGTAGTTGGGAGG
IFITM3F: TGCTGATCTTCCAGGCCTATG
R: AGCGTGTGAGGATAAAGGGC
GAPDHF: AACGGGAAGCTTGTCATCAATGGAAA
R: GCATCAGCAGAGGGGGCAGAG

[i] 5A-ECD, SEMA5A extracellular domain; 5A-Full, SEMA5A full length; 5A-ICD, SEMA5A intracellular domain; F, forward; G1P, glycogenin 1 pseudogene; IFIT1, interferon induced protein with tetratricopeptide repeats 1; IRF9, interferon regulatory factor 9; JAK, Janus kinase; R, reverse; SEMA5A, semaphorin 5A; TYK2, tyrosine kinase 2.

Protein extraction

Before lysis, A549 and H1299 cells were washed with cold PBS (Bioman Scientific Co., Ltd.) and samples were harvested with cell scrapers. RIPA lysis buffer (MilliporeSigma) with RNase inhibitor and protease inhibitor cocktail (MilliporeSigma) was used to lyse the cells. Total protein concentrations were detected using Protein Assay Dye Reagent Concentrate (Bio-Rad Laboratories, Inc.). Membrane protein extraction was conducted using a Mem-PER™ plus membrane protein extraction kit (Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. Proteins in the cell culture medium were concentrated using a Nanosep centrifugal 10K OMEGA™ filter (Pall Life Sciences) at 300 × g for 40 min at 4°C, and BSA (1 ng/ml; Sigma-Aldrich; Merck KGaA) was added externally to the cell culture medium as the spike-in control.

Western blotting

Proteins extracted from A549 and H1299 cells and culture medium were prepared as aforementioned. Proteins (25 µg per lane) were separated by 8 or 10% SDS-PAGE and transferred to PVDF membranes (GE Healthcare). The membranes were blocked with the undiluted Lightning Blocking Buffer (Enginelife Science Co., Ltd.) for 10 min at room temperature and incubated with the following primary antibodies overnight at 4°C: SEMA5A (dilution, 1:1,000; cat. no. PAL924Hu01; Cloud-Clone Corp.), p-STAT1 (dilution, 1:1,000; cat. no. AP0109; ABclonal Biotech Co., Ltd.), STAT1 (dilution, 1:1,000; cat. no. 10144-2-AP; ProteinTech Group, Inc.), p-STAT2 (dilution, 1:1,000; cat. no. AP0284; ABclonal Biotech Co., Ltd.), STAT2 (dilution, 1:1,000; cat. no. 72604; Cell Signaling Technology, Inc.), p-JAK1 (dilution, 1:1,000; cat. no. AP0530; ABclonal Biotech Co., Ltd.), JAK1 (dilution, 1:1,000; cat. no. 3332; Cell Signaling Technology, Inc.), p-JAK2 (dilution, 1:1,000; cat. no. AP0531; ABclonal Biotech Co., Ltd.), JAK2 (dilution, 1:1,000; cat. no. 3230; Cell Signaling Technology, Inc.), IFIT1 (dilution, 1:1,000; cat. no. 14769; Cell Signaling Technology, Inc.), G1P2 (ISG15) (dilution, 1:1,000; cat. no. 2758; Cell Signaling Technology, Inc.), ACTB (dilution, 1:5,000; cat. no. 3700; Cell Signaling Technology, Inc.), caspase-3 (CASP3) (dilution, 1:1,000; cat. no. 9662; Cell Signaling Technology, Inc.), cleaved caspase-3 (dilution, 1:1,000; cat. no. 9661; Cell Signaling Technology, Inc.) and GAPDH (dilution, 1:5,000; cat. no. 10494-1-AP; ProteinTech Group, Inc.). The secondary antibodies were goat anti-rabbit IgG HRP (dilution, 1:10,000; cat. no. RA-BZ202; Croyez Bioscience Co., Ltd.) and goat anti-mouse IgG(H+L) HRP (dilution, 1:10,000; cat. no. RA-BZ102; Croyez Bioscience Co., Ltd.). After immunoblotting, the membranes were washed with Tris-buffered saline with 0.1% Tween-20 and incubated with horseradish peroxidase-conjugated goat anti-rabbit IgG (Croyez Bioscience Co., Ltd.) or goat anti-mouse IgG (Croyez Bioscience Co., Ltd.) for 1 h at room temperature. The blotted protein bands were detected using LuminataTM Forte Western HRP Substrate in an enhanced chemiluminescence system (MilliporeSigma) with the BioSpectrum Imaging System (Analytik Jena AG). The intensities of bands were analyzed using ImageJ 1.48v (National Institutes of Health).

Cell proliferation assay

A549 and H1299 cells (3,000 cells/well) transfected with plasmids containing different SEMA5A domains, including 5A-Full, 5A-ECD, 5A-ICD or empty control plasmid, were first seeded in a 6-cm dish and transfected with different SEMA5A-expressing plasmids for 24 h. Then, the transfected cells were seeded on 96-well plates at a density of 3,000 cells/well. After incubation for 12 h, cell proliferation was measured using MTT (Bionovas Biotechnology Co., Ltd.) assays at 0, 24, 48 and 72 h. A mixture of 10 µl MTT solution and 90 µl RPMI medium was added to each well and incubated for 2 h. Dimethyl sulfoxide (99.8%; Sigma-Aldrich; Merck KGaA) was used to dissolve the purple formazan. The absorbance was measured at 570 nm. The cell growth ratio was expressed as the relative absorbance compared with 0 h.

Gap closure assay

A549 and H1299 cells transfected with plasmids containing different SEMA5A domains, including 5A-Full, 5A-ECD, 5A-ICD or empty control plasmid, were first seeded in a 6-cm dish and transfected as aforementioned for 24 h. The transfected cells were seeded in the Ibidi Culture-Insert (Ibidi GmbH) at a density of 2.5×104 cells/reservoir, serum-starved and incubated at 37°C overnight. After incubation, the inserts were carefully removed and the cell-free gap images were captured at 0, 12 and 24 h. Cell migration was measured by comparison with the cell-free area at 0 h using a light microscope and quantified using ImageJ 1.48v software (National Institutes of Health).

Colony formation assay

A549 and H1299 cells transfected with plasmids containing different SEMA5A domains, including 5A-Full, 5A-ECD, 5A-ICD or empty control plasmid, were seeded in a 6-cm dish and transfected as aforementioned for 24 h, and then seeded in 6-well plates at a density of 300 cells/well. After incubation at 37°C for 2 weeks, cells were fixed with 500 µl methanol-acetic acid (Sigma-Aldrich; Merck KGaA) solution (3:1) for 10 min at room temperature and stained with 0.1% crystal violet for another 10 min at room temperature. Colonies containing >50 cells were counted and quantified using ImageJ 1.48v software (National Institutes of Health).

Flow cytometry analysis of cell cycle distribution and apoptosis

To analyze cell cycle phases and cell death, A549 and H1299 cells transfected with plasmids containing different SEMA5A domains, including 5A-Full, 5A-ECD, 5A-ICD or empty control plasmid, in the medium were harvested along with the detached cultured cells. Cell lysis buffer (0.5% Triton X-100, 0.2 µg/ml Na2EDTA•2H2O, 1% BSA in PBS) was used to lyse cells, and cells were fixed with cold 100% methanol at −20°C overnight. After washing with PBS, cells were stained with PI (Thermo Fisher Scientific, Inc.) solution (20 µg PI/ml; 0.1 mg RNase/ml in PBS) for 10 min on ice. The suspension was analyzed on a Beckman Coulter FC500 instrument (Beckman Coulter, Inc.) using CXP Analysis Software v2.3 (Beckman Coulter, Inc.).

Illumina microarray analysis

The levels of mRNA corresponding to the different SEMA5A constructs in A549 cells were detected and analyzed as aforementioned. Total RNA was extracted from cultured cells using NucleoZOL reagent (Machery-Nagel GmbH) according to the manufacturer's protocol. Total RNA was primed with T7 Oligo(dT) and amplified using an Illumina TotalPre RNA Amplification Kit (Ambion; Thermo Fisher Scientific, Inc.). Following the first strand cDNA synthesis, DNA polymerase and RNAase H were used to simultaneously degrade the RNA and synthesize the second strand cDNA. The double-stranded cDNA then underwent a clean-up process, and in vitro transcription was conducted to synthesize multiple copies of biotinylated complementary RNA (cRNA). After amplification, the cRNA was hybridized to Illumina Human HT-12 v4 BeadChips (GSGX Version 1.9.0; part number, 15002873; serial number, 200769980010; Illumina, Inc.) at 58°C for 16 h. After hybridization, the BeadChip was washed and stained with streptavidin-Cy3 dye. The intensity of the bead's fluorescence was detected using a HiScan SQ instrument (Illumina, Inc.), and the results were analyzed using BeadStudio v2011.1 software (Illumina, Inc.). After scanning, the intensity data of Illumina Human HT-12 v4 BeadChips were analyzed using the software Partek v7.0 (Partek, Inc.), and background-adjusted signals were normalized by a quantile normalization algorithm. Unpaired Student's t-tests were utilized to identify differentially expressed genes (DEGs; Tables SI and SII). The filtering criteria were set at a fold change ≥1.5 or ≤0.67 and P<0.05 compared with the empty control. Principal component analysis was utilized to evaluate the similarity of the gene expression profiles. Hierarchical clustering analysis and the Genesis 1.7.7 program (31) were used to generate a visual representation of the expression profiles. Furthermore, Ingenuity Pathway Analysis (Ingenuity Systems; Qiagen, Inc.) was applied to identify gene-gene interaction networks, biological functions and canonical pathways of DEGs. The datasets generated during the current study are available in the Gene Expression Omnibus repository (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE157062).

Statistical analysis

Statistical analyses were performed using GraphPad Prism 8 (GraphPad Software, Inc.). Data are presented as the mean ± SD of at least three independent experiments. Statistical significance was analyzed by unpaired Student's t-test, one-way ANOVA test and Bonferroni post hoc test or two-way ANOVA test and Bonferroni post hoc test and expressed as a P-value. P<0.05 was considered to indicate a statistically significant difference. Fisher's Exact test was utilized to identify canonical pathways that differentially expressed genes were involved in. The significance of pathways was determined according to Ingenuity's default threshold (−log(P-value)>1.3).

Results

5A-Full and 5A-ECD suppress the proliferation and migration of lung adenocarcinoma cells

In previous studies, SEMA5A has been identified as a biomarker, and to suppress the proliferation and migration of lung adenocarcinoma cells (13,14). The present study first examined the effects of different SEMA5A domains on the progression of lung adenocarcinoma in A549 and H1299 cells. Total RNA was extracted at 24 h after the transfection of plasmids encoding different SEMA5A constructs, including 5A-Full, 5A-ECD and 5A-ICD. After successful overexpression of these constructs as demonstrated by RT-qPCR (Fig. 1A and B), in vitro functional assays were performed in both A549 and H1299 cells. The results demonstrated that 5A-Full and 5A-ECD, but not 5A-ICD, significantly (P<0.05) inhibited cell proliferation in MTT assays (Fig. 1C and D) and cell migration at 24 h in gap closure assays (Fig. 1E-H) compared with empty control in both A549 and H1299 cells. Additionally, the 5A-ECD construct significantly (P<0.05) decreased the colony formation of A549 cells, and the two constructs significantly (P<0.05) decreased the colony formation of H1299 cells (Fig. 1I-L). However, the results of flow cytometry revealed no significant difference in the effect of different SEMA5A domains on the cell cycle distribution and apoptosis, and no significant alterations of cleaved caspase-3 were observed in A549 and H1299 cells overexpressing different SEMA5A domains (Fig. S2). These results supported the proposed tumor-suppressive role of 5A-Full in lung adenocarcinoma cells and also revealed that the extracellular domain of SEMA5A contributed to the tumor-suppressive role.

Figure 1.

5A-Full and 5A-ECD suppress the proliferation and migration of lung adenocarcinoma cells. A549 and H1299 lung adenocarcinoma cells were transfected with plasmids containing different SEMA5A domains, including 5A-Full, 5A-ECD, 5A-ICD and empty control plasmid. Relative expression levels of SEMA5A in (A) A549 and (B) H1299 lung adenocarcinoma cells overexpressing different SEMA5A domains examined by reverse transcription-quantitative PCR. GAPDH was used as the internal control. Proliferation of (C) A549 and (D) H1299 cells expressing different domains of SEMA5A assessed using MTT assays. (E and F) Gap closure assays. Representative images were captured at 0, 12 and 24 h for (E) A549 and (F) H1299 cells. Scale bar, 0.1 mm. Quantification of relative gap closure of (G) A549 and (H) H1299 cells. The percentage of wound closure was compared with the wound area at 0 h. (I and J) Colony formation assays. Representative images were captured for (I) A549 and (J) H1299 cells. (K and L) Quantification of colony counts of colony formation assays of (K) A549 and (L) H1299 cells. Experiments were repeated in triplicate, and the results are presented as the mean ± SD. Two-way ANOVA and Bonferroni post hoc test were performed for (C and D); one-way ANOVA and Bonferroni post hoc test were performed for (A, B, G, H, K and L). *P<0.05 vs. Empty. 5A-ECD, SEMA5A extracellular domain; 5A-Full, SEMA5A full length; 5A-ICD, SEMA5A intracellular domain; SEMA5A, semaphorin 5A.

Identification of genes regulated by SEMA5A domains in A549 cells by microarray analysis

To further investigate the functional roles of different SEMA5A domains, the gene expression profiles of A549 cells overexpressing different SEMA5A domains were examined using Illumina Human HT-12 v4 BeadChips. To select the differential gene expression, the filtering criteria were set at a fold change ≥1.5 or ≤0.67 and P<0.05 compared with the empty control. Principal component analysis was used to examine the reproducibility among samples. As shown in Fig. 2A, where each dot represents one sample, and the different colors represent different groups, the groups expressing different SEMA5A domains were separated clearly from the empty control group and from each other; however, the samples within each group were clustered together. This indicated high reproducibility within the same group and different expression profiling across groups.

Figure 2.

Identification of genes regulated by SEMA5A domains in A549 cells by microarray analysis. (A) Principal component analysis of A549 cells overexpressing different SEMA5A domains. Principal components were plotted using expression of differentially expressed probes after quantile normalization. Each dot represents one sample. (B-D) Volcano plots of DEGs in A549 cells overexpressing (B) 5A-Full, (C) 5A-ECD or (D) 5A-ICD. Dashed lines show the thresholds of fold change (≥1.5 or ≤0.67) and P-value (<0.05). Red, upregulated genes; green, downregulated genes. (E) Venn diagram of DEGs in cells expressing different SEMA5A domains. (F) Heatmap and hierarchical cluster analysis of DEGs regulated by different SEMA5A domains. Each column represents one sample and each row represents one gene. Red, upregulated genes; green, downregulated genes. The black lines indicated representative genes involved in interferon signaling pathways. Unpaired Student's t-tests were utilized to identify DEGs. 5A-ECD, SEMA5A extracellular domain; 5A-Full, SEMA5A full length; 5A-ICD, SEMA5A intracellular domain; DEGs, differentially expressed genes; PC, principal component; SEMA5A, semaphorin 5A.

A total of 165 DEGs were identified when comparing any 5A group with the empty group, including 46 DEGs in the 5A-Full group, 126 in the 5A-ECD group and 67 in the 5A-ICD group (Fig. 2B-D). Among these genes, 19 DEGs were common to all the groups expressing different SEMA5A domains, and there were 38 unique DEGs for the 5A-ICD group and 71 for the 5A-ECD group (Fig. 2E). The DEGs in the 5A-Full group were almost identical to those in the 5A-ECD group, except nucleolar protein with MIF4G domain 1 (Fig. 2E). The common gene list is shown in Table SII. All 165 DEGs were hierarchically clustered and shown in a heatmap (Fig. 2F). In general, the expression profiling of genes in the 5A-Full group was more similar to that of the 5A-ECD group than that of the 5A-ICD group.

Next, to analyze which pathways the DEGs were involved in, Ingenuity Pathway Analysis was used to analyze the functions of DEGs in the different SEMA5A groups. The top four canonical pathways that the different SEMA5A domains were involved in were ‘Interferon Signaling’, ‘Activation of IRF by Cytosolic Pattern Recognition Receptor’, ‘Systemic Lupus Erythematosus in B cell Signaling Pathway’ and ‘Role of PKR in Interferon Induction and Antiviral Response’ (Fig. 3A, C and E). The corresponding molecular and cellular functions that different SEMA5A domains were possibly involved in included ‘Cell Signaling’, ‘Gene Expression’, ‘Cellular Development’, ‘Cellular Movement’, ‘Cellular Growth and Proliferation’, ‘Cell-To-Cell Signaling and Interaction’ and ‘Cell Death and Survival’ (Fig. 3B, D and F).

Figure 3.

Ingenuity Pathway Analysis of DEGs regulated by different SEMA5A domains. (A, C and E) Top four canonical pathways of DEGs in A549 cells overexpressing (A) 5A-Full, (C) 5A-ECD or (E) 5A-ICD. The significance of pathways was determined according to Ingenuity's default threshold (−log(P-value) >1.3). Fisher's Exact test was utilized to identify canonical pathways that DEGs were enriched(B, D and F) Molecular and cellular functions of DEGs in A549 cells overexpressing (B) 5A-Full, (D) 5A-ECD or (F) 5A-ICD. 5A-ECD, SEMA5A extracellular domain; 5A-Full, SEMA5A full length; 5A-ICD, SEMA5A intracellular domain; DEGs, differentially expressed genes; IRF, interferon regulatory factor; PKR, protein kinase R; SEMA5A, semaphorin 5A.

Expression levels of tumor suppressor genes in the interferon signaling pathway are upregulated by different SEMA5A domains

Since the DEGs were most likely involved in the interferon signaling pathway, relative expression levels of selected differentially expressed genes were compiled in Tables II and SIII. Selected genes in the interferon signaling pathways are also shown in Fig. 2F. The present study further investigated the DEGs in this pathway and validated their expression by RT-qPCR. Fig. 4A-C shows the schematic representation of the interferon signaling network from the Ingenuity Pathways Analysis canonical pathway. The DEGs in the 5A-Full group were similar to those in 5A-ECD group. In contrast to 5A-Full and 5A-ECD, overexpression of 5A-ICD did not affect STAT2 or a number of the nuclear elements of the interferon signaling pathway (e.g., STAT1 and IFIT3).

Figure 4.

Expression levels of tumor suppressor genes in the interferon signaling pathway are upregulated by different SEMA5A domains. (A) Schematic depiction of the canonical pathway of interferon signaling, colored according to gene expression in the presence of 5A-Full. The darkness of red color indicates the fold change of each gene. (B) Schematic depiction of the canonical pathway of interferon signaling, colored according to gene expression in the presence of 5A-ECD. (C) Schematic depiction of the canonical pathway of interferon signaling, colored according to gene expression in the presence of 5A-ICD. (D) Relative expression levels of JAK1, JAK2 and TYK2 examined by RT-qPCR in A549 cells overexpressing different SEMA5A domains. (E) Relative expression levels of JAK1, JAK2 and TYK2 examined by RT-qPCR in H1299 cells overexpressing different SEMA5A domains. (F) Relative expression levels of STAT1, STAT2 and IRF9 in A549 cells overexpressing different SEMA5A domains. (G) Relative expression levels of STAT1, STAT2 and IRF9 in H1299 cells overexpressing different SEMA5A domains. (H) Relative expression levels of IFIT1, G1P2, G1P3, IFITM1, IFITM2 and IFITM3 in A549 cells overexpressing different SEMA5A domains. (I) Relative expression levels of IFIT1, G1P2, G1P3, IFITM1, IFITM2 and IFITM3 in H1299 cells overexpressing different SEMA5A domains. GAPDH: internal control. Experiments were repeated in triplicate, and the results are presented as the mean ± SD. One-way ANOVA and Bonferroni post hoc test were performed. *P<0.05 vs. empty control. #P<0.05 vs. 5A-ICD. 5A-ECD, SEMA5A extracellular domain; 5A-Full, SEMA5A full length; 5A-ICD, SEMA5A intracellular domain; G1P, glycogenin 1 pseudogene; IFIT1, interferon induced protein with tetratricopeptide repeats 1; IFITM, interferon induced transmembrane protein; IRF9, interferon regulatory factor 9; JAK, Janus kinase; Log2FC, log2 fold change; RT-qPCR, reverse transcription-quantitative PCR; SEMA5A, semaphorin 5A; TYK2, tyrosine kinase 2.

To validate the expression levels of DEGs regulated by different SEMA5A domains in the interferon signaling pathway, RT-qPCR was performed to examine mRNA levels focusing on tumor suppressor genes identified in previous reports (32–39). The expression levels of interferon receptor-associated genes, such as Janus kinase 1 (JAK1), Janus kinase 2 (JAK2) and tyrosine kinase 2, were not significantly different in the various SEMA5A-expressing cells compared with the empty controls (Fig. 4D and E).

Overexpression of 5A-Full and 5A-ECD increases the amount of phosphorylated STAT1 in A549 cells

STAT1 and STAT2 have been previously identified to form heterodimers along with the DNA binding protein interferon regulatory factor 9 (IRF9) (40), and the transcription levels of these three proteins were significantly increased in A549 and H1299 cells overexpressing 5A-Full and 5A-ECD compared with the empty control cells (Fig. 4F and G). In addition, the expression levels of STAT1 and STAT2 were significantly different between cells expressing 5A-Full and 5A-ECD and cells expressing 5A-ICD (Fig. 4F and G).

Regarding STAT1/2 downstream genes, the expression levels of tumor suppressor genes interferon induced protein with tetratricopeptide repeats 1 (IFIT1) and glycogenin 1 pseudogene (G1P2) in A549 and H1299 cells overexpressing 5A-Full and 5A-ECD were significantly increased compared with the empty control group (Fig. 4H and I). In A549 cells, IFIT1 expression was significantly increased in cells overexpressing 5A-Full and 5A-ECD compared with cells overexpressing 5A-ICD (Fig. 4H). In H1299 cells, G1P2 expression was significantly increased in cells overexpressing 5A-Full and 5A-ECD compared with cells overexpressing 5A-ICD (Fig. 4I). In addition, the expression levels of the identified oncogene G1P3 were significantly decreased in A549 cells overexpressing the different SEMA5A domains, especially in the 5A-Full and 5A-ECD groups (Fig. 4H). However, no significant differences were observed in H1299 cells (Fig. 4I). Other genes, including interferon induced transmembrane protein (IFITM)1 and IFITM3, were significantly upregulated (Fig. 4H and I) in both A549 and H1299 cells.

The pattern of differential gene expression in the presence of different SEMA5A domains indicated that the expression levels of differentially expressed genes in the presence of 5A-Full were similar to those in the presence of 5A-ECD, and the expression levels of STAT1 and STAT2 in the presence of 5A-ICD were significantly lower compared with those in the 5A-Full and 5A-ECD groups. These results suggested that overexpressing 5A-ECD may have similar effects to overexpressing 5A-Full in terms of a tumor-suppressing role in lung adenocarcinoma.

Furthermore, the protein expression levels of the DEGs were examined by western blotting. The overexpression of 5A-Full and 5A-ECD was validated by western blotting (Fig. 5A and B) and the SEMA5A protein expression was significantly increased compared with the empty control group (Fig. 5C and D). The total and phosphorylated protein expression levels of JAK1, JAK2, STAT1 and STAT2 were examined in A549 cells (Fig. 5E) and H1299 cells (Fig. 5G). Additionally, IFIT1 and G1P2, STAT1/2 downstream targets, were examined in A549 cells (Fig. 5E) and H1299 cells (Fig. 5G). Cells overexpressing 5A-Full and 5A-ECD exhibited significantly increased ratios of phosphorylated STAT1 to total STAT1 in A549 cells, and an increased ratio of phosphorylated STAT2 to total STAT2 in H1299 cells. Additionally, the expression levels of its downstream targets IFIT1 and G1P2 increased in both A549 and H1299 cells compared with empty control cells (Fig. 5E-H), which indicated that the tumor-suppressive effect of 5A-Full or 5A-ECD was due to activation of STAT1 in the interferon signaling pathway.

Figure 5.

Overexpression of 5A-Full and 5A-ECD increases the amount of phosphorylated STAT1 in A549 cells. (A) Western blotting of total lysates from A549 cells overexpressing 5A-Full. (B) Western blotting of total lysates from H1299 cells overexpressing 5A-Full or 5A-ECD. (C) Semi-quantification of SEMA5A from the conditions of (A). (D) Semi-quantification of SEMA5A from the conditions of (B). (E) Relative protein expression levels of differentially expressed genes examined by western blotting in A549 cells. GAPDH or ACTB was used as the loading control. (F) Semi-quantification of p-STAT1, p-STAT2, p-JAK1, p-JAK2, IFIT1 and G1P2 in A549 cells. Each phosphorylated protein was normalized to its respective total protein, i.e., p-STAT1 was normalized to t-STAT1, p-STAT2 to t-STAT2, p-JAK1 to t-JAK1 and p-JAK2 to t-JAK2. IFIT1 and G1P2 were normalized to ACTB. (G) Relative protein expression levels of differentially expressed genes examined by western blotting in H1299 cells. ACTB was used as the loading control. (H) Semi-quantification of p-STAT1, IFIT1 and G1P2 in H1299 cells. Each phosphorylated protein was normalized to its respective total protein, i.e., p-STAT1 was normalized to t-STAT1, p-STAT2 to t-STAT2, p-JAK1 to t-JAK1 and p-JAK2 to t-JAK2. IFIT1 and G1P2 were normalized to ACTB. Experiments were repeated in triplicate, and the results are presented as the mean ± SD. One-way ANOVA and Bonferroni post hoc test were performed. *P<0.05 vs. Empty. 5A-ECD, SEMA5A extracellular domain; 5A-Full, SEMA5A full length; ACTB, actin β; G1P2, glycogenin 1 pseudogene 2; IFIT1, interferon induced protein with tetratricopeptide repeats 1; JAK, Janus kinase; p, phosphorylated; SEMA5A, semaphorin 5A; t, total.

Discussion

The present investigation of the tumor-suppressive mechanism of SEMA5A in lung adenocarcinoma cells revealed that overexpression of the full-length protein or the extracellular domain inhibited the proliferation and migration of both A549 and H1299 cells. Genes subject to the regulation of different SEMA5A domains were identified by microarray analysis. Among the DEGs, the most significant function of these genes was the ‘Interferon Signaling’ pathway. RT-qPCR demonstrated that the expression levels of several genes in this pathway, including STAT1, STAT2, IRF9, IFIT1, G1P2 and IFITM1, were increased in cells expressing 5A-Full and 5A-ECD compared with the empty control group. These upregulated suppressors decreased tumor malignancy as demonstrated by the results of functional assays. Overexpression of 5A-Full or 5A-ECD inhibited the proliferation and migration of lung adenocarcinoma cells via the interferon signaling pathway.

In previous studies, SEMA5A has been identified as a tumor suppressor in lung adenocarcinoma (13,14). The present study investigated the functional role of different domains of SEMA5A. The extracellular domain has been reported to be involved in angiogenesis (41). The expression of the extracellular domain increases both proliferation and anti-apoptosis abilities in endothelial cells (30). Furthermore, pancreatic cells transfected with the extracellular domain of SEMA5A exhibit higher metastatic potential (42). These results implied that the extracellular domain of SEMA5A has the potential to initiate carcinogenesis. However, our previous studies revealed that SEMA5A expression was decreased in lung cancer cells, suggesting a tumor-suppressive role (13,14). While most cancer genes are characterized as either oncogenes or tumor suppressors, some genes, such as BRCA1, enhancer of zeste 2 polycomb repressive complex 2 subunit, NOTCH1, NOTCH2, STAT3 and TP53, have been demonstrated to display dual oncogenic and tumor suppressive functions (43,44). Therefore, it was hypothesized that SEMA5A has a dual oncogenic and tumor suppressor role in different types of cancer.

To further investigate the mechanism of the suppressive effects of SEMA5A in lung cancer cells, cellular functional assays were performed in A549 and H1299 cells overexpressing different SEMA5A domains. The results demonstrated that overexpressing 5A-ECD had the same effects as overexpressing 5A-Full. These two overexpression groups could inhibit the cell proliferation, colony formation and migration but had no effect on apoptosis and cell cycle progression. These results may indicate that the tumor-suppressive effects of SEMA5A are restricted to cell proliferation, and it does not have a marked effect on cell death or the cell cycle. By contrast, overexpression of 5A-ICD did not have the same tumor-suppressing effects. This demonstrated that the extracellular domain, not the intracellular domain, of SEMA5A serves the major role in inhibiting the malignancy of lung adenocarcinoma.

The present study subsequently explored the downstream genes regulated by different domains of SEMA5A by microarray analysis. The DEGs in cells expressing 5A-Full were almost identical to those in cells expressing 5A-ECD. Most of them were involved in the ‘Interferon Signaling’ pathway. Of the 19 DEGs common to cells overexpressing the different SEMA5A domains, 5 of them, including STAT1, STAT2, IRF9, G1P2 (ISG15) and IFIT1, were in the interferon signaling pathway. Such The results of the DEGs of 5A-Full were almost identical to those of 5A-ECD, which was in line with our expectations; because ECD accounted for almost 90% of the total length, the DEGs were similar. However, the DEGs between the 5A-Full group and the 5A-ICD group were less similar. The discrepancy may be due to constructs of different domains changing the protein structure, which may lead to activation of different genes. Additionally, interplay of different domains of SEMA may change the affected genes. For example, our previous study revealed that the extracellular SEMA domain could attenuate intracellular apoptotic signaling of SEMA6A in lung cancer cells (26).

The interferon signaling pathway has been reported to have anti-proliferative, anti-angiogenic, pro-apoptotic and immunoregulatory effects in non-small cell lung cancer (37). The increase of IFN-α/β could induce STAT1/STAT2 heterodimerization with IRF9, leading to the suppression of tumor growth (45). STAT1 has been reported to improve therapeutic effects of interferons on lung cancer cells (32). STAT2 has been demonstrated to share the anti-viral, immunomodulatory, anti-apoptotic and anti-proliferative effects of IFN-I (36). IRF9 has been identified to decrease cell proliferation and inhibit tumor formation (35). In the present study, the expression levels of STAT1, STAT2 and IRF9 were increased in cells overexpressing 5A-Full or 5A-ECD in both A549 and H1299 cells, as were the levels of phosphorylated STAT1 in A549 cells, which revealed a tumor-suppressing mechanism in lung cancer cells.

Furthermore, IFIT1 has been reported to be a predictive biomarker, and to suppress proliferation and promote apoptosis in cancer cells (39), and G1P2 (ISG15) has been identified to promote ubiquitin E3 ligase activity and inhibit lung cancer cell proliferation in response to type I interferon (38). The present results demonstrated that the mRNA and protein expression levels IFIT1 and G1P2 were increased in cells overexpressing 5A-Full and 5A-ECD. Overall, these results demonstrated that the extracellular domain of SEMA5A serves a similar tumor-suppressive role as full length SEMA5A in regulating the interferon signaling pathway in lung adenocarcinoma. These results may contribute to the development of a more specific therapeutic regime to treat lung adenocarcinoma.

Supplementary Material

Supporting Data
Supporting Data

Acknowledgements

The authors would like to thank Dr Melissa Stauffer for editorial assistance. The authors also benefited from the technical assistance of Dr Li-Ting Jang (Biomedical Resource Core at the 1st Core Facility Lab, NTU College of Medicine, Taipei, Taiwan).

Funding

The present study was supported by grants from the Ministry of Science and Technology (grant no. MOST 109-2320-B-002-016-MY3) and National Taiwan University Hospital (grant no. MS441). The funding source had no role in the design of this study and will not have any role in its execution or analysis, interpretation of the data, or the decision to publish the results.

Availability of data and materials

The microarray datasets generated during the current study are available in the Gene Expression Omnibus repository (https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE157062). All other data generated or analyzed during this study are included in this published article.

Authors' contributions

MZC, HHH and LCL conceived and designed the experiments. MZC, LYS and MHH performed the experiments. MZC, PHK, LLC and TPL analyzed the data. LHC, EYC, LPC and MHT contributed reagents, materials and/or analysis tools, interpreted data and revised the manuscript critically for important intellectual content. MZC, LYS, MHH and LCL confirmed the authenticity of all the raw data. MZC and LCL wrote the paper. All authors have read and approved the final manuscript, and agreed to be accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved.

Ethics approval and consent to participate

The gene recombinant/infectious biological materials experiments were approved by the Biosafety Committee of the College of Medicine, National Taiwan University (BG1050086; Taipei, Taiwan).

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA and Jemal A: Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 68:394–424. 2018. View Article : Google Scholar : PubMed/NCBI

2 

Torre LA, Siegel RL and Jemal A: Lung cancer statistics. In: Lung cancer and personalized medicine. Springer. (New York, NY). 1–19. 2016.

3 

Molina JR, Yang P, Cassivi SD, Schild SE and Adjei AA: Non-small cell lung cancer: Epidemiology, risk factors, treatment, and survivorship. Mayo Clin Proc. 83:584–594. 2008. View Article : Google Scholar : PubMed/NCBI

4 

Ettinger DS, Akerley W, Bepler G, Blum MG, Chang A, Cheney RT, Chirieac LR, D'Amico TA, Demmy TL, Ganti AK, et al: Non-small cell lung cancer. J Natl Compr Canc Netw. 8:740–801. 2010. View Article : Google Scholar : PubMed/NCBI

5 

Chang JS, Chen LT, Shan YS, Lin SF, Hsiao SY, Tsai CR, Yu SJ and Tsai HJ: Comprehensive analysis of the incidence and survival patterns of lung cancer by histologies, including rare subtypes, in the era of molecular medicine and targeted therapy: A nation-wide cancer registry-based study from Taiwan. Medicine (Baltimore). 94:e9692015. View Article : Google Scholar : PubMed/NCBI

6 

Ger LP, Liou SH, Shen CY, Kao SJ and Chen KT: Risk factors of lung cancer. J Formos Med Assoc. 91 (Suppl 3):S222–S231. 1992.(In Japanese). PubMed/NCBI

7 

Hirayasu T, Iwamasa T, Kamada Y, Koyanagi Y, Usuda H and Genka K: Human papillomavirus DNA in squamous cell carcinoma of the lung. J Clin Pathol. 49:810–817. 1996. View Article : Google Scholar : PubMed/NCBI

8 

Yamamoto H, Shigematsu H, Nomura M, Lockwood WW, Sato M, Okumura N, Soh J, Suzuki M, Wistuba II, Fong KM, et al: PIK3CA mutations and copy number gains in human lung cancers. Cancer Res. 68:6913–6921. 2008. View Article : Google Scholar : PubMed/NCBI

9 

Eberhard DA, Johnson BE, Amler LC, Goddard AD, Heldens SL, Herbst RS, Ince WL, Jänne PA, Januario T, Johnson DH, et al: Mutations in the epidermal growth factor receptor and in KRAS are predictive and prognostic indicators in patients with non-small-cell lung cancer treated with chemotherapy alone and in combination with erlotinib. J Clin Oncol. 23:5900–5909. 2005. View Article : Google Scholar : PubMed/NCBI

10 

Shigematsu H, Lin L, Takahashi T, Nomura M, Suzuki M, Wistuba II, Fong KM, Lee H, Toyooka S, Shimizu N, et al: Clinical and biological features associated with epidermal growth factor receptor gene mutations in lung cancers. J Natl Cancer Inst. 97:339–346. 2005. View Article : Google Scholar : PubMed/NCBI

11 

Toyooka S, Tsuda T and Gazdar AF: The TP53 gene, tobacco exposure, and lung cancer. Hum Mutat. 21:229–239. 2003. View Article : Google Scholar : PubMed/NCBI

12 

Hainaut P and Pfeifer GP: Patterns of p53 G->T transversions in lung cancers reflect the primary mutagenic signature of DNA-damage by tobacco smoke. Carcinogenesis. 22:367–374. 2001. View Article : Google Scholar : PubMed/NCBI

13 

Lu TP, Tsai MH, Lee JM, Hsu CP, Chen PC, Lin CW, Shih JY, Yang PC, Hsiao CK, Lai LC and Chuang EY: Identification of a novel biomarker, SEMA5A, for non-small cell lung carcinoma in nonsmoking women. Cancer Epidemiol Biomarkers Prev. 19:2590–2597. 2010. View Article : Google Scholar : PubMed/NCBI

14 

Ko PH, Lenka G, Chen YA, Chuang EY, Tsai MH, Sher YP and Lai LC: Semaphorin 5A suppresses the proliferation and migration of lung adenocarcinoma cells. Int J Oncol. 56:165–177. 2020.PubMed/NCBI

15 

Unified nomenclature for the semaphorins/collapsins. Semaphorin Nomenclature Committee. Cell. 97:551–552. 1999. View Article : Google Scholar : PubMed/NCBI

16 

Gherardi E, Love CA, Esnouf RM and Jones EY: The sema domain. Curr Opin Struct Biol. 14:669–678. 2004. View Article : Google Scholar : PubMed/NCBI

17 

Hota PK and Buck M: Plexin structures are coming: Opportunities for multilevel investigations of semaphorin guidance receptors, their cell signaling mechanisms, and functions. Cell Mol Life Sci. 69:3765–3805. 2012. View Article : Google Scholar : PubMed/NCBI

18 

Pasterkamp RJ and Giger RJ: Semaphorin function in neural plasticity and disease. Curr Opin Neurobiol. 19:263–274. 2009. View Article : Google Scholar : PubMed/NCBI

19 

Delaire S, Elhabazi A, Bensussan A and Boumsell L: CD100 is a leukocyte semaphorin. Cell Mol Life Sci. 54:1265–1276. 1998. View Article : Google Scholar : PubMed/NCBI

20 

Bougeret C, Mansur IG, Dastot H, Schmid M, Mahouy G, Bensussan A and Boumsell L: Increased surface expression of a newly identified 150-kDa dimer early after human T lymphocyte activation. J Immunol. 148:318–323. 1992.PubMed/NCBI

21 

Gitler AD, Lu MM and Epstein JA: PlexinD1 and semaphorin signaling are required in endothelial cells for cardiovascular development. Dev Cell. 7:107–116. 2004. View Article : Google Scholar : PubMed/NCBI

22 

Hayashi M, Nakashima T, Taniguchi M, Kodama T, Kumanogoh A and Takayanagi H: Osteoprotection by semaphorin 3A. Nature. 485:69–74. 2012. View Article : Google Scholar : PubMed/NCBI

23 

Roche J, Boldog F, Robinson M, Varella-Garcia M, Swanton M, Waggoner B, Fishel R, Franklin W, Gemmill R, Drabkin H, et al: Distinct 3p21.3 deletions in lung cancer and identification of a new human semaphorin. Oncogene. 12:1289–1297. 1996.PubMed/NCBI

24 

Basile JR, Castilho RM, Williams VP and Gutkind JS: Semaphorin 4D provides a link between axon guidance processes and tumor-induced angiogenesis. Proc Natl Acad Sci USA. 103:9017–9022. 2006. View Article : Google Scholar : PubMed/NCBI

25 

Tomizawa Y, Sekido Y, Kondo M, Gao B, Yokota J, Roche J, Drabkin H, Lerman MI, Gazdar AF and Minna JD: Inhibition of lung cancer cell growth and induction of apoptosis after reexpression of 3p21. 3 candidate tumor suppressor gene SEMA3B. Proc Natl Acad Sci USA. 98:13954–13959. 2001. View Article : Google Scholar : PubMed/NCBI

26 

Shen CY, Chang YC, Chen LH, Lin WC, Lee YH, Yeh ST, Chen HK, Fang W, Hsu CP, Lee JM, et al: The extracellular SEMA domain attenuates intracellular apoptotic signaling of semaphorin 6A in lung cancer cells. Oncogenesis. 7:952018. View Article : Google Scholar : PubMed/NCBI

27 

Li X and Lee AY: Semaphorin 5A and plexin-B3 inhibit human glioma cell motility through RhoGDIalpha-mediated inactivation of Rac1 GTPase. J Biol Chem. 285:32436–32445. 2010. View Article : Google Scholar : PubMed/NCBI

28 

Sadanandam A, Sidhu SS, Wullschleger S, Singh S, Varney ML, Yang CS, Ashour AE, Batra SK and Singh RK: Secreted semaphorin 5A suppressed pancreatic tumour burden but increased metastasis and endothelial cell proliferation. Br J Cancer. 107:501–507. 2012. View Article : Google Scholar : PubMed/NCBI

29 

Saxena S, Purohit A, Varney ML, Hayashi Y and Singh RK: Semaphorin-5A maintains epithelial phenotype of malignant pancreatic cancer cells. BMC Cancer. 18:12832018. View Article : Google Scholar : PubMed/NCBI

30 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

31 

Sturn A, Quackenbush J and Trajanoski Z: Genesis: Cluster analysis of microarray data. Bioinformatics. 18:207–208. 2002. View Article : Google Scholar : PubMed/NCBI

32 

Chen J, Zhao J, Chen L, Dong N, Ying Z, Cai Z, Ji D, Zhang Y, Dong L, Li Y, et al: STAT1 modification improves therapeutic effects of interferons on lung cancer cells. J Transl Med. 13:2932015. View Article : Google Scholar : PubMed/NCBI

33 

Cheriyath V, Kaur J, Davenport A, Khalel A, Chowdhury N and Gaddipati L: G1P3 (IFI6), a mitochondrial localised antiapoptotic protein, promotes metastatic potential of breast cancer cells through mtROS. Br J Cancer. 119:52–64. 2018. View Article : Google Scholar : PubMed/NCBI

34 

Gao M, Lin Y, Liu X, Li Y, Zhang C, Wang Z, Wang Z, Wang Y and Guo Z: ISG20 promotes local tumor immunity and contributes to poor survival in human glioma. Oncoimmunology. 8:e15340382019. View Article : Google Scholar : PubMed/NCBI

35 

Luker KE, Pica CM, Schreiber RD and Piwnica-Worms D: Overexpression of IRF9 confers resistance to antimicrotubule agents in breast cancer cells. Cancer Res. 61:6540–6547. 2001.PubMed/NCBI

36 

Park C, Li S, Cha E and Schindler C: Immune response in Stat2 knockout mice. Immunity. 13:795–804. 2000. View Article : Google Scholar : PubMed/NCBI

37 

Wilderman MJ, Sun J, Jassar AS, Kapoor V, Khan M, Vachani A, Suzuki E, Kinniry PA, Sterman DH, Kaiser LR and Albelda SM: Intrapulmonary IFN-β gene therapy using an adenoviral vector is highly effective in a murine orthotopic model of bronchogenic adenocarcinoma of the lung. Cancer Res. 65:8379–8387. 2005. View Article : Google Scholar : PubMed/NCBI

38 

Yoo L, Yoon AR, Yun CO and Chung KC: Covalent ISG15 conjugation to CHIP promotes its ubiquitin E3 ligase activity and inhibits lung cancer cell growth in response to type I interferon. Cell Death Dis. 9:972018. View Article : Google Scholar : PubMed/NCBI

39 

Zhang JF, Chen Y, Lin GS, Zhang JD, Tang WL, Huang JH, Chen JS, Wang XF and Lin ZX: High IFIT1 expression predicts improved clinical outcome, and IFIT1 along with MGMT more accurately predicts prognosis in newly diagnosed glioblastoma. Hum Pathol. 52:136–144. 2016. View Article : Google Scholar : PubMed/NCBI

40 

Ghislain JJ, Wong T, Nguyen M and Fish EN: The interferon-inducible stat2: Stat1 heterodimer preferentially binds in vitro to a consensus element found in the promoters of a subset of interferon-stimulated genes. J Interferon Cytokine Res. 21:379–388. 2001. View Article : Google Scholar : PubMed/NCBI

41 

Sadanandam A, Rosenbaugh EG, Singh S, Varney M and Singh RK: Semaphorin 5A promotes angiogenesis by increasing endothelial cell proliferation, migration, and decreasing apoptosis. Microvasc Res. 79:1–9. 2010. View Article : Google Scholar : PubMed/NCBI

42 

Sadanandam A, Varney ML, Singh S, Ashour AE, Moniaux N, Deb S, Lele SM, Batra SK and Singh RK: High gene expression of semaphorin 5A in pancreatic cancer is associated with tumor growth, invasion and metastasis. Int J Cancer. 127:1373–1383. 2010. View Article : Google Scholar : PubMed/NCBI

43 

Aranko AS, Oeemig JS, Kajander T and Iwaï H: Intermolecular domain swapping induces intein-mediated protein alternative splicing. Nat Chem Biol. 9:616–622. 2013. View Article : Google Scholar : PubMed/NCBI

44 

Shen L, Shi Q and Wang W: Double agents: Genes with both oncogenic and tumor-suppressor functions. Oncogenesis. 7:252018. View Article : Google Scholar : PubMed/NCBI

45 

Fink K and Grandvaux N: STAT2 and IRF9: Beyond ISGF3. JAKSTAT. 2:e275212013.PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Chen M, Su L, Ko P, Hsu M, Chuang L, Chen L, Lu T, Chuang EY, Chow L, Tsai M, Tsai M, et al: Extracellular domain of semaphorin 5A serves a tumor‑suppressing role by activating interferon signaling pathways in lung adenocarcinoma cells. Int J Oncol 60: 21, 2022.
APA
Chen, M., Su, L., Ko, P., Hsu, M., Chuang, L., Chen, L. ... Lai, L. (2022). Extracellular domain of semaphorin 5A serves a tumor‑suppressing role by activating interferon signaling pathways in lung adenocarcinoma cells. International Journal of Oncology, 60, 21. https://doi.org/10.3892/ijo.2022.5311
MLA
Chen, M., Su, L., Ko, P., Hsu, M., Chuang, L., Chen, L., Lu, T., Chuang, E. Y., Chow, L., Tsai, M., Hsu, H., Lai, L."Extracellular domain of semaphorin 5A serves a tumor‑suppressing role by activating interferon signaling pathways in lung adenocarcinoma cells". International Journal of Oncology 60.2 (2022): 21.
Chicago
Chen, M., Su, L., Ko, P., Hsu, M., Chuang, L., Chen, L., Lu, T., Chuang, E. Y., Chow, L., Tsai, M., Hsu, H., Lai, L."Extracellular domain of semaphorin 5A serves a tumor‑suppressing role by activating interferon signaling pathways in lung adenocarcinoma cells". International Journal of Oncology 60, no. 2 (2022): 21. https://doi.org/10.3892/ijo.2022.5311
Copy and paste a formatted citation
x
Spandidos Publications style
Chen M, Su L, Ko P, Hsu M, Chuang L, Chen L, Lu T, Chuang EY, Chow L, Tsai M, Tsai M, et al: Extracellular domain of semaphorin 5A serves a tumor‑suppressing role by activating interferon signaling pathways in lung adenocarcinoma cells. Int J Oncol 60: 21, 2022.
APA
Chen, M., Su, L., Ko, P., Hsu, M., Chuang, L., Chen, L. ... Lai, L. (2022). Extracellular domain of semaphorin 5A serves a tumor‑suppressing role by activating interferon signaling pathways in lung adenocarcinoma cells. International Journal of Oncology, 60, 21. https://doi.org/10.3892/ijo.2022.5311
MLA
Chen, M., Su, L., Ko, P., Hsu, M., Chuang, L., Chen, L., Lu, T., Chuang, E. Y., Chow, L., Tsai, M., Hsu, H., Lai, L."Extracellular domain of semaphorin 5A serves a tumor‑suppressing role by activating interferon signaling pathways in lung adenocarcinoma cells". International Journal of Oncology 60.2 (2022): 21.
Chicago
Chen, M., Su, L., Ko, P., Hsu, M., Chuang, L., Chen, L., Lu, T., Chuang, E. Y., Chow, L., Tsai, M., Hsu, H., Lai, L."Extracellular domain of semaphorin 5A serves a tumor‑suppressing role by activating interferon signaling pathways in lung adenocarcinoma cells". International Journal of Oncology 60, no. 2 (2022): 21. https://doi.org/10.3892/ijo.2022.5311
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team