Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
April-2018 Volume 17 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
April-2018 Volume 17 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Novel TRERF1 mutations in Chinese patients with ovarian endometriosis

  • Authors:
    • Bianna Cao
    • Yuanfeng Zeng
    • Fei Wu
    • Jun Liu
    • Zeliang Shuang
    • Xiaoyun Xu
    • Jiubai Guo
  • View Affiliations / Copyright

    Affiliations: Department of Gynecology, Jiangxi Provincial Maternal and Child Health Hospital, Nanchang, Jiangxi 330006, P.R. China, Department of Pathology, Jiangxi Provincial People's Hospital, Nanchang, Jiangxi 330006, P.R. China
  • Pages: 5435-5439
    |
    Published online on: January 26, 2018
       https://doi.org/10.3892/mmr.2018.8510
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Endometriosis is an estrogen-dependent precancerous lesion exhibiting frequently perturbed level of steroid hormones and transcriptional‑regulating factor 1 (TRERF1) has a crucial role in the production of steroid hormones including estrogen. Endometriosis has previously been revealed to be a precancerous lesion that harbors somatic mutations in cancer‑associated genes. Therefore, the authors of the present study hypothesize that TRERF1 aberrations may be involved in the development of endometriosis. In the present study, endometriotic lesions and paired blood samples from 92 individuals with ovarian endometriosis were analyzed for the potential presence of TRERF1 mutations by sequencing the entire coding region and the corresponding intron‑exon boundaries of the TRERF1 gene. Two heterozygous missense somatic mutations [c.3166A>C (p.K1056Q) and c.3187 G>A (p.G1063R)] in the TRERF1 gene were identified in two out of 92 ectopic endometria (2.2%), to the best of our knowledge, these mutations have not been previously reported. From the two samples with TRERF1 mutations, one sample was from a 42‑year‑old patient also diagnosed with uterine leiomyoma and the other mutation was identified in a 36‑year‑old woman exhibiting no other apparent gynecological conditions. The evolutionary conservation analysis and in silico prediction of these TRERF1 mutations suggested that they may be pathogenic. To the best of our knowledge, the present study was the first to identify 2 novel, potentially ‘disease‑causing’ TRERF1 somatic mutations in the endometriotic lesions in 2 out of 92 patients with ovarian endometriosis; therefore, TRERF1 mutations may be involved in the pathogenesis of ovarian endometriosis.

Introduction

Endometriosis is an estrogen-dependent chronic disorder that affects between 5 and 10% of women at reproductive age (1,2). It is characterized by chronic pelvic pain and subfertility or infertility, and affects the quality life of the affected individuals (3–5). Despite the progress made in elucidating the molecular etiology of endometriosis, due to heterogeneity of this disorder, there are individuals with unknown molecular/genetic alterations which are affected by endometriosis (6–9).

Endometriosis has long been considered to be closely associated with the development of ovarian endometrioid and clear cell carcinoma, and has been previously proposed to be a precancerous lesion (10–12). Previous studies further supported this hypothesis as an increasing number of genetic alterations in oncogenes and tumor suppressor genes, such as KRAS proto-oncogene GTPase, tumor protein p53, phosphatase and tensin homolog, breast cancer type 2 susceptibility protein and protein phosphatase 2 scaffold subunit Aα, have been identified in patients with endometriosis (13–15).

Transcriptional regulating factor 1 (TRERF1) acts as a zinc-finger transcriptional regulatory protein and modifies the expression of cholesterol side-chain cleavage enzyme (P450scc) (16,17). Endometriosis is frequently characterized by perturbed levels of estrogen (18,19) and diverse somatic mutations in multiple genes (14). TRERF1 may regulate the expression of P450scc, thus affecting the conversion of cholesterol to pregnenolone, which is the first and rate-limiting step in the synthesis of the steroid hormones, such as estrogen (20). The authors of the present study hypothesize that certain TRERF1 aberrations, including gene mutations, may contribute to the development of endometriosis. To verify this hypothesis, samples were collected from 92 patients with ovarian endometriosis and the entire coding region and corresponding intron-exon boundaries of TRERF1 were sequenced to analyze the potential presence of TRERF1 mutations.

Materials and methods

Samples

The ectopic endometria and paired blood samples were obtained from a total of 92 patients with ovarian endometriosis who underwent surgical resection in Jiangxi Provincial Maternal and Child Health Hospital between June 2013 and July 2014. Tissue and blood samples were stored at −80°C immediately following collection.

Clinical data

Clinical data was determined for individuals with ovarian endometriosis, including the following information: Age of diagnosis, age at the time of menarche, the serum levels of estrogen (E2), progesterone (P), cancer antigen 125 (CA125), thyroid stimulating hormone (TSH), free triiodothyronine (FT3), free thyroxine (FT4), carcinoembryonic antigen (CEA), α-fetoprotein (AFP) and squamous cell carcinoma antigen (SCCA) is presented in Table I. The levels for the aforementioned factors were determined according to the previously described protocols (21).

Table I.

Association of transcriptional-regulating factor 1 mutations with clinical characteristics in the 92 individuals with ovarian endometriosis.

Table I.

Association of transcriptional-regulating factor 1 mutations with clinical characteristics in the 92 individuals with ovarian endometriosis.

FeatureWild type (n=90)Mutant type (n=2)P-value
Age (years)   33.54±7.4539.00±4.240.31
Age of menarche (years)   13.68±1.38     14±2.830.75
E2 (pg/ml)126.65±99.1584.61±61.510.54
P (ng/ml)     1.54±3.68   0.91±0.490.81
CA125 (µ/ml)103.38±191.1357.03±14.600.73
TSH (mIU/ml)     2.60±1.25     1.90±0.430.31
FT3 (pg/ml)     3.05±0.37     3.00±0.040.87
FT4 (ng/dl)     1.29±0.13     1.30±0.060.56
CEA (ng/ml)     1.16±0.42     0.96±0.110.36
AFP (ng/ml)     2.53±1.62     3.47±0.770.43
SCC (ng/ml)     1.48±1.01     1.68±1.280.65

[i] E2, estrogen; P, progesterone; CA125, cancer antigen 125; TSH, thyroid stimulating hormone; FT3, free triiodothyronine; FT4, free thyroxine; CEA, carcinoembryonic antigen; AFP, α-fetoprotein; SCCA, squamous cell carcinoma antigen.

Compliance with ethical standards

The present study was approved by the Ethics Committee at the Jiangxi Provincial Maternal and Child Health Hospital (Nanchang, China). All procedures were performed according to the tenets of the Declaration of Helsinki. Written informed consent was obtained from each patient prior to this study.

DNA isolation, polymerase chain reaction (PCR) amplification and DNA sequencing

Genomic DNA (gDNA) was isolated from tissues and paired blood samples using a TIANamp Genomic DNA kit (cat no. DP304; Tiangen Biotech Co., Ltd., Beijing, China). The quantity and quality of the isolated gDNA was assessed by SmartSpec Plus Spectrophotometer (Bio-Rad Laboratories, Inc., Hercules, CA, USA) at a wavelength of 260 nm and 1.5% agarose gel electrophoresis with ethidium bromide staining for visualization, respectively. The entire coding sequence of the TRERF1 gene was amplified and sequenced to analyze potential somatic mutations in 92 ovarian endometriosis samples. A total of 50 ng DNA from each sample was amplified using PCR in a final volume of 30 µl containing 1.0 U of rTaq DNA polymerase (Takara Biotechnology Co., Ltd., Dalian, China), 3 µl 10X PCR buffer (Takara Biotechnology Co., Ltd. Dalian, China), 1.0 mM MgCl2, 200 µM dNTPs (Takara Biotechnology Co., Ltd., Dalian, China), 1.5 µM each primer in a Thermal Cycler 2720 (Thermo Fisher Scientific, Inc., Waltham, MA, USA). The following thermocycling conditions were used for the PCR: Initial denaturation for 5 min at 94°C, 35 cycles of 94°C for 30 sec, 52–62°C for 30 sec, and 72°C for 30 sec, and a final extension at 72°C for 8 min. The purification of the amplified PCR products was performed using TIANgel Midi Purification kit (Tiangen Biotech Co., Ltd. Beijing, China). The purified PCR products were subjected to a sequencing reaction using ABI PRISM® BigDye® Terminator v3.1 cycle Sequencing kit (Thermo Fisher Scientific, Inc.) with ABI Prism 3730 DNA sequencer (Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. The sequencing electropherograms were analyzed using DNASTAR software version 4.0 (DNASTAR, Inc., Madison, WI, USA). Somatic mutations were confirmed by sequencing DNA from paired blood samples. The PCR primer sequences for the entire coding sequence of the TRERF1 gene are listed in Table II.

Table II.

Polymerase chain reaction primer sequences for the mutation analysis of transcriptional-regulating factor 1 gene.

Table II.

Polymerase chain reaction primer sequences for the mutation analysis of transcriptional-regulating factor 1 gene.

Primer sequence (5′-3′)

ExonForwardReverseAnnealing temperature (°C)Amplicon length (bp)
5–1 GACGTCTCCTCACCACAGTG CCAGTGAAACCAGGGTGAGG55891
5–2 TCAGCAGTGATGGATGGAGC CTGACCCTGTAGCACACTGG60981
6 GGTGGTCCCAAGTCAAGGAG CACCCCAGAAAATCCTCCCC57312
7 CTCTAAAGGGCACTGGGGTG CAAGCAGCACACGACCTAGA50355
8 AAGTGCATCCCCCTTGTGAG GGGTAGGGTTCCCAATGTGG52521
9 CAACCAGAACTCGCTTTGCC GTCCCAGGACTTTACCCAGC52620
10 CACCATACTCCACCCAGCTC AGGGCTTCATGCTTTGACCA52446
11, 12 CAGTGAAAAGGCCACGTGTG CCTACCCACCGAGAGAAGGA55697
13 TCCCTCTGGGTTTCCTTCCA CACAACCGAACATGCAAGCA55279
14 GAACCCAGGTGTCAGAGCTC CCAGCGAGTGTGGAAGACAT50393
15 GGTAAGGACAGGCGTGTGAA GGCTATCTTGGCAGCAAAGC52382
16 TCCTAAGCATCCGGAGACCA CCCTCTGCCAAACTGTGACT57519
17 ACAGGATCTGTGGTTGTGGT TCCCATAGAGCGACTACCCA62457
18 AGGAGGTCCTAGAAGCCGAG TTATTTATTCCCCCAACCCCC57663

[i] bp, base pair.

Evolutionary conservation analysis

To evaluate the role of the identified TRERF1 somatic mutations, evolutionary conservation analysis of the TRERF1 protein sequence was performed. The amino acid sequences of 19 vertebrate species were obtained from GenBank database and subjected to the evolutionary conservation analysis of TRERF1, including: Homo sapiens (accession no. NP_277037.1), Pan troglodytes (accession no. XP_016810987), Macaca mulatta (accession no. XP_014991838), Cercocebus atys (accession no. XP_011928290), Mus musculus (accession no. NP_001091092), Rattus norvegicus (accession no. NP_001101669), Bos taurus (accession no. XP_010816556), Canis lupus familiaris (accession no. XP_013973919), Camelus dromedarius (accession no. XP_010977853), Equus asinus (accession no. XP_014686382), Panthera pardus (accession no. XP_019312677), Mustela putorius furo (accession no. XP_012917709), Microcebus murinus (accession no. XP_012628645), Pteropus vampyrus (accession no. XP_011352924), Gallus gallus (accession no. XP_015139339), Gavialis gangeticus (accession no. XP_019371939), Manis javanica (accession no. XP_017504614), Xenopus tropicalis (accession no. XP_002934726) and Nanorana parkeri (accession no. XP_018413822). The alignment of sequences was carried out by ClusterW method using MEGA version 4.0 (22).

Bioinformatics prediction of TRERF1 mutations

The online bioinformatics programs, PolyPhen-2 (23,24) and MutationTaster version 2 (25) were used to predict the potential disease-causing roles for the identified TRERF1 mutations, using the instructions of the programs.

Statistical analysis

Student's t-test was used to compare the potential association between nominal variables referring to TRERF1 mutations, and continuous variables were compared using the Mann-Whitney method. P-values were 2-tailed and P<0.05 was considered to indicate a statistically significant difference. All statistical analyses were performed using SPSS version 18.0 (SPSS, Inc., Chicago, IL, USA).

Results

TRERF1 mutations in ovarian endometriosis

In the present study, the coding sequence and the corresponding intron-exon boundaries of the TRERF1 gene in the ectopic endometria from 92 individuals with ovarian endometriosis were sequenced. Two heterozygous missense somatic mutations in TRERF1 [NM_033502; c.3166A>C (p.K1056Q) and c.3187 G>A (p.G1063R)] located in exon 17 were identified in 2 out of 92 ectopic endometria (2.2%) samples. The somatic status of these mutations was confirmed by sequencing of the respective paired blood samples (Fig. 1). From the two samples with TRERF1 mutations, one sample was from a 42-year-old diagnosed with uterine leiomyoma, and the other mutation carrier was a 36-year-old woman exhibiting no other apparent gynecological conditions. No TRERF1 mutations were identified in the remaining 90 samples of ovarian endometriosis. Furthermore, the two novel mutations were not identified in the Human Gene Mutation Database (http://www.hgmd.cf.ac.uk/ac/index.php) (26) and dbSNP database (https://www.ncbi.nlm.nih.gov/snp).

Figure 1.

Sequencing electropherograms of TRERF1 mutations in ectopic endometria and the corresponding blood samples. The arrows indicate the locations of the mutations.

Association between TRERF1 mutations and clinical data

The potential association between TRERF1 mutations and the available clinical data was analyzed using SPSS software. Therefore, no association between TRERF1 mutations and clinical characteristics was identified (Table I).

Evolutionary conservation analysis of TRERF1 mutations

Evolutionary conservation analysis revealed that the mutated amino acids p.K1056 and p.G1063 led to alterations of highly conserved amino acid sequences in vertebrate species (Fig. 2).

Figure 2.

Evolutionary conservation analysis results of TRERF1 p.K1056Q and p.G1063R mutations in 19 different vertebrate species.

Pathogenic potential of TRERF1 mutations

The TRERF1 mutations were predicted by MutationTaster online program and the two TRERF1 mutations (p.K1056Q and p.G1063R) were predicted to be ‘disease-causing’, with a score of 125 (p.K1056Q) and 53 (p.G1063R), where the mutations were considered as ‘disease-causing’ when the mutation frequency was >0.01 and the mutation was not present in the known single-nucleotide polymorphisms (SNPs) database in the National Center for Biotechnology Information (www.ncbi.nlm.nih.gov/snp/). Additionally, the two mutations were also predicted to be ‘probably damaging’ by PolyPhen-2, with a score of 0.999 (sensitivity, 0.14; specificity, 0.99) for p.K1056Q mutation and a score of 1.000 (sensitivity: 0.00; specificity: 1.00) for p.G1063R mutation, where the mutations were considered as ‘probably damaging’ when the prediction score value was >0.05.

Discussion

Previous studies have suggested that the balance between estrogen and progesterone production is frequently perturbed in endometriosis (18,19) and that endometriosis is a potential precancerous lesion harboring multiple somatic mutations in certain cancer-associated genes (10,11,13–15). It remains to be determined whether endometriosis harbors mutations in genes involved in the regulation of production of steroid hormones. Considering that TRERF1 has a role in the production of steroid hormones, including estrogen and progesterone (16,20), the authors of the present study hypothesized that TRERF1 may harbor mutations in endometriosis.

In the present study, two heterozygous somatic mutations in the TRERF1 gene were identified in two out of 92 tissue samples with ovarian endometriosis. To the best of our knowledge, both mutations were not previously reported and are located in exon 17. One individual carrying the somatic mutation of TRERF1 gene was diagnosed with uterine leiomyoma while the other exhibited no other apparent gynecological conditions. In addition, no association between TRERF1 mutation and the collected clinical data was observed in the samples included in the present study, including age at diagnosis, age of menarche, the levels of serum E2, P, CA125, TSH, FT3, FT4, CEA, AFP and SCCA. The results of the statistical analysis should be treated with caution due to small sample size in the TRERF1 mutation group (n=2). The evolutionary conservation analysis suggested that both the p.K1056 and p.G1063 residues were evolutionarily highly conserved in a number of vertebrate species. Furthermore, the two TRERF1 mutations were predicted to be ‘disease-causing’ and ‘probably damaging’ according to MutationTaster and PolyPhen-2 prediction programs, respectively. However, whether these TRERF1 mutations have a role in the development of ovarian endometriosis remains to be confirmed.

The mutation frequency of TRERF1 among patients with ovarian endometriosis was 2.2% (2/92). Previous studies aiming to determine the somatic mutation profiles in ovarian endometriosis did not identify any somatic mutations in the TRERF1 gene in endometriotic lesions from 16 patients with ovarian endometriosis (14) and 27 patients with deep infiltrating endometriosis (15). The authors of the present study hypothesize that the relatively small sample sizes analyzed in the prior studies may have prevented identification of the potential rare somatic mutations (14,15).

In conclusion, the present study identified somatic mutations in TRERF1 (p.K1056Q and p.G1063R) in ovarian endometriosis and the mutation frequency was 2.2% (2/92). In silico prediction suggested that the two somatic mutations may be ‘disease-causing’. Future functional assays should be performed to confirm the pathogenic roles of the TRERF1 mutations, which may elucidate the underlying mechanism of ovarian endometriosis.

Acknowledgements

The present study was supported by a grant from the Natural Science Foundation of Jiangxi Province (grant no. 20151BAB205012).

References

1 

Arosh JA, Lee J, Balasubbramanian D, Stanley JA, Long CR, Meagher MW, Osteen KG, Bruner-Tran KL, Burghardt RC, Starzinski-Powitz A and Banu SK: Molecular and preclinical basis to inhibit PGE2 receptors EP2 and EP4 as a novel nonsteroidal therapy for endometriosis. Proc Natl Acad Sci USA. 112:pp. 9716–9721. 2015; View Article : Google Scholar : PubMed/NCBI

2 

Samartzis EP, Noske A, Dedes KJ, Fink D and Imesch P: ARID1A mutations and PI3K/AKT pathway alterations in endometriosis and endometriosis-associated ovarian carcinomas. Int J Mol Sci. 14:18824–18849. 2013. View Article : Google Scholar : PubMed/NCBI

3 

Leone Roberti Maggiore U, Ferrero S, Mangili G, Bergamini A, Inversetti A, Giorgione V, Viganò P and Candiani M: A systematic review on endometriosis during pregnancy: Diagnosis, misdiagnosis, complications and outcomes. Hum Reprod Update. 22:70–103. 2016. View Article : Google Scholar : PubMed/NCBI

4 

Vigano P, Corti L and Berlanda N: Beyond infertility: Obstetrical and postpartum complications associated with endometriosis and adenomyosis. Fertil Steril. 104:802–812. 2015. View Article : Google Scholar : PubMed/NCBI

5 

Fadhlaoui A, Bouquet de la Jolinière J and Feki A: Endometriosis and infertility: How and when to treat? Front Surg. 1:242014. View Article : Google Scholar : PubMed/NCBI

6 

Tosti C, Pinzauti S, Santulli P, Chapron C and Petraglia F: Pathogenetic mechanisms of deep infiltrating endometriosis. Reprod Sci. 22:1053–1059. 2015. View Article : Google Scholar : PubMed/NCBI

7 

Richards EG, Zheng Y, Shenoy CC, Ainsworth AJ, Delaney AA, Jones TL, Khan Z and Daftary GS: KLF11 is an epigenetic mediator of DRD2/dopaminergic signaling in endometriosis. Reprod Sci. 24:1129–1138. 2017. View Article : Google Scholar : PubMed/NCBI

8 

Uimari O, Rahmioglu N, Nyholt DR, Vincent K, Missmer SA, Becker C, Morris AP, Montgomery GW and Zondervan KT: Genome-wide genetic analyses highlight mitogen-activated protein kinase (MAPK) signaling in the pathogenesis of endometriosis. Hum Reprod. 32:780–793. 2017. View Article : Google Scholar : PubMed/NCBI

9 

Yotova I, Hsu E, Do C, Gaba A, Sczabolcs M, Dekan S, Kenner L, Wenzl R and Tycko B: Epigenetic alterations affecting transcription factors and signaling pathways in stromal cells of endometriosis. PLoS One. 12:e01708592017. View Article : Google Scholar : PubMed/NCBI

10 

Matsumoto T, Yamazaki M, Takahashi H, Kajita S, Suzuki E, Tsuruta T and Saegusa M: Distinct β-catenin and PIK3CA mutation profiles in endometriosis-associated ovarian endometrioid and clear cell carcinomas. Am J Clin Pathol. 144:452–463. 2015. View Article : Google Scholar : PubMed/NCBI

11 

Pavlidou A and Vlahos NF: Endometriosis and ovarian cancer: Clinical and molecular aspects. Minerva Endocrinol. 39:155–165. 2014.PubMed/NCBI

12 

Burghaus S, Fasching PA, Häberle L, Rübner M, Büchner K, Blum S, Engel A, Ekici AB, Hartmann A, Hein A, et al: Genetic risk factors for ovarian cancer and their role for endometriosis risk. Gynecol Oncol. 145:142–147. 2017. View Article : Google Scholar : PubMed/NCBI

13 

Vestergaard AL, Thorup K, Knudsen UB, Munk T, Rosbach H, Poulsen JB, Guldberg P and Martensen PM: Oncogenic events associated with endometrial and ovarian cancers are rare in endometriosis. Mol Hum Reprod. 17:758–761. 2011. View Article : Google Scholar : PubMed/NCBI

14 

Li X, Zhang Y, Zhao L, Wang L, Wu Z, Mei Q, Nie J, Li X, Li Y, Fu X, et al: Whole-exome sequencing of endometriosis identifies frequent alterations in genes involved in cell adhesion and chromatin-remodeling complexes. Hum Mol Genet. 23:6008–6021. 2014. View Article : Google Scholar : PubMed/NCBI

15 

Anglesio MS, Papadopoulos N, Ayhan A, Nazeran TM, Noë M, Horlings HM, Lum A, Jones S, Senz J, Seckin T, et al: Cancer-associated mutations in endometriosis without cancer. N Engl J Med. 376:1835–1848. 2017. View Article : Google Scholar : PubMed/NCBI

16 

Gizard F, El-Alfy M, Duguay Y, Lavallée B, DeWitte F, Staels B, Beatty BG and Hum DW: Function of the transcriptional regulating protein of 132 kDa (TReP-132) on human P450scc gene expression. Endocr Res. 28:559–574. 2002. View Article : Google Scholar : PubMed/NCBI

17 

Gizard F, Teissier E, Dufort I, Luc G, Luu-The V, Staels B and Hum DW: The transcriptional regulating protein of 132 kDa (TReP-132) differentially influences steroidogenic pathways in human adrenal NCI-H295 cells. J Mol Endocrinol. 32:557–569. 2004. View Article : Google Scholar : PubMed/NCBI

18 

Reis FM, Petraglia F and Taylor RN: Endometriosis: Hormone regulation and clinical consequences of chemotaxis and apoptosis. Hum Reprod Update. 19:406–418. 2013. View Article : Google Scholar : PubMed/NCBI

19 

Vercellini P, Viganò P, Somigliana E and Fedele L: Endometriosis: Pathogenesis and treatment. Nat Rev Endocrinol. 10:261–275. 2014. View Article : Google Scholar : PubMed/NCBI

20 

Gizard F, Lavallee B, DeWitte F, Teissier E, Staels B and Hum DW: The transcriptional regulating protein of 132 kDa (TReP-132) enhances P450scc gene transcription through interaction with steroidogenic factor-1 in human adrenal cells. J Biol Chem. 277:39144–39155. 2002. View Article : Google Scholar : PubMed/NCBI

21 

Wu J, Zou Y, Luo Y, Guo JB, Liu FY, Zhou JY, Zhang ZY, Wan L and Huang OP: Prevalence and clinical significance of mediator complex subunit 12 mutations in 362 Han Chinese samples with uterine leiomyoma. Oncol Lett. 14:47–54. 2017. View Article : Google Scholar : PubMed/NCBI

22 

Tamura K, Dudley J, Nei M and Kumar S: MEGA4: Molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol Biol Evol. 24:1596–1599. 2007. View Article : Google Scholar : PubMed/NCBI

23 

Adzhubei IA, Schmidt S, Peshkin L, Ramensky VE, Gerasimova A, Bork P, Kondrashov AS and Sunyaev SR: A method and server for predicting damaging missense mutations. Nat Methods. 7:248–249. 2010. View Article : Google Scholar : PubMed/NCBI

24 

Adzhubei I, Jordan DM and Sunyaev SR: Predicting functional effect of human missense mutations using PolyPhen-2. Curr Protoc Hum Genet. Jan;2013.doi: 10.1002/0471142905.hg0720s76. View Article : Google Scholar : PubMed/NCBI

25 

Schwarz JM, Cooper DN, Schuelke M and Seelow D: MutationTaster2: Mutation prediction for the deep-sequencing age. Nat Methods. 11:361–362. 2014. View Article : Google Scholar : PubMed/NCBI

26 

Stenson PD, Mort M, Ball EV, Evans K, Hayden M, Heywood S, Hussain M, Phillips AD and Cooper DN: The human gene mutation database: Towards a comprehensive repository of inherited mutation data for medical research, genetic diagnosis and next-generation sequencing studies. Hum Genet. 136:665–677. 2017. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Cao B, Zeng Y, Wu F, Liu J, Shuang Z, Xu X and Guo J: Novel TRERF1 mutations in Chinese patients with ovarian endometriosis. Mol Med Rep 17: 5435-5439, 2018.
APA
Cao, B., Zeng, Y., Wu, F., Liu, J., Shuang, Z., Xu, X., & Guo, J. (2018). Novel TRERF1 mutations in Chinese patients with ovarian endometriosis. Molecular Medicine Reports, 17, 5435-5439. https://doi.org/10.3892/mmr.2018.8510
MLA
Cao, B., Zeng, Y., Wu, F., Liu, J., Shuang, Z., Xu, X., Guo, J."Novel TRERF1 mutations in Chinese patients with ovarian endometriosis". Molecular Medicine Reports 17.4 (2018): 5435-5439.
Chicago
Cao, B., Zeng, Y., Wu, F., Liu, J., Shuang, Z., Xu, X., Guo, J."Novel TRERF1 mutations in Chinese patients with ovarian endometriosis". Molecular Medicine Reports 17, no. 4 (2018): 5435-5439. https://doi.org/10.3892/mmr.2018.8510
Copy and paste a formatted citation
x
Spandidos Publications style
Cao B, Zeng Y, Wu F, Liu J, Shuang Z, Xu X and Guo J: Novel TRERF1 mutations in Chinese patients with ovarian endometriosis. Mol Med Rep 17: 5435-5439, 2018.
APA
Cao, B., Zeng, Y., Wu, F., Liu, J., Shuang, Z., Xu, X., & Guo, J. (2018). Novel TRERF1 mutations in Chinese patients with ovarian endometriosis. Molecular Medicine Reports, 17, 5435-5439. https://doi.org/10.3892/mmr.2018.8510
MLA
Cao, B., Zeng, Y., Wu, F., Liu, J., Shuang, Z., Xu, X., Guo, J."Novel TRERF1 mutations in Chinese patients with ovarian endometriosis". Molecular Medicine Reports 17.4 (2018): 5435-5439.
Chicago
Cao, B., Zeng, Y., Wu, F., Liu, J., Shuang, Z., Xu, X., Guo, J."Novel TRERF1 mutations in Chinese patients with ovarian endometriosis". Molecular Medicine Reports 17, no. 4 (2018): 5435-5439. https://doi.org/10.3892/mmr.2018.8510
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team