Open Access

Expression of immunoglobulin A in human mesangial cells and its effects on cell apoptosis and adhesion

  • Authors:
    • Hui Deng
    • Junfan Ma
    • Ziyang Jing
    • Zhenling Deng
    • Yaoxian Liang
    • Lata A
    • Yang Liu
    • Xiaoyan Qiu
    • Yue Wang
  • View Affiliations

  • Published online on: February 2, 2018     https://doi.org/10.3892/mmr.2018.8544
  • Pages: 5272-5282
  • Copyright: © Deng et al. This is an open access article distributed under the terms of Creative Commons Attribution License.

Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

IgA nephropathy (IgAN) is characterized by predominant IgA deposition in the glomerular mesangium. It has been considered that the deposited IgA is synthesized by B cells, although recent reports have suggested the implication of other cell types. Therefore, the present study investigated whether glomerular mesangial cells could produce IgA by themselves. Semi‑quantitative reverse transcription-polymerase chain reaction, and immunostaining analysis revealed that the IgA protein and gene transcripts were expressed in primary human renal mesangial cells (HRMCs). Furthermore, the IgA heavy chain (α1 and α2) and the light chain (κ and λ) were localized in the cytoplasm or were located on the cell membranes of human mesangial cells (HMCs). Mass spectrometry results indicated that Ig α1 and Ig α2 were secreted in the culture media of HMCs. The transcripts of Ig α, Ig κ and Ig λ constant regions were detected. The predominant rearrangement pattern of the variable region of Ig κ, was Vκ3‑20*01/Jκ1*01 in HMCs and Vκ1‑12*01/Jκ4*01 in HRMCs. In addition, knockdown of Ig α1 expression by small interfering RNA (siRNA) inhibited cell adhesion and promoted apoptosis. Our findings demonstrate that HMCs can express IgA, and that this expression is associated with cell functions, which may contribute to the deposition of IgA in patients with IgAN.

Introduction

Human mesangial cell (HMC) proliferation and expansion occurs in major glomerular diseases and is the main feature of IgA nephropathy (IgAN) (1). It is generally considered that the immune complexes containing IgA are found in the glomerular mesangium, and that IgA1 is secreted by B lymphocytes, mediated by the process of glycosylation and over aggregation. The abnormal IgA1 can be recognized by anti-glycan auto-antibodies of the IgA1 and/or IgG isotype, resulting in formation of circulative immune complexes (CIC) (2,3). The pathogenic CIC deposits in the glomerular mesangium can promote resident mesangial cells to secrete proinflammatory factors, initiating glomerular injuries (46).

Classical immunology considers that differentiated B cells are the unique source of immunoglobulins (Igs). However, this theory has been challenged over the past decade by increasing evidence reporting that Igs could be expressed in cancer cells. Qiu and Yang initially reported the existence of Ig-like protein in malignant tumor cells in 1996 (7,8). Later studies by Kimoto and Zheng et al have shown that Igs transcripts are expressed in human carcinoma cell lines (9), and in human epithelial carcinoma cell lines (10). Qiu et al also has reported IgG secretion by epithelial cancer cells, and demonstrated that its function is to promote growth and survival of tumor cells (11). Subsequently, Igs were found to be widely expressed in many types of cancer cells, including breast cancer, colon cancer, lung carcinomas, nasopharyngeal carcinoma, abnormal cervical epithelial cells and oral epithelial tumor cells (1216). Unlike B-cell-derived Igs, which are the key molecules for humoral immune responses, cancerous Igs are associated with various cell functions, such as cell survival, proliferation, transformation, metastasis and carcinogenesis (11,13,1722).

Besides the cancer cells, there is growing evidence showing that normal cells could also express Igs. Huang et al reported that several types of Igs are expressed in normal cells, including IgG expression in brain neurons with classic V-(D)-J gene rearrangements (23), Ig µ gene expression and rearrangement in myeloid cells (24), Ig gene expression and rearrangement in germ cells (25), mammary gland (26) and hematopoietic stem/progenitor cells (27). Kang et al revealed the LOX-1 dependent overexpression of Ig κ in cardiomyocytes in response to angiotensin II (AngII) (28). Previous results detected the IgG expression in the eye (29), and the IgG, IgA, IgM expression in the liver (30) and in the hippocampus (31). These findings demonstrated that normal cells could express proteins and mRNA transcripts of the Ig's heavy chains, light chains, and enzymes required for V(D)J recombination, suggesting a significant role in maintaining the organs' microenvironment, and regulating the development and function of cells.

In the present study, we have confirmed that IgA is expressed in primary human renal mesangial cells (HRMCs) and in the HMCs, and investigated its potential role on cell apoptosis and cell adhesion.

Materials and methods

Cell culture

Primary HRMCs (Sciencell Research Laboratories, Carlsbad, CA, USA) were cultured in mesangial cell medium (MCM) solution containing 2% FBS, 1% mesangial cell growth supplement, and 1% penicillin/streptomycin. The materials to culture HRMCs were purchased from the Sciencell Research Laboratories and cultured according to the manufacturer's protocol. Cells were maintained in serum-free medium for 48 h prior to harvesting. Cells were used at passage nos. 4 to 6.

The HMC line, C2M12, which retains many of the morphological and physiological features of the normal HMCs (32,33), was kindly donated by Professor Youfei Guan (Department of Physiology and Pathophysiology, Peking University Health Science Center, Peking, China). These cells were cultured in RPMI-1640 (Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) containing 10% fetal bovine serum (FBS; Biological Industries USA, Inc., Cromwell, CT, USA), 1% insulin transferrin selenium-A supplement (ITS-A; Invitrogen; Thermo Fisher Scientific, Inc.), 100 U/ml penicillin, and 100 mg/ml streptomycin, at 37°C in an atmosphere of 95% air and 5% CO2. Cells were sub-cultured when reaching 90% confluency with 0.05% trypsin containing 1 mM EDTA for 20 sec at 37°C. AngII and staphylococcus (SAC; Sigma-Aldrich, St. Louis, MO, USA) were used to stimulate the HMCs.

Cell cycle synchronization

Cell cycle synchronization of the HMCs was performed following the double thymidine block protocol described by previous studies (34,35). Briefly, HMCs were seeded on 10 cm culture dishes at a density of 1×105 cells per dish. In order to collect cells arrested at G1/S phase, the cell culture was grown until it reached confluence of 50%, then arrested with 2 mmol/l thymidine in complete culture media for 12 h, washed twice with phosphate-buffered saline (PBS), and recovered in fresh complete culture media for 12 h, followed by a second arrest with 2 mmol/l thymidine for another 12 h. After the second arrest, the supernatant was replaced by fresh complete culture media to recover the cells. A sample of each cell culture was collected on cover slips every 2 h after the second cell cycle release.

Cell cycle assay

Cell cycle progression was assessed by flow cytometry based on the DNA content of cells (36). DNA content of cells at distinct phases of the cell cycle (G0/G1, S, and G2/M phase) was analyzed using propidium iodide (PI) staining. HMCs were harvested and washed twice in cold PBS by centrifugation at 800 × g for 5 min. Cells were then suspended in 100 µl ice-cold PBS at a density of at least 2×104 cells per tube. 3 ml of ice-cold 70% ethanol was gradually added to the cell suspension for fixation. The suspended cells were incubated at 4°C overnight, then filtered through a 48 µm filter screen, spun at 1,500 × g for 5 min and washed twice with ice-cold PBS to remove traces of ethanol. RNase (0.5 mg/ml) was added to degrade RNA at 37°C for 30 min. After washing twice with 300 µl ice-cold PBS, the cells were suspended in 300 of 50 µg/ml PI staining solution to stain the nuclei and incubated at room temperature for 5 min in the dark. The cell cycle data for individual samples was acquired using the BD LSRFortessa flow cytometer equipped with BD FACSDiva software (BD Biosciences, San Diego, CA, USA) and analyzed using ModFit LT software (Verity Software House, Topsham, ME, USA).

Immunofluorescence

For indirect immunofluorescence staining (IF), HMCs and HRMCs were cultured on cover slips and fixed in cold acetone for 5 min. After washing three times with PBS, the slides were blocked with 5% BSA (Invitrogen; Thermo Fisher Scientific, Inc.) (diluted with PBS) for 30 min at room temperature and incubated with the primary antibody (diluted with PBS) at 4°C overnight. Mouse anti-human Ig α1, Ig α2 antibodies (Southern-Biotech, Birmingham, AL, USA), mouse anti-human monoclonal Ig κ, Ig λ antibodies (Zhongshan Golden Bridge Biotechnology Co., Ltd., Beijing, China) were used as the primary antibody; PBS was used as a blank control. After removing the unbound antibodies by washing in PBS for three times, the slides were incubated with goat anti-mouse IgG antibody (Zhongshan Golden Bridge Biotechnology Co., Ltd.) and labeled with fluorescein isothiocyanate (FITC) for 1 h at room temperature in dark. For direct immunofluorescence staining, the slides were incubated with the mouse anti-human Ig α-FITC (Zhongshan Golden Bridge Biotechnology Co., Ltd.) in the dark overnight at 4°C. After washing another three times, the slides were incubated with DAPI (Vector Laboratories, Inc., Burlingame, CA, USA) for 2 min at room temperature. Fluorescent signals were detected with a Confocal Laser Scanning microscopy FV1000 (Olympus, Tokyo, Japan).

Semi-quantitative reverse transcription-polymerase chain reaction (SqRT-PCR)

Total RNA of cultured cells was extracted with TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.) and the concentration was assessed using a Nanodrop spectrophotometer (Thermo Fisher Scientific, Inc.). Then 1.5 µg of total RNA was reverse-transcribed to cDNA using the GoScript Reverse Transcriptase (Promega, Madison, WI, USA). PCR was performed with the primers targeting constant regions of Ig α, Ig κ, Ig λ (Ig Cα, Ig Cκ, Ig Cλ) and nested PCR was performed with external primers at the first round and internal primers at the second round targeting variable region of Ig κ (Ig Vκ). The sequences of primers and reaction conditions are listed in Tables I and II. Amplification products were separated in a 1% agarose gel by electrophoresis, including a 100 bp DNA ladder (Beijing Solarbio Science & Technology Co., Ltd., Beijing, China). The amplified DNA fragments were identified by their molecular mass, under ultraviolet light observations. Human peripheral blood mononuclear cells (PBMCs) were used as the positive control. The peripheral blood was obtained from healthy donors. PBMCs were isolated from 5 ml peripheral blood using two-step discontinuous Ficoll/Hypaque (Second Chemistry Factory, Shanghai, China) density gradient centrifugation. The white gradient layer containing PBMCs was recovered and washed with 0.01 M PBS, and the isolated PBMCs used immediately for total RNA extraction (37).

Table I.

Sequences of polymerase chain reaction primers used in this study.

Table I.

Sequences of polymerase chain reaction primers used in this study.

Gene namePrimerPrimer sequence 5′-3′Product length (bp)
Igα constant region (Ig Cα)Forward ACCATGCAGGAGAAGGTGTC340
Reverse TCACTTGCACTGCTGCCTAC
Igκ constant region (Ig Cκ)Forward TGAGCAAAGCAGACTACGAGA231
Reverse GGGGTGAGGTGAAAGATGAG
Igλ constant region (Ig Cλ)Forward GGGACCAAGCTCACCGTCCTAG316
Reverse TCTTCTCCACGGTGCTCCCTTC
Igκ variable region (Ig Vκ)External forward GACATCGAGCTCACCCAGTCTCC360–380
External reverse CGGGAAGATGAAGACAGATGGTGC
Internal forward GAAATTGAGCTCACGCAGTCTCCA340–360
Internal reverse TGGTGCAGCCACAGTTCGTT
β-actinForward AGAGCTATGAGCTGCCTGAC121
Reverse AATTGAATGTAGTTTCATGGATG

Table II.

Reaction conditions of polymerase chain reaction used in this study.

Table II.

Reaction conditions of polymerase chain reaction used in this study.

Gene nameInitial denaturation (°C/min)Denaturation (°C/sec)Annealing (°C/sec)Extension (°C/sec)Cycle numberExtension (°C/min)
Ig Cα94/494/3062/3072/303572/10
Ig Cκ95/495/3050/3072/303572/10
Ig Cλ95/495/3056/3072/303572/10
Ig Vκ (External reaction)94/594/3060/3072/30  3
94/3058/3072/30  3
94/3056/3072/30  3
94/3054/3072/30  3
94/3052/3072/30  3
94/3050/3072/30  3
94/3048/3072/302072/7
Ig Vκ (Internal reaction)94/594/3060/3072/303572/7
β-actin94/594/3056/3072/302572/7
Analysis of gene rearrangement

PCR products of Ig Vκ were cloned into a pGEM-T Easy Vector (Promega) and transfected into the competent E. coli cell line TOP10 [Tiangen Biotech (Beijing) Co., Ltd., Beijing, China]. The transcripts of individual clones were amplified. After DNA sequencing with an ABI 3730XL Genetic Analyzer (Applied Biosystems; Thermo Fisher Scientific, Inc.) which was performed by Invitrogen; Thermo Fisher Scientific, Inc., the variable sequences were compared with the published sequences of the germline gene segments using the BLAST tool of the National Center for Biotechnology Information (NCBI).

Western blot analysis

Cultured cells were harvested and washed twice with cold PBS, then re-suspended in TSD lysis buffer (TSD lysis buffer, 1% SDS; 50 mmol/l, pH 7.5 Tris-HCL, 50 mmol/l DTT), sonicated for 1 min, and lysed for 30 min at room temperature. The protein concentration of the cell lysate was calculated with a BCA kit (Applygen Technologies Inc., Beijing, China). After centrifugation at 12,000 × g for 10 min at 4°C, 5X loading buffer was added to the lysate, boiled at 100°C for 5 min, and the samples were immediately used for western blot analysis. The proteins in the culture supernatant were precipitated with 50% ammonium sulfate, centrifuged at 12,000 × g for 15 min and then dissolved in PBS. The collected fraction was filtrated with the AmiconR Ultra-0.5 Centrifugal Filter Devices (EMD Millipore, Billerica, MA, USA) to remove the ammonium sulfate. The measurement of protein concentration in the culture supernatant was performed with the same method used as for the cell lysate. Free Ig in the human serum and the cultural medium were used as control.

The protein samples were separated by 10% sodium dodecylsulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to nitrocellulose membranes. The membranes were incubated with rabbit anti-IgA antibody (1:1,000), mouse anti-IgA1 antibody (1:1,000), mouse anti-IgA2 antibody (1:1,000), rabbit anti-Ig κ antibody (1:10,000), and rabbit anti-Ig λ antibody (1:50,000). The above antibodies were purchased from Abcam (Cambridge, UK). All the membranes were washed three times with TBST for 10 min before incubated with secondary antibodies for 1 h at room temperature. Goat anti-rabbit IgG-IRDyeTM800CW (1:10,000 and goat anti-mouse IgG-IRDyeTM680CW (1:10,000; both from LI-COR Biosciences, Lincoln, NE, USA) were used as secondary antibodies. Immunoreactivity was observed with the Odyssey Infrared imager (LI-COR Biosciences).

IgA1 purification and mass spectrometry

After the HMCs were cultured in RPMI-1640 with 2% FBS for 48 h, the culture supernatant was collected as described above. IgA1 was purified according to the manufacturer's instructions of jacalin-sepharose (BioVision, Milpitas, CA, USA). After precipitation of the proteins, the pellet was dissolved in PBS and filtrated with the AmiconR Ultra-0.5 Centrifugal Filter Devices (EMD Millipore) to remove the ammonium sulfate and elution buffer. The purified proteins were separated by 10% SDS PAGE, detected by western blot analysis as described above, and further analyzed by mass spectrometry in the Beijing Protein Innovation Co., Ltd. (Beijing, China).

Cell stimulation with AngII

HMC were seeded on 10 cm culture dishes. When the sub-cultured HMC reached 70% confluency, cells were cultured in RPIM-1640 containing 0.5% FBS overnight, followed by treatment with 10−8 mol/l AngII for 24 h or with SAC (1:1,000) for 48 h. A sample from each cell culture was placed on cover slips for immunostaining and the remaining cells were collected for western blot analysis, as described above.

Transfection of cultured HMCs with small interfering RNA (siRNA)

Lipofectamine 3000 (Invitrogen; Thermo Fisher Scientific, Inc.) was used for the transfection with siRNA. siRNAs directed against different regions of the constant region of the Ig α1 heavy chain (siRNA-1, siRNA-2 and siRNA-3), against GAPDH (positive control, PC) and against the nonspecific, scrambled, control siRNA [negative control (NC)], were designed by GenePharma Company (Shanghai, China) and the sequences are listed in Table III. HMCs were seeded onto 12-well culture plate (2×104 cells/well) in mesangial cell culture media and grown overnight. HMCs were then transfected with each of 50 nmol/l siRNA mixed with Lipofectamine reagent in Opti-mem medium (Invitrogen; Thermo Fisher Scientific, Inc.). PBS was added to the control group. HMCs were harvested after transfection for 48 h and used for western blot analysis.

Table III.

Sequences of siRNA used in this study.

Table III.

Sequences of siRNA used in this study.

siRNADirectionSequence (5′-3′)
siRNA-1Forward GCUCUUAGGUUCAGAAGCGTT
Reverse CGCUUCUGAACCUAAGAGCTT
siRNA-2Forward GGAACCAUGGGAAGACCUUTT
Reverse AAGGUCUUCCCAUGGUUCCTT
siRNA-3Forward GCCUUCACACAGAAGACCATT
Reverse UGGUCUUCUGUGUGAAGGCTT
Positive controlForward UGACCUCAACUACAUGGUUTT
Reverse AACCAUGUAGUUGAGGUCATT
Negative controlForward UUCUCCGAACGUGUCACGUTT
Reverse ACGUGACACGUUCGGAGAATT

[i] siRNA, small interfering RNA.

Cell apoptosis assay

After transfection for 48 h, cells were collected with 0.05% trypsin solution and harvested by centrifugation at 800 × g for 5 min. The harvested cells were washed twice with cold PBS. According to the manufacturer's protocol, 1×106 cells were suspended in 100 µl of 1X Annexin V binding buffer and stained with 5 µl of Annexin V-FITC and 5 µl of 7-AAD (both from BD Biosciences) in the dark for 15 min at room temperature. After adding another 400 µl binding buffer and filtrating through a 48 µm filter, cell apoptosis was measured by flow cytometry (BD Biosciences).

Cell adhesion assay

Cell adhesion rate was analyzed by the Cell Counting kit-8 (CCK-8; Dojindo Molecular Technologies, Inc., Kumamoto, Japan). After siRNA transfection for 48 h, 3×104 cells were re-suspended in culture media and 100 µl were aliquoted in each well of a 96-well plate and incubated at 37°C for 1 h. 3 wells of each group were washed gently three times with PBS, and 100 µl of fresh culture media with 8 µl of CCK-8 reagents were added. In order to analyze the total cell concentration, CCK-8 was directly added to 3 different unwashed wells. After incubation for 3 h at 37°C, concentration was determined by measuring absorbance at 450 nm using a spectrophotometric microplate reader (BioTek Instruments, Inc., Winooski, VT, USA). The cell adhesion rate was calculated as follows:

Cell adhesion rate=ODwashed–ODblankODunwashed–ODblank
Statistical analysis

Data was expressed as the means ± standard deviation and analyzed using SPSS 20.0 for Windows (SPSS, Inc., Chicago, IL, USA). The differences between experimental groups were analyzed with one-way analysis of variance, followed by a Least Square Difference multiple comparison test. A value of P<0.05 was considered to indicate a statistically significant difference.

Results

IgA expression in primary HMCs

In this study, the in vivo IgA expression in HRMCs was investigated. Western blot analysis of the lysed HRMCs demonstrated that Ig α was present not only at a size of 72 kDa, which was consistent with the positive control in the serum, but also at 53 and 38 kDa (Fig. 1A), indicating that the α chains in the cytoplasm might be truncated or are at different synthesis stages. There was no obvious band detected for Ig κ (Fig. 1B). A positive band for Ig λ was detected at 55 kDa which is similar to the molecular weight of a dimer and was consisted with the size of the positive controls in the serum (Fig. 1C). The absence of a band in the MCM eliminates the possibility of IgA heavy chain and light chain expression in the culture medium. In addition, RT-PCR revealed Ig Cκ and Ig Vκ transcripts' expression in HRMCs (Fig. 1D). Further sequencing of the PCR products showed 95% sequence similarity between the Ig Cκ collected from the HRMCs and the published sequence obtained from plasma cells in the NCBI database (Gene Bank, Y14736.1) (Fig. 1E). The predominant Vκ/Jκ rearrangement pattern was Vκ1-12*01/Jκ4*01, which is different to the transcripts' pattern observed in the PBMCs (Table IV). The negative expression of CD19 indicated that there was no B cell contamination in the HRMCs. The constant region and the Ig Vκ transcripts were strongly detected, suggesting an IgA expression in the HRMCs.

Table IV.

Rearrangement patterns of Ig κ variable region transcripts.

Table IV.

Rearrangement patterns of Ig κ variable region transcripts.

NameClone no.Identity%
PBMC (n=16)1Vκ1-27*01Jκ1*0190.2
1Vκ1-27*01Jκ4*0196.1
1Vκ1-39*01Jκ1*0190.8
6Vκ1-39*01Jκ4*0186.9–97.6
1Vκ1-39*01Jκ3*0197.9
1Vκ1-39*01Jκ5*0193.3
1Vκ1-16*02Jκ4*0195.5
2Vκ1-33*01Jκ4*0191.3
1Vk4-1*01Jk4*0196.6
HMC (n=7)7Vκ3-20*01Jκ1*0194.4
HRMC (n=8)2Vκ3-20*01Jκ1*0192.7–94.4
6Vk1-12*01Jk4*0194.4–94.7

[i] PBMC, peripheral blood mononuclear cell; HMC, human mesangial cell; HRMC, human renal mesangial cell.

IgA expression in HMC line

IgA expression in mesangial cells was further confirmed in the HMC cell line with several methods. Immunofluorescence staining was positive for Ig α, Ig κ, Ig λ in the mesangial cytoplasm (Fig. 2A). Similar to a previous study which had reported the absence of IgA in the FBS (38), the FBS was negatively stained with rabbit anti-human Ig α, κ and λ antibodies, indicating that FBS could not interfere with the results. Western blot analysis of the HMCs lysates displayed similar positive bands for Ig α at 53 and 38 kDa, and for Ig λ at 55 kDa, but negative results for Ig κ, which corresponds with the results obtained in HRMCs (Fig. 2B), further supporting the IgA expression in mesangial cells.

Ig gene rearrangement and transcription is a prerequisite for Ig expression. To confirm the fact that IgA was synthesized in HMCs, we further explored the transcripts of Ig α, Ig κ and Ig λ by examining the mRNA expression of the constant regions of Ig α, Ig κ, Ig λ and the variable region of Ig κ in the HMCs (Fig. 2C). The alignment of the sequences of the RT-PCR products with those of the published Ig Cα1, Ig Cα2, Ig Cκ and Ig Cλ mRNA sequences in the NCBI database (Gene Bank, BC016369.1, BC073765.1, Y14736.1, X57823.1) demonstrated a sequence similarity of 99, 97, 98 and 97%, respectively (Fig. 3). The DNA sequencing of the Vκ PCR products showed that the predominant rearrangement was Vκ3-20*01/Jκ1*01, which was different from the rearrangements in HRMCs, and less diverse than the transcripts from PBMCs (Table IV). The HMC-derived Ig Vκ rearrangement sequence has been submitted to the GenBank database (GenBank accession no. KX443559).

Dynamic expression of IgA in HMCs during cell cycle and IgA secretion

Double thymidine (TdR) block model was used to achieve HMCs synchronous growth and the cells were harvested every 2 h to detect the IgA expression at different phases of the cell cycle. The cell cycle phase was determined by flow cytometry and demonstrated that HMCs entered S phase at around 2 h, G2/M phase from 4 to 6 h, G0/G1 phase from 8 h to 10 h, and re-entered into S phase 12 h later (Fig. 4A).

Consistent with the cell cycle phases, we detected dynamic expressions of Ig α1 (Fig. 4B and C) and Ig α2 (data not shown). The immunostaining results showed that Ig α1 expression was gradually increased from S phase (2 h), then reached highest levels at the G2/M phase (4–6 h), decreased after the G0/G1 phase (10 h) and increased in S phase (12 to 24 h) again. Different protein expression levels were also detected in the cell lysates by Western blot analysis (Fig. 4D and E). The trend of the Ig α heavy chain expression at 4 and 10 h by Western blot was similar with that by IF staining. The α chain displayed a differential localization pattern and expression levels during the 24 h observation period after synchronization. These changes were in accordance with the cell G, S and M phases, indicating that the IgA heavy chain may be associated with cell growth, proliferation and division.

To find out whether HMCs could secrete IgA, we purified Ig α1 from the culture supernatant using jacalin-sepharose which binds to human IgA1 with high specificity. The size of the eluted protein was 65 kDa, according to the anti-human Ig α and the Ig α1 antibodies staining, which corresponds to the molecular size for the Ig α heavy chain (Fig. 4F). Mass spectra results showed that there was high homology between the amino acid sequences of the band and those of the Ig α1 and Ig α2 constant regions published in the NCBI database (GenBank, CAC20453.1, AAB30803.1) (Fig. 5).

Up-regulation of IgA in HMCs by AngII

We utilized AngII, endogenous pro-inflammatory factor, to examine the effects of pro-inflammatory factors on the IgA expression in HMCs. 24 h after AngII stimulation, the immunofluorescence staining was stronger for Ig α, Ig κ, Ig λ in the cytoplasm (Fig. 6A). Ig α and Ig λ were more abundant on the fibrous structures in the cytoplasm and a granular accumulation was observed on the cell membranes. Similar to the WB results immunostaining revealed that Ig κ was expressed weakly in HMCs and its accumulation on the membranes was not obvious.

The association of IgA with cell apoptosis and cell adhesion

To investigate the possible effects of HMC-produced IgA on cell functions, we used the siRNA transfection method to down regulate the expression of Ig α1 in HMCs. After transfection with siRNAs for 48 h, the cells were collected to detect the Ig α1 expression in HMCs. The relative expression of the 53 kDa form of the Ig α1 was significantly downregulated in the siRNA-1 and the siRNA-3 treated groups compared to the negative control (NC) group (0.32±0.01 vs. 0.73±0.05, P<0.05; 0.36±0.01 vs. 0.73±0.05, P<0.05, respectively) and this was also similar with the expression of the 38 kDa form (0.34±0.01 vs. 0.58±0.03, P<0.05; 0.26±0.02 vs. 0.58±0.03, P<0.05) (Fig. 6B and C). These results indicated that siRNA-1 and siRNA-3 transfection could effectively down-regulate IgA in HMCs.

Annexin V assay combined with flow cytometry was performed to evaluate the apoptosis rates. After siRNA transfection for 48 h, early apoptosis in HMCs was detected. Apoptosis in the HMCs siRNA-1 and the siRNA-3 groups showed an early increase compared with that in the NC group (20.45±5.34 vs. 10.27±5.31%, P<0.05; 27.25±9.81 vs. 10.27±5.31%, P<0.05, n=4) (Fig. 6D and E), indicating that IgA expression in HMCs might play an important role in cell growth and apoptosis. Cell adhesion ability is important for HMCs to execute functions such as structural support of the capillary tuft, modulation of glomerular hemodynamics and phagocytic removal of macromolecules and immune complexes. After siRNA transfection for 48 h, cell adhesion rates of HMCs in both the siRNA-1 and the siRNA-3 groups were significantly decreased compared to the NC group (34.99±2.56 vs. 46.88±6.70%, P<0.05; 27.16±4.67 vs. 46.88±6.70%, P<0.05) (Fig. 6F). The significant decrease of cell adhesion rates indicated that the knockdown of IgA in HMCs might inhibit cell adhesion. These changes in the rate of early apoptosis and the ability to adhere indicated that IgA expression is associated with mesangial cell functions.

Discussion

Definitive diagnosis of IgAN requires a kidney biopsy and IgAN is identified immunohistologically by the presence of dominant or co-dominant glomerular deposits of IgA (39), which had been generally considered to be B cell derived. The deposits consist predominantly of polymeric IgA structures of the IgA1 subclass (40). The pathogenic IgA deposition in the glomerular mesangium can activate mesangial cells and induce mesangial hyper-cellularity, apoptosis, oxidative stress, activation of complement, scarring in the glomerular and interstitial compartments, and secretion of pro-inflammatory factors, causing symptoms such as proteinuria, hematuria, and leading to IgAN (4143). Igs expression in non-B cells has been reported in recent years by several studies, which provided clues for IgA expression in mesangial cells (11,14,37). Our study demonstrated, for the first time, that mesangial cells may produce and secret IgA, and that the deposited IgA in the mesangium of patients with IgAN may be, at least partially, originated from mesangial cells.

In addition, in this study, we have demonstrated that the Ig α, Ig κ and Ig λ proteins are present in HRMCs and HMCs, and that their presence was not due to artificial contamination by B lymphocytes or by the FBS buffer in the culture media. These results confirm that the IgA, especially IgA1, is expressed in the mesangial cells. The different molecular weights of the Ig α heavy chain suggested that Ig synthesis and assembly occur at different stages or that it existed in different truncated or aggregated forms, as it has been previously reported by Hu et al (44). Furthermore, our study has shown that the IgA heavy and light chain constant and variable region gene transcripts and proteins were present in the HRMCs and HMCs and that their high homology with those mRNA sequences in the NCBI database strongly supports IgA expression in mesangial cells,. The unique or dominant Ig Vκ sequences in non-B cells are consistent with other reports (26,37).

Increase of early apoptosis and decrease of cell adhesion ability in HMCs after IgA downregulation were observed in our study, which indicated that expression of Ig α1 might be associated with mesangial cell functions such as apoptosis, proliferation, and adhesion. IgA mediated cell proliferation and apotosis has been reported in human epithelial cancer cells, but the mechanism was not investigated (45). Previous studies have shown that the pathogenesis of a variety of renal diseases is highly correlated with cell apoptosis and changes of apoptotic genes, in which the Bcl-2 family is one of the most implicated gene families (46,47). Besides, active effector caspases could proteolytically degrade a range of intracellular proteins during the apoptosis process (48,49). IgA expression may participate in the transcriptional and/or post-translational regulation of apoptosis related genes or proteins, such as caspases, to inhibit mesangial cell apoptosis. The specific molecules contributing to cell adhesion between the mesangial cell and the glomerular basement membrane are not clear. However, the protein called Epithelial Protein Lost In Neoplasm (EPLIN) was reported to strongly express in glomerular mesangial cells (50). EPLIN is implicated in the organization of the actin cytoskeleton, during the cell-cell or cell-matrix interactions (51). The above evidence provide us with clues to explore the underlying mechanism(s) regulating IgA expression in mesangial cells and mediating apoptosis and adhesion.

The results of our study have potential application and significance in clinical practice. First, the facts that IgA could be expressed in mesangial cell and secreted out of cell can illustrate that the IgA deposited in the mesangium in patients with IgAN may be, at least partially, originated from mesangial cells and may induce mesangial cells proliferation and secretion of extracellular matrixes. Second, our results have shown that mesangial cell-derived IgA is required for physiological cell functions, so exploring the factors which could lead to IgA deposition in the mesangium would be of great clinical significance. Third, the upregulation of Ig α, Ig κ, Ig λ expression by AngII in the cytoplasm of HMCs indicates that an interaction exists between angiotensin and IgA. This interaction can be potentially targeted for the clinical treatment of IgAN by exploiting angiotensin converting enzyme inhibitors or AngII receptor blockers.

Several points in the study need to be further clarified. First, IF staining demonstrated the presence of the κ chain in the cytoplasm and RT-PCR identified the transcript of the κ chain in the HMCs, but WB was not able to detect the Ig κ band. Generally speaking, antibodies used in IF recognize the three-dimensional structure while those in WB bind to the short line chain of the proteins, therefore the IF staining results are more convincing. The negative result in the WB might be attributed to the insufficient recognition by the antibodies. Secondly, a 65 kDa band after jacalin affinity chromatography was positively detected with antibodies against Ig α and Ig α1 but not Ig α2, however both α1 and α2 heavy chains were detected in the band by mass spectrometry. IF demonstrated the staining of both α1 and α2 in the cytoplasm and RT-PCR showed that the transcripts of both α1 and α2 were expressed in HMCs. The dominant expression of Ig α1, as we found by IF and by WB, may compete with the binding of the antibody to the Ig α2. It was not easy to explain the affinity of jacalin to Ig α2, which was considered not to have any glycosylation sites at the hinge area, and it was unclear if the glycosylation at the hinge area of Ig α1 and Ig α2 in the mesangial cells was different from those in the plasm cell.

In conclusion, this study demonstrates that mesangial cells can express and secret IgA and that this expression may be associated with cell functions. Our findings provide clues for the implication of the HMC-produced IgA in the excessive deposition of IgA in the pathogenesis of IgAN.

Acknowledgements

We thank Professor Youfei Guan (Department of Physiology and Pathophysiology, Peking University Health Science Center, Peking, China) for supplying the C2M12 cell line, and the Department of Immunology, Peking University, for supporting our work. This study was supported by the National Natural Science Foundation of China (nos. 91229102 and 81272237).

Glossary

Abbreviations

Abbreviations:

HMC

human mesangial cell

AngII

angiotensin II

SAC

staphylococcus

siRNA

small interfering RNA

References

1 

Zhou X, Workeneh B, Hu Z and Li R: Effect of immunosuppression on the human mesangial cell cycle. Mol Med Rep. 11:910–916. 2015. View Article : Google Scholar : PubMed/NCBI

2 

Tomana M, Matousovic K, Julian BA, Radl J, Konecny K and Mestecky J: Galactose-deficient IgA1 in sera of IgA nephropathy patients is present in complexes with IgG. Kidney Int. 52:509–516. 1997. View Article : Google Scholar : PubMed/NCBI

3 

Tomana M, Novak J, Julian BA, Matousovic K, Konecny K and Mestecky J: Circulating immune complexes in IgA nephropathy consist of IgA1 with galactose-deficient hinge region and antiglycan antibodies. J Clin Invest. 104:73–81. 1999. View Article : Google Scholar : PubMed/NCBI

4 

Conley ME, Cooper MD and Michael AF: Selective deposition of immunoglobulin A1 in immunoglobulin A nephropathy, anaphylactoid purpura nephritis, and systemic lupus erythematosus. J Clin Invest. 66:1432–1436. 1980. View Article : Google Scholar : PubMed/NCBI

5 

Novak J, Moldoveanu Z, Renfrow MB, Yanagihara T, Suzuki H, Raska M, Hall S, Brown R, Huang WQ, Goepfert A, et al: IgA nephropathy and Henoch-Schoenlein purpura nephritis: Aberrant glycosylation of IgA1, formation of IgA1-containing immune complexes, and activation of mesangial cells. Contrib Nephrol. 157:134–138. 2007. View Article : Google Scholar : PubMed/NCBI

6 

Reily C, Ueda H, Huang ZQ, Mestecky J, Julian BA, Willey CD and Novak J: Cellular signaling and production of galactose-deficient IgA1 in IgA nephropathy, an autoimmune disease. J Immunol Res. 2014:1975482014. View Article : Google Scholar : PubMed/NCBI

7 

Qiu X and Yang G: Existance of Ig-like protein in malignant tumor cells. J Norman Bethune Univ Med Sci. 22:572,574,5751996.

8 

Qiu X and Yang G: The characteristic and gene structure of Ig-like protein in maligant tumor. Chin J Immun. 295:1996.(In Chinese).

9 

Kimoto Y: Expression of heavy-chain constant region of immunoglobulin and T-cell receptor gene transcripts in human non-hematopoietic tumor cell lines. Genes Chromosomes Cancer. 22:83–86. 1998. View Article : Google Scholar : PubMed/NCBI

10 

Zheng H, Li M, Ren W, et al: Expression and secretion of immunoglobulin alpha heavy chain with diverse VDJ recombinations by human epithelial cancer cells. Mol Immunol. 44:2221–2227. 2007. View Article : Google Scholar : PubMed/NCBI

11 

Qiu X, Zhu X, Zhang L, Mao Y, Zhang J, Hao P, Li G, Lv P, Li Z, Sun X, et al: Human epithelial cancers secrete immunoglobulin g with unidentified specificity to promote growth and survival of tumor cells. Cancer Res. 63:6488–6495. 2003.PubMed/NCBI

12 

Zhu X, Li C, Sun X, Mao Y, Li G, Liu X, Zhang Y and Qiu X: Immunoglobulin mRNA and protein expression in human oral epithelial tumor cells. Appl Immunohistochem Mol Morphol. 16:232–238. 2008. View Article : Google Scholar : PubMed/NCBI

13 

Babbage G, Ottensmeier CH, Blaydes J, Stevenson FK and Sahota SS: Immunoglobulin heavy chain locus events and expression of activation-induced cytidine deaminase in epithelial breast cancer cell lines. Cancer Res. 66:3996–4000. 2006. View Article : Google Scholar : PubMed/NCBI

14 

Zheng H, Li M, Ren W, Zeng L, Liu HD, Hu D, Deng X, Tang M, Shi Y, Gong J and Cao Y: Expression and secretion of immunoglobulin alpha heavy chain with diverse VDJ recombinations by human epithelial cancer cells. Mol Immunol. 44:2221–2227. 2007. View Article : Google Scholar : PubMed/NCBI

15 

Chen Z and Gu J: Immunoglobulin G expression in carcinomas and cancer cell lines. FASEB J. 21:2931–2938. 2007. View Article : Google Scholar : PubMed/NCBI

16 

Li M, Feng DY, Ren W, Zheng L, Zheng H, Tang M and Cao Y: Expression of immunoglobulin kappa light chain constant region in abnormal human cervical epithelial cells. Int J Biochem Cell Biol. 36:2250–2257. 2004. View Article : Google Scholar : PubMed/NCBI

17 

Wang C, Xia M, Sun X, He Z, Hu F, Chen L, Bueso-Ramos CE, Qiu X and Yin CC: IGK with conserved IGΚV/IGΚJ repertoire is expressed in acute myeloid leukemia and promotes leukemic cell migration. Oncotarget. 6:39062–39072. 2015.PubMed/NCBI

18 

Jiang C, Huang T, Wang Y, Huang G, Wan X and Gu J: Immunoglobulin G expression in lung cancer and its effects on metastasis. PLoS One. 9:e973592014. View Article : Google Scholar : PubMed/NCBI

19 

Wang J, Lin D, Peng H, Huang Y, Huang J and Gu J: Cancer-derived immunoglobulin G promotes tumor cell growth and proliferation through inducing production of reactive oxygen species. Cell Death Dis. 4:e9452013. View Article : Google Scholar : PubMed/NCBI

20 

Wen YJ, Mancino A, Pashov A, Whitehead T, Stanley J and Kieber-Emmons T: Antigen binding of human IgG Fabs mediate ERK-associated proliferation of human breast cancer cells. DNA Cell Biol. 24:73–84. 2005. View Article : Google Scholar : PubMed/NCBI

21 

Liang PY, Li HY, Zhou ZY, Jin YX, Wang SX, Peng XH and Ou SJ: Overexpression of immunoglobulin G prompts cell proliferation and inhibits cell apoptosis in human urothelial carcinoma. Tumour Biol. 34:1783–1791. 2013. View Article : Google Scholar : PubMed/NCBI

22 

Pan B, Zheng S, Liu C and Xu Y: Suppression of IGHG1 gene expression by siRNA leads to growth inhibition and apoptosis induction in human prostate cancer cell. Mol Biol Rep. 40:27–33. 2013. View Article : Google Scholar : PubMed/NCBI

23 

Huang J, Sun X, Mao Y, Zhu X, Zhang P, Zhang L, Du J and Qiu X: Expression of immunoglobulin gene with classical V-(D)-J rearrangement in mouse brain neurons. Int J Biochem Cell Biol. 40:1604–1615. 2008. View Article : Google Scholar : PubMed/NCBI

24 

Huang J, Sun X, Gong X, He Z, Chen L, Qiu X and Yin CC: Rearrangement and expression of the immunoglobulin µ-chain gene in human myeloid cells. Cell Mol Immunol. 11:94–104. 2014. View Article : Google Scholar : PubMed/NCBI

25 

Huang J, Zhang L, Ma T, Zhang P and Qiu X: Expression of immunoglobulin gene with classical V-(D)-J rearrangement in mouse testis and epididymis. J Histochem Cytochem. 57:339–349. 2009. View Article : Google Scholar : PubMed/NCBI

26 

Zhang S, Mao Y, Huang J, Ma T, Zhang L, Zhu X, Zheng J, Wu L, Yin CC and Qiu X: Immunoglobulin gene locus events in epithelial cells of lactating mouse mammary glands. Cell Mol Life Sci. 67:985–994. 2010. View Article : Google Scholar : PubMed/NCBI

27 

Liu J, Xia M, Wang P, Wang C, Geng Z, Cameron Yin C, Zhang C and Qiu X: Immunoglobulin gene expression in umbilical cord blood-derived CD34+ hematopoietic stem/progenitor cells. Gene. 575:108–117. 2016. View Article : Google Scholar : PubMed/NCBI

28 

Kang BY, Hu C, Prayaga S, Khaidakov M, Sawamura T, Seung KB and Mehta JL: LOX-1 dependent overexpression of immunoglobulins in cardiomyocytes in response to angiotensin II. Biochem Biophys Res Commun. 379:395–399. 2009. View Article : Google Scholar : PubMed/NCBI

29 

Niu N, Zhang J, Sun Y, Wang S, Sun Y, Korteweg C, Gao W and Gu J: Expression and distribution of immunoglobulin G and its receptors in an immune privileged site: The eye. Cell Mol Life Sci. 68:2481–2492. 2011. View Article : Google Scholar : PubMed/NCBI

30 

Lei Y, Huang T, Su M, Luo J, Korteweg C, Li J, Chen Z, Qiu Y, Liu X, Yan M, et al: Expression and distribution of immunoglobulin G in the normal liver, hepatocarcinoma and postpartial hepatectomy liver. Lab Invest. 94:1283–1295. 2014. View Article : Google Scholar : PubMed/NCBI

31 

Wang S, Huang G, Wang Y, Huang T, Lin S and Gu J: Up-regulation of immunoglobulin G gene expression in the hippocampus of rats subjected to acute immobilization stress. J Neuroimmunol. 258:1–9. 2013. View Article : Google Scholar : PubMed/NCBI

32 

Ruan XZ, Varghese Z, Fernando R and Moorhead JF: Cytokine regulation of low-density lipoprotein receptor gene transcription in human mesangial cells. Nephrol Dial Transplant. 13:1391–1397. 1998. View Article : Google Scholar : PubMed/NCBI

33 

Sraer JD, Delarue F, Hagege J, Feunteun J, Pinet F, Nguyen G and Rondeau E: Stable cell lines of T-SV40 immortalized human glomerular mesangial cells. Kidney Int. 49:267–270. 1996. View Article : Google Scholar : PubMed/NCBI

34 

Prendergast L, van Vuuren C, Kaczmarczyk A, Doering V, Hellwig D, Quinn N, Hoischen C, Diekmann S and Sullivan KF: Premitotic assembly of human CENPs-T and -W switches centromeric chromatin to a mitotic state. PLoS Biol. 9:e10010822011. View Article : Google Scholar : PubMed/NCBI

35 

Coldwell MJ, Cowan JL, Vlasak M, Mead A, Willett M, Perry LS and Morley SJ: Phosphorylation of eIF4GII and 4E-BP1 in response to nocodazole treatment: A reappraisal of translation initiation during mitosis. Cell Cycle. 12:3615–3628. 2013. View Article : Google Scholar : PubMed/NCBI

36 

Jose S, Tan SW, Ooi YY, Ramasamy R and Vidyadaran S: Mesenchymal stem cells exert anti-proliferative effect on lipopolysaccharide-stimulated BV2 microglia by reducing tumour necrosis factor-α levels. J Neuroinflammation. 11:1492014. View Article : Google Scholar : PubMed/NCBI

37 

Zheng J, Huang J, Mao Y, Liu S, Sun X, Zhu X, Ma T, Zhang L, Ji J, Zhang Y, et al: Immunoglobulin gene transcripts have distinct VHDJH recombination characteristics in human epithelial cancer cells. J Biol Chem. 284:13610–13619. 2009. View Article : Google Scholar : PubMed/NCBI

38 

Brown TT Jr..Schultz RD, Duncan JR and Bistner SI: Serological response of the bovine fetus to bovine viral diarrhea virus. Infect Immun. 25:93–97, 197. PubMed/NCBI

39 

Roberts IS: Pathology of IgA nephropathy. Nat Rev Nephrol. 10:445–454. 2014. View Article : Google Scholar : PubMed/NCBI

40 

Valentijn RM, Radl J, Haaijman JJ, Vermeer BJ, Weening JJ, Kauffmann RH, Daha MR and van Es LA: Circulating and mesangial secretory component-binding IgA-1 in primary IgA nephropathy. Kidney Int. 26:760–766. 1984. View Article : Google Scholar : PubMed/NCBI

41 

Novak J, Julian BA, Mestecky J and Renfrow MB: Glycosylation of IgA1 and pathogenesis of IgA nephropathy. Semin Immunopathol. 34:365–382. 2012. View Article : Google Scholar : PubMed/NCBI

42 

Lai KN, Leung JC, Chan LY, Saleem MA, Mathieson PW, Lai FM and Tang SC: Activation of podocytes by mesangial-derived TNF-alpha: Glomerulo-podocytic communication in IgA nephropathy. Am J Physiol Renal Physiol. 294:F945–F955. 2008. View Article : Google Scholar : PubMed/NCBI

43 

Lai KN: Pathogenesis of IgA nephropathy. Nat Rev Nephrol. 8:275–283. 2012. View Article : Google Scholar : PubMed/NCBI

44 

Hu D, Duan Z, Li M, Jiang Y, Liu H, Zheng H, Li L, Bode AM, Dong Z and Cao Y: Heterogeneity of aberrant immunoglobulin expression in cancer cells. Cell Mol Immunol. 8:479–485. 2011. View Article : Google Scholar : PubMed/NCBI

45 

Zheng H, Li M, Liu H, Ren W, Hu DS, Shi Y, Tang M and Cao Y: Immunoglobulin alpha heavy chain derived from human epithelial cancer cells promotes the access of S phase and growth of cancer cells. Cell Biol Int. 31:82–87. 2007. View Article : Google Scholar : PubMed/NCBI

46 

Kang BP, Urbonas A, Baddoo A, Baskin S, Malhotra A and Meggs LG: IGF-1 inhibits the mitochondrial apoptosis program in mesangial cells exposed to high glucose. Am J Physiol Renal Physiol. 285:F1013–F1024. 2003. View Article : Google Scholar : PubMed/NCBI

47 

Qiu LQ, Sinniah R and I-Hong Hsu S: Downregulation of Bcl-2 by podocytes is associated with progressive glomerular injury and clinical indices of poor renal prognosis in human IgA nephropathy. J Am Soc Nephrol. 15:79–90. 2004. View Article : Google Scholar : PubMed/NCBI

48 

Denault JB and Salvesen GS: Caspases: Keys in the ignition of cell death. Chem Rev. 102:4489–4500. 2002. View Article : Google Scholar : PubMed/NCBI

49 

Philchenkov AA: Caspases as regulators of apoptosis and other cell functions. Biochemistry (Mosc). 68:365–376. 2003. View Article : Google Scholar : PubMed/NCBI

50 

Tsurumi H, Harita Y, Kurihara H, Kosako H, Hayashi K, Matsunaga A, Kajiho Y, Kanda S, Miura K, Sekine T, et al: Epithelial protein lost in neoplasm modulates platelet-derived growth factor-mediated adhesion and motility of mesangial cells. Kidney Int. 86:548–557. 2014. View Article : Google Scholar : PubMed/NCBI

51 

Karaköse E, Geiger T, Flynn K, Lorenz-Baath K, Zent R, Mann M and Fässler R: The focal adhesion protein PINCH-1 associates with EPLIN at integrin adhesion sites. J Cell Sci. 128:1023–1033. 2015. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

April 2018
Volume 17 Issue 4

Print ISSN: 1791-2997
Online ISSN:1791-3004

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
APA
Deng, H., Ma, J., Jing, Z., Deng, Z., Liang, Y., A, L. ... Wang, Y. (2018). Expression of immunoglobulin A in human mesangial cells and its effects on cell apoptosis and adhesion. Molecular Medicine Reports, 17, 5272-5282. https://doi.org/10.3892/mmr.2018.8544
MLA
Deng, H., Ma, J., Jing, Z., Deng, Z., Liang, Y., A, L., Liu, Y., Qiu, X., Wang, Y."Expression of immunoglobulin A in human mesangial cells and its effects on cell apoptosis and adhesion". Molecular Medicine Reports 17.4 (2018): 5272-5282.
Chicago
Deng, H., Ma, J., Jing, Z., Deng, Z., Liang, Y., A, L., Liu, Y., Qiu, X., Wang, Y."Expression of immunoglobulin A in human mesangial cells and its effects on cell apoptosis and adhesion". Molecular Medicine Reports 17, no. 4 (2018): 5272-5282. https://doi.org/10.3892/mmr.2018.8544