This article is mentioned in:

Introduction

Chronic sinusitis with nasal polyposis (CRSwNP) is an inflammatory disease of the nasal cavity. Paranasal sinuses develop grape-like structures, leading to nasal obstruction, olfactory disturbance, headache, chronic inflammatory diseases and postnasal drip, which severely affect the quality of life of patients (1,2). CRS is usually caused by repeated bouts of acute inflammation, which lead to pathological changes of the nasal aperture and epithelial ciliary dysfunction (1). The nasal aperture becomes swollen, hypertrophic and polypoid, thereby obstructing drainage of the sinus orifices and leading to CRS (2). The characteristics of CRSwNP include T helper (Th) 2 regulation and eosinophilic inflammation (3).

Interleukin-10 (IL-10) is a potent anti-inflammatory cytokine, which protects the host from excessive tissue damage, and serves a key role in the development and maintenance of immune tolerance and homeostasis (4). The levels of IL-10 are reduced in various chronic inflammatory diseases, including inflammatory bowel disease (5) and spontaneous colitis (6). Imbalance in the levels of IL-10 amplifies the local inflammatory response, which aggravates histopathological changes, and increases the risk of developing autoimmune diseases (7). Consequently, IL-10 is a potential therapeutic target for nasal polyps (8,9).

Electroacupuncture (EA) is a non-drug, adjuvant therapy for certain inflammatory diseases, such as peripheral inflammation (10). It reportedly prevents the nuclear transport of the nuclear factor (NF)-κB p65 subunit, and thereby inhibits the NF-κB signaling pathway and reduces inflammatory damage (11). Additionally, acupuncture has been used as a therapy for CRS (12,13); however, the mechanisms via which this is achieved have not been fully elucidated. The present study evaluated the therapeutic effects of EA combined with IL-10 overexpression on CRS in mice and investigated the associated mechanisms.

Materials and methods

Mouse model of CRS

A total of 35 male C57BL/6J mice (3 months of age; body weight ~25 g) were obtained from Hunan Slake Jingda Laboratory Co., Ltd (Hunan, China) and maintained in specific pathogen-free conditions at a temperature of 23±2°C and a relative humidity of 45–65% under a controlled 12:12-h light/dark cycle, with access to food and water ad libitum. On days 0 and 5, the mice were injected intraperitoneally with 2 µg ovalbumin (OVA; cat. no. S7951MSDS; Sigma-Aldrich; Merck KGaA) + 2 mg aluminum hydroxide gel (cat. no. A8222; Sigma-Aldrich; Merck KGaA) to induce CRS as previously described (14). On days 12–19, the animals received 40 µl of 3% OVA nasally. Subsequently, three drops (~3 µl) of 3% OVA were administered per week to induce a long-term inflammatory response over 12 weeks. The control group was treated with a similar volume of saline. All protocols were supervised and approved by the Ethics Committee of Jiangxi University of Chinese Medicine.

Reverse transcription-quantitative PCR (RT-qPCR)

Virus-encoded IL-10 (pGreenPuro™ plasmid packaged in serotype 5 adenovirus) was established by Shanghai GenePharma Co., Ltd. and confirmed in rat cardiac fibroblasts. Adenovirus containing empty pGreenPuro plasmid was used as the control vector. Rat cardiac fibroblasts were purchased from the Cell Bank of Chinese Academy of Sciences, and cultured at 37°C with 5% CO2 in Dulbecco's Modified Eagle's medium (Gibco; Thermo Fisher Scientific, Inc.) supplemented with 10% fetal calf serum (HyClone; GE Healthcare Life Sciences), 100 U/ml penicillin and 100 mg/ml streptomycin. Cells at 70% confluence were transfected with virus (1×105 IFU/ml) using Lipofectamine™ 2000 (Invitrogen; Thermo Fisher Scientific, Inc.). At 24 h later, RNA was extracted from cardiac fibroblasts using TRIzol® reagent (Baosheng Science & Technology Innovation Co., Ltd.) and reverse transcribed into cDNA using an Ultrapure SMART MMLV RT kit (cat. no. 639522, Takara Biotechnology Co., Ltd.) according to the manufacturer's protocol. The cDNA was used as a template for detection by fluorescence qPCR (SYBR Green Master Mix; cat. no. HY-K0501; MedChemExpress LLC) according to the following protocol: 40 cycles of 95°C for 10 sec (denaturation), 53°C for 30 sec (annealing) and 72°C for 30 sec (extension), and a final extension of 72°C for 10 min. The relative expression of IL-10 mRNA was calculated with GAPDH as the internal reference using the 2−∆∆Cq method as previously described (15). The primers are presented in Table I.

Table I. Primer sequences.

Table I.

Primer sequences.

Gene	Primer (5′-3′)	Primer length (bp)	Product length (bp)	Annealing temperature (°C)
IL-10	Forward, CAACATACTGCTGACAGATTCCT	23	236	58.4
	Reverse, GCTCCACTGCCTTGCTTT	18
GAPDH	Forward, GCAAGTTCAACGGCACAG	18	141	58.6
	Reverse, CGCCAGTAGACTCCACGAC	19

[i] Bp, base pairs; IL-10, interleukin-10.

Experimental groups

The animals were divided into seven groups (n=5 in each group) as follows: i) Control group; ii) OVA group; iii) OVA + EA group; iv) OVA + vector group; v) OVA + vector + EA group; vi) OVA + IL-10 group; and vii) OVA + IL-10 + EA group. Mice in the control, OVA and OVA + EA groups were injected with 0.5 ml saline via the tail vein. On day 20 following first injection with OVA, a volume of 0.5 ml of the virus encoding blank vector was injected in the OVA + vector and OVA + vector + EA groups, whereas 0.5 ml adenovirus encoding IL-10 was injected in the OVA + IL-10 and OVA + IL-10 + EA groups. Following the virus injection, the animals in the OVA + EA, OVA + vector + EA and OVA + IL-10 + EA groups received the first round of electroacupuncture on day 20. Briefly, the animals were anesthetized using isoflurane (1% in oxygen). EA was conducted in the following corresponding acupoints of mice: i) Zusanli (lateral knee joint, 3.5 mm below the capitulum fibulae; a 3-mm straight puncture); ii) Feishu (between the ribs below the third thoracic vertebra); iii) Yingxiang (lateral upper end of the nostril, at the hairless junction; a 2–3 mm oblique puncture inward and upward); and iv) Hegu (1-mm straight puncture between the first and second metacarpal bones of the forelimb). Each mouse was stimulated by EA using a Huatuo SDZ-II Electronic Acupuncture Therapy Instrument (Suzhou Medical Supplies Factory Co., Ltd.) at the same acupoint for 30 min (once a day for 10 days). Following treatment, the animals were anesthetized by isoflurane (1% in oxygen) via inhalation and decapitated. Nasal tissues were collected on ice using surgical tools under a dissecting microscope (SZ61; Olympus Corporation). Fresh tissues were stored at −80°C or fixed in 4% paraformaldehyde overnight at 4°C.

Hematoxylin and eosin staining

Nasal tissues were washed for 1 h with phosphate-buffered saline (PBS), following which they were fixed with 4% paraformaldehyde at 4°C overnight. The tissues were then dehydrated by 70, 80 and 90% ethanol, and mixed with anhydrous ethanol and xylene for 15 min, xylene I for 15 min and xylene II for 15 min (until transparent). Tissues were embedded in paraffin and sliced (10 µm). The paraffin slices were dewaxed and hydrated. The sections were stained with hematoxylin for 3 min at room temperature, differentiated by ethanol hydrochloride for 15 sec, washed slightly and stained with eosin for 3 min at room temperature. The sections were then mounted on slides and observed under a light microscope (magnification, ×200).

Immunohistochemistry

Nasal tissues were fixed in 4% paraformaldehyde overnight at 4°C. The tissues were subjected to dehydration, embedding and slicing. The paraffin sections (10 µm) were then dewaxed and hydrated. Sections were incubated with 3% (v/v) hydrogen peroxide for 5 min at room temperature to block endogenous peroxidase activity. Following blocking in 5% goat serum (cat. no. G9023; Sigma-Aldrich; Merck KGaA) at room temperature for 2 h, the sections were incubated with the following primary antibodies overnight at 4°C: Rabbit polyclonal anti-IL-10 (1:300; cat. no. bs-20373R; BIOSS) and rabbit polyclonal anti-interferon-γ (IFN-γ; 1:300; cat. no. bs-0480R; BIOSS). The slides were then washed with PBS and incubated with the secondary antibody (horseradish peroxidase-labeled goat anti-rabbit IgG; 1:10,000; cat. no. A16104SAMPLE; Thermo Fisher Scientific, Inc.) for 30 min at room temperature. Sections were subsequently stained with 3,3′-diaminobenzidine chromogen for 3 min and counterstained with hematoxylin and eosin (3%, 3 min) at room temperature. Images of four fields for each group were acquired under a light microscope (BX51; Olympus Corporation), and expression density was analyzed by ImageJ software version 1.48 (National Institutes of Health).

Western blotting

Protein was extracted from each group using a protein isolation kit (ReadyPrep; cat. no. 28-9425-44; GE Healthcare Life Sciences). The concentration of the proteins was quantified using a bicinchoninic acid assay. Thereafter, 25 µg of protein was separated via 12% SDS-PAGE. The proteins were then transferred onto polyvinylidene difluoride membranes. The membranes were blocked in 5% milk for 2 h at room temperature. The following primary antibodies were incubated with tissues overnight at 4°C: Rabbit polyclonal anti-IL-10 (1:300; cat. no. bs-20373R; BIOSS), rabbit polyclonal anti-IFN-γ (1:300; cat. no. bs-0480R; BIOSS) and mouse monoclonal anti-GAPDH (1:2,000; cat. no. TA-08; ZSBIO). The membrane was incubated with peroxidase-conjugated anti-mouse (1:2,000; cat. no. TA130003) or anti-rabbit (1:2,000; cat. no. TA140003; OriGene Technologies, Inc.) secondary antibodies for 2 h at room temperature. Protein bands were visualized using enhanced chemiluminescence (SuperSignal™ West Pico Chemiluminescent Substrate; cat. no. 34580; Thermo Fisher Scientific, Inc.). Five repeats were performed, and expression density was analyzed using ImageJ version 1.48.

Statistical analysis

Data are presented as the mean ± standard error of the mean (n=5/group for each experiment). SPSS software (version 17; SPSS, Inc.) was used to analyze the data. One-way analysis of variance was applied to the data, followed by the Newman-Keuls post-hoc test. P<0.05 was considered to indicate a statistically significant difference.

Results

Morphological changes in the mucosa of the nasal sinuses following establishment of the CRS model

As presented in Fig. 1, the pseudostratified epithelium of the mucosa of the nasal sinuses in the control group exhibited a neatly arranged, complete structure. No infiltration of inflammatory cells was observed in the submucosa. By contrast, the OVA group showed severe inflammation, a disordered arrangement of mucosal epithelium, necrosis and exfoliation. These results indicated that injury of pseudostratified epithelium was induced in the CRS model.

Figure 1. Treatment with EA and IL-10 ameliorates the injury of the pseudostratified epithelium. Epithelial injury was determined using hematoxylin and eosin staining. The pseudostratified epithelium of the mucosa of the nasal sinuses was impaired in the OVA group and exfoliation was observed (black arrow). Infiltration of inflammatory cells and nuclear condensation were observed in the submucosa (white arrow). Scale bar, 100 µm. EA, electroacupuncture; IL-10, interleukin-10; OVA, ovalbumin.

Virus-encoded IL-10 promotes IL-10 expression

As presented in Fig. 2, the expression of IL-10 in cardiac fibroblasts transduced with virus-encoded IL-10 was significantly increased compared with in the control group (P<0.05), whereas the empty vector virus did not affect IL-10 expression. Therefore, the virus-encoded IL-10 was used in the subsequent experiments.

Figure 2. Confirmation of IL-10 expression in fibroblasts. Expression of IL-10 was significantly increased in the virus-encoded IL-10 group compared with the control group. *P<0.05 vs. control. IL-10, interleukin-10.

Treatment with EA and IL-10 ameliorates injury of the pseudostratified epithelium

The OVA group and OVA + vector group exhibited severe inflammation, disordered arrangement of the mucosal epithelium, necrosis and exfoliation. Treatment with EA (OVA + EA group) or IL-10 (OVA + IL-10 group) resulted in attenuation of the injury induced by the CRS model (Fig. 1). Notably, combination therapy with EA and IL-10 was more effective than treatment with EA or IL-10 alone. In the OVA + IL-10 + EA group, cells were neatly arranged and few inflammatory cells were observed (Fig. 1).

Treatment with EA and IL-10 increases IFN-γ and IL-10 expression

The results of immunohistochemistry are presented in Fig. 3. Compared with the control group, the expression of IFN-γ in the OVA group was significantly decreased (P<0.05). Compared with the OVA group, the expression of IFN-γ was promoted by EA (OVA + EA group) and virus-encoded IL-10 (OVA + IL-10 group; P<0.05), but not by the virus-encoding vector (OVA + vector group). The combined effect of EA and IL-10 (OVA + IL-10 + EA group) was significantly increased compared with EA or IL-10 alone (P<0.05).

Figure 3. Treatment with EA and IL-10 rescues IFN-γ expression. Immunohistochemistry revealed that IFN-γ expression was decreased in the OVA group, but promoted by EA and virus-encoded IL-10. Upper panel, representative images of each group. Scale bar, 100 µm. Lower panel, IFN-γ protein level quantification. *P<0.05 vs. control; #P<0.05 vs. OVA; $P<0.05 vs. OVA+IL-10+EA. EA, electroacupuncture; IL-10, interleukin-10; IFN-γ, interferon-γ; OVA, ovalbumin.

The results of IL-10 expression are shown in Fig. 4. Compared with the control group, the expression of IL-10 in the OVA group was significantly decreased (P<0.05). Compared with the OVA group, the expression of IL-10 was promoted by EA (OVA + EA group) and virus-encoded IL-10 (OVA + IL-10 group; P<0.05), but not by the virus-encoding vector (OVA + vector group). Combined treatment with EA did not further promote IL-10 expression compared with IL-10 overexpression alone (P>0.05).

Figure 4. Treatment with EA and IL-10 rescues IL-10 expression. Immunohistochemistry showed that IL-10 expression was decreased in the model group, but promoted by EA and virus-encoded IL-10. Upper panel, representative images of each group. Lower panel, IL-10 protein level quantification. *P<0.05 vs. control; #P<0.05 vs. OVA; $P<0.05 vs. OVA+IL-10+EA. Scale bar, 100 µm. EA, electroacupuncture; IL-10, interleukin-10; OVA, ovalbumin.

The expression of IFN-γ and IL-10 was also quantified by western blotting. Consistently, OVA treatment reduced IFN-γ and IL-10 expression, whereas EA or IL-10 overexpression promoted the expression of IL-10 and IFN-γ in OVA-treated mice. The combination of EA and overexpression of IL-10 further promoted IFN-γ, but not IL-10 levels, compared with the individual treatments (Fig. 5).

Figure 5. Treatment with EA and IL-10 increases IL-10 and IFN-γ expression. (A) Representative blots of IFN-γ and IL-10. (B) Western blotting showed that IFN-γ expression was decreased in the model group, but promoted by EA and virus-encoded IL-10. (C) Western blotting showed that IL-10 expression was decreased in the model group, but promoted by EA and virus-encoded IL-10. *P<0.05 vs. control; #P<0.05 vs. OVA; $P<0.05 vs. OVA+IL-10+EA. EA, electroacupuncture; IL-10, interleukin-10; IFN-γ, interferon-γ; OVA, ovalbumin.

Discussion

The current study provided novel data demonstrating the protective effects of EA and IL-10 on CRS in mice. Based on the morphological changes observed, EA and virus-encoded IL-10 ameliorated the injured pseudostratified epithelium. Notably, the combined application of EA and IL-10 expression induced additive effects, likely via the upregulation of IFN-γ.

An animal model of sinusitis is important for the basic and clinical research of this type of disease. The stability and repeatability of the model also guarantee progress of the research. From the early 20th century, animal models have been used in sinusitis research, and OVA has been used as an agent to induce CRS (16). In the current study, OVA was used to induce CRS, whereas aluminum hydroxide gel was used to protect against gastric injury induced by OVA, and morphological changes of the mucosa of the nasal sinus were observed (14). The pseudostratified epithelium of the mucosa of the nasal sinus was impaired in the model group, and was characterized by severe inflammation, disordered arrangement of the mucosal epithelium, necrosis and exfoliation, all of which are symptoms of sinusitis (14). Furthermore, EA treatment ameliorated the abnormal changes of the mucosa. The results obtained in the current study suggested that the mouse model of sinusitis was successfully induced, and that EA exerted protective effects in this model.

As a major anti-inflammatory cytokine, IL-10 serves important roles in tumors, infections, organ transplantation, and the hematopoietic and cardiovascular systems (17,18). Furthermore, IL-10 is closely associated with the blood, digestion and diseases of the cardiovascular system (19). Impaired IL-10 production, in response to Staphylococcus aureus enterotoxin B in nasal polyps, likely exacerbates the pathophysiological mechanisms of eosinophilic chronic rhinosinusitis, including eosinophilia and obstruction of the lower airway (20). In the present study, IL-10 levels were reduced in the OVA group compared with the control group. By contrast, EA treatment promoted IL-10 expression. These data suggested that EA likely exerted protective effects in CRS by increasing IL-10 levels. IL-10 upregulation has a protective effect in CRSwNP (8,9). In allergic fungal rhinosinusitis, IL-10 levels were reportedly reduced (21), indicating that IL-10 may be a potential therapeutic target for the treatment of CRSwNP caused by various pathologic factors (22). In the present study, EA alone improved IL-10 expression in the CRS model, but in combination with IL-10 overexpression, did not further promote IL-10 expression. IL-10 acts by blocking the metabolism of macrophages as part of this inflammatory response (CD4+ T-cell responses) (23). Specifically, IL-10 is able to inhibit lipopolysaccharide-induced glucose uptake and glycolysis, and promote oxidative phosphorylation (24). In addition, a reduction in IL-10 levels damaged mitochondria by promoting mitochondrial autophagy, and subsequently eliciting inflammation (25).

The IFN-γ cytokine has antiviral, immunomodulatory and antitumor properties (26,27). In addition to inducing the differentiation and maturation of Th1 cells and increasing IFN-γ levels in the serum, EA inhibits the differentiation and maturation of Th2 cells and the production of cytokines (28). Thus, EA inhibits the transformation of Thl cells to Th2 cells, and thereby corrects any imbalance in the number of Thl/2 cells (28,29) and enhances the cellular immune response. In the present study, IL-10 overexpression attenuated the reduction in IFN-γ levels observed in the OVA model. Furthermore, EA alone promoted IFN-γ expression. These findings suggested that IL-10 may act upstream of IFN-γ in immunotherapy. Indeed, IL-10 controlled IFN-γ and the production of tumor necrosis factor during experimental endotoxemia (30). However, IFN-γ could also reprogram IL-10 activity in macrophages (31). Nevertheless, the cooperative actions of IFN-γ and IL-10 in the regulation of cell functions cannot be ignored (32). In the current study, EA did not further promote IL-10 levels but increased IFN-γ when applied in combination with IL-10 overexpression. These findings suggested that EA may function via various mechanisms to promote IFN-γ expression.

Treatment with EA may promote the secretion of adrenocortical hormones, thereby enhancing the function of the pituitary-adrenal cortex and sympathetic-adrenal systems to improve resistance to certain diseases, such as myocardial ischemia injury (33). In addition, EA therapy enhanced immunity by improving the phagocytic ability of the mononuclear macrophage system (34) and function of T helper cells (35) in rats. Moreover, EA increased microvascular perfusion, improved blood circulation, supported the lymphatic and nervous systems and regulated cellular and humoral immunity in humans (36). Thus, the exact mechanisms of EA in the treatment of CRSwNP require further investigation.

The present study possessed to certain limitations. EA promoted IL-10 expression and IL-10 overexpression ameliorated the pathological changes of CRSwNP; however, the underlying mechanisms were not elucidated. The manner via which IL-10 regulates IFN-γ requires clarification. An increased number of quantified parameters to evaluate pathological changes should be detected to confirm the effectiveness and uniformity of the treatment administered by nasal drops. Finally, a transgenic model, such as IL-10 knockout mice, may be more effective in determining the underlying mechanisms.

In conclusion, EA and IL-10 effectively inhibit inflammation and increase the expression of IFN-γ, and thereby exert various specific effects in the treatment of CRS in mice. These data may provide novel insight for the future treatment of CRS.

Acknowledgements

Not applicable.

Funding

The current study was supported by grants from the Jiangxi Education Department, the Jiangxi Provincial Health Planning Commission (grant no. 2016A102) and the State Administration of Chinese Medicine (grant no. 201507006).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

LZ and YS conceived and designed the experiments. JH, ZW and XL performed the experiments and analyzed the data. LZ and YS wrote the manuscript. All authors read and approved the manuscript and agree to be accountable for all aspects of the research in ensuring that the accuracy or integrity of any part of the work are appropriately investigated and resolved.

Ethics approval and consent to participate

The experimental protocols were approved by the Ethics Committee of Jiangxi University of Chinese Medicine.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References