Open Access

Regulatory mechanism of NOV/CCN3 in the inflammation and apoptosis of lung epithelial alveolar cells upon lipopolysaccharide stimulation

  • Authors:
    • Hai‑Ping Zhu
    • Hui‑Ya Huang
    • Deng‑Min Wu
    • Nian Dong
    • Li Dong
    • Cheng‑Shui Chen
    • Chao‑Lei Chen
    • Yu‑Guo Chen
  • View Affiliations

  • Published online on: September 9, 2019     https://doi.org/10.3892/mmr.2019.10655
  • Pages: 1872-1880
  • Copyright: © Zhu et al. This is an open access article distributed under the terms of Creative Commons Attribution License.

Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Lipopolysaccharide (LPS) induces stress inflammation and apoptosis. Pulmonary epithelial cell apoptosis, which accelerates the progression of acute lung injury (ALI)/acute respiratory distress syndrome (ARDS), is the leading cause of mortality in patients with ALI/ARDS. The nephroblastoma overexpressed protein (CCN3), an inflammatory modulator, is reported to be a biomarker in ALI. Using the LPS-induced ALI model, this study investigated the expression of CCN3 and its possible molecular mechanism in lung alveolar epithelial cell inflammation and apoptosis. Our data revealed that LPS treatment greatly increased the level of CCN3 in A549 cells. The A549 cells were transfected with specific CCN3 small interfering RNA (siRNA) using transfection reagent. CCN3 siRNA not only largely attenuated the expressions of the inflammatory cytokines interleukin (IL)-1β and transforming growth factor (TGF)-β1, but also reduced the apoptotic rate of the AEC II cells and affected the expressions of the apoptosis-associated proteins (Bcl-2 and caspase-3). Furthermore, CCN3 knockdown greatly inhibited the activation of nuclear factor-κB p65 in A549 cells. In addition, TGF-β/p-Smad inhibitor (TP0427736) and NF-κB inhibitor (PDTC) significantly attenuated the expression level of CCN3 in A549 cells. In conclusion, our data indicated that CCN3 siRNA affected downstream signal through TGF-β/ p-Smad or NF-κB pathway, leading to the inhibition of cell inflammation and apoptosis in human alveolar epithelial cells.

Introduction

Acute lung injury (ALI) or its severe form, acute respiratory distress syndrome (ARDS), is characterized by an excessive and uncontrolled inflammatory response, which results in increased permeability of the alveolar-capillary barrier, alveolar flooding and acute respiratory failure (1,2). Type II alveolar epithelial cells (AEC II), the progenitor cells in the corners of alveoli, are thought to play a central role in the pathogenesis of ALI by synthesizing, secreting and reutilizing surfactant (3). In addition, the apoptosis of AEC II directly accelerates the progression of ALI, which is the leading cause of mortality in patients with ARDS (46).

The nephroblastoma overexpressed protein (NOV/CCN3), is a cysteine-rich protein that belongs to the CCN (Cyr61, CTGF, Nov) family of matricellular proteins with a variety of functions (7,8). CCN3 has been previously shown to be involved in regulating a variety of chronic inflammatory diseases, such as atherosclerosis, rheumatoid arthritis and liver disease (7,9,10). In addition, studies have also shown that CCN proteins are key signaling and regulatory molecules involved in the pathophysiology of various lung diseases, including lung cancer, chronic obstructive pulmonary disease and ventilator-induced lung injury (1115). By integrating the proteomic profiles of inflammatory mediators with clinical informatics, our previous study (16) indicated that the plasma levels of CCN3 and other inflammatory mediators were significantly increased in patients with severe pneumonia-induced ARDS compared to the healthy controls. Thus, we hypothesized that CCN3 could play a role in the pathophysiology of ALI/ARDS.

Proteins involved in transcriptional regulation, such as nuclear factor (NF)-κB and transforming growth factor (TGF)-β, have been implicated in the development and progression of ALI and ARDS (1721). Human A549 alveolar epithelial cells have been widely used as an epithelial cell injury model to examine lipopolysaccharide (LPS)-induced acute lung inflammatory response (2228). The objective of this study was to reveal the potential role and underlying mechanism of CCN3 in lung dysfunction from the perspective of inflammation and apoptosis using siRNA-mediated transfection approach.

Materials and methods

Reagents and chemicals

Human lung alveolar type II epithelial A549 cells were obtained from the Cell Bank of the Chinese Academy of Science (Shanghai, China). LPS (Sigma-Aldrich; Merck KGaA), anti-TGF-β1 antibody (cat. no. ab64715, Abcam), ALK5 inhibitor (TP0427736; cat. no. S8700, Selleck Chemicals), pyrrolidine dithiocarbamate (PDTC; cat. no. S363302, Selleck Chemicals) and immunohistochemistry reagents and kits (Beyotime, China) were used in this study. Other reagents and chemicals were obtained from Western Biotechnology (China).

Lung alveolar epithelial cell culture

Human A549 cells were cultured in F12K medium (Gibco; Thermo Fisher Scientific, Inc.), containing 10% FBS, 100 U/ml penicillin, and 100 mg/ml streptomycin, in a 37°C/5% CO2 atmosphere. The medium was routinely changed every 3 days to remove non-adherent cells.

siRNA transfection

Cells were transfected with 100 nM negative control (NC)-siRNA or CCN3-siRNA (Invitrogen; Thermo Fisher Scientific, Inc.) using Lipofectamine 2000 (cat. no. 11668019; Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions (29).

Enzyme-linked immunosorbent assay (ELISA)

The levels of tumor necrosis factor (TNF)-α, IL-1β and TGF-β1 in the supernatant of cultured cells were analyzed using sandwich ELISA kits (cat. nos. F02810, F01220 and F02750; Bio-Tek Inc., USA), respectively, according to the manufacturer's instructions. The optical density of each well was assayed at 450 nm on a microplate reader.

Flow cytometric analysis

BD Pharmingen™ FITC Annexin V Apoptosis Detection Kit I (cat. no. 556547; BD Biosciences) was used to quantify apoptotic cells according to the manufacturer's instructions. After the treatments, cells were harvested, trypsinized, and rinsed twice with PBS. The suspended cells were incubated with 5 µl Annexin V-FITC solution and 5 µl propidium iodide (PI) solution at 4°C for 15 min. The cells were then suspended in 400 µl binding buffer and subjected to flow cytometry (BD Biosciences), and the rates of apoptotic and necrotic cells were determined using CytExpert 2.3.0.84 (Beckman Coulter, Inc.).

Real-time quantitative PCR (qPCR)

Total RNA was extracted from A549 cells using Trizol reagent (Beyotime, China), and then used for first-strand cDNA synthesis. qPCR was performed using an Applied Biosystems™ SYBR Green I Real-Time PCR Master Mix system (Funglyn Biotech, Canada). The amplification program was set to 94°C for 4 min, 35 cycles of 94°C for 20 sec and 60°C for 30 sec, and 72°C for 30 sec as a final elongation step. The gene expression level was normalized to GAPDH as the internal gene using the 2−ΔΔCq method (30). The primer sequences used in this study are shown in Table I.

Table I.

Sequences of primers used for reverse transcription-quantitative PCR.

Table I.

Sequences of primers used for reverse transcription-quantitative PCR.

GenesPrimer sequences (5′-3′)
CCN3Forward GGAGGATTCACTGGGAGGC
(153 bp)Reverse ATTGACGGTTCCTATTGGTGAC
Bcl-2Forward AGGGACGGGGTGAACTGG
(175 bp)Reverse CTACCCAGCCTCCGTTATCC
TGF-β1Forward CGTGGAGGGGAAATTGAGG
(185 bp)Reverse GCCATGAGAAGCAGGAAAGG
GAPDHForward ATCCCATCACCATCTTCCAGG
(146 bp)Reverse GATGACCCTTTTGGCTCCC

[i] CCN3, nephroblastoma overexpressed (also known as NOVTGF-β1, transforming growth factor-β1.

Western blot analysis

A549 cells were seeded at a density of 1×106 cells with 0.1 ml RIPA buffer. After passaging and centrifugation (12,000 × g for 15 min), the supernatants were collected and protein concentrations were assessed using the Bradford assay. An equal amount of protein (20 µg) was loaded onto 10% SDS-PAGE gels. Proteins were resolved through SDS-PAGE and transferred to polyvinylidene difluoride (PVDF) membranes (Bio-Rad). Nonspecific sites were blocked with 5% nonfat milk at room temperature for 2 h. The blots were incubated with antibodies against Bcl-2 (dilution 1:500, cat. no. ab182858; Abcam), caspase-3 (dilution 1:500, cat. no. ab184787), TGF-β receptor (R)II (dilution 1:500, cat. no. ab113670, Abcam), p-Smad2/3 [dilution 1:500, cat. no. 8828S, Cell Signaling Technology, Inc. (CST)], CCN3 (dilution 1:500; cat. no. ab191425; Abcam) and β-actin (dilution 1:1,000; cat. no. ab8226; Abcam) at room temperature for 1.5 h or 4°C overnight. After washing with TBST three times, the blots were incubated with the secondary goat anti-rat IgG antibody (dilution 1:1,000; cat. no. AP156P; Sigma-Aldrich; Merck KGaA) at room temperature for 1.5 h, and visualized using an enhanced chemiluminescence (ECL) kit (cat. no. 34580; Thermo Fisher Scientific, Inc.) in the ImageQuant Tanon-4200 system (Tanon Science and Technology Co., Ltd., Shanghai, China). The rat anti-β-actin Ab was used as an internal control for western blotting. The densities of the detected bands were quantified in triplicate using Labworks Analysis Software (UVP, LLC, USA).

Immunofluorescence staining

Cells were grown on 12-mm glass coverslips. After transfection with CCN3-siRNA or NC-siRNA, the cells were fixed in 4% paraformaldehyde at room temperature for 15 min, permeabilized in PBS with 0.5% Triton X-100 for 15 min, and blocked with 6% goat serum for 30 min. Next, the cells were incubated with the primary NF-κB p65 antibody (dilution 1:100, cat. no. ab32536, Abcam) solution at 4°C overnight. After washing, the cells were incubated with the secondary antibody, goat anti-rabbit IgG (Cy3; dilution 1:800, cat. no. ab6939, Abcam) at room temperature for 30 min, and DAPI was added for nuclear staining for 5 min. Finally, the cells were visualized using a confocal laser scanning microscope (Leica, Germany). The data are presented as relative fluorescence intensity.

Statistical analysis

Statistical analysis was performed with Statistical Product and Service Solutions (SPSS) v24.0 (SPSS, Inc.) and Prism 6 (GraphPad Software). Data are presented as means ± SEM. Statistical significance was assessed with Student's t-test or one-way ANOVA with Bonferroni significant analysis. Results were considered statistically significant when P<0.05.

Results

Effect of LPS on the expression level of CCN3 in human lung alveolar epithelial cells

To assess the effects of LPS on CCN3 expression, we analyzed mRNA expression by qPCR and protein expression by western blot analysis. The results revealed that the levels of CCN3 mRNA and CCN3 protein were significantly upregulated following treatment with 0.1 µg/ml LPS for 12 h (Fig. 1A and B) (P<0.01). Our findings suggest that CCN3 is associated with LPS-induced lung injury.

Reduction of inflammatory cytokines by CCN3-siRNA

To assess the function of CCN3 in the regulation of inflammatory cytokines, we inhibited CCN3 expression by siRNA and measured the levels of TNF-α, IL-1β and TGF-β1 by ELISA. As shown in Fig. 2A and B, it was demonstrated that inhibition of CCN3 by siRNA significantly downregulated the levels of inflammatory cytokines, such as IL-1β (P<0.01) and TGF-β1 (P<0.05), compared with the vehicle control (NC). Similar effects were observed after LPS treatment. Surprisingly, there were no significant changes in the levels of TNF-α after CCN- siRNA treatment compared with both the NC group and following LPS treatment (Fig. 2C).

Anti-inflammatory activity of CCN3-siRNA through modulation of TGF-β/p-Smad signaling

Activation of TGF-β though interaction with receptor-regulated Smad (Smad2/3) signaling plays a pro-inflammatory role in the resolution of lung alveolar epithelial cell injury (18,31). We next sought to explore whether the CCN3-induced pro-inflammatory effects are mediated through the TGF-β/p-Smad signaling pathway. To investigate this, A549 cells were transfected with CCN3-siRNA for 36 h and then stimulated with or without LPS for 12 h. The mRNA level of TGF-β1, and the protein levels of TGF-β RII and p-Smad2/3 were detected by qPCR and western blot analysis, respectively. We found that knockdown of CCN3 by siRNA largely downregulated the protein levels of TGF-β RII and p-Smad2/3 (Fig. 3B-D). However, the mRNA level of TGF-β1 was slightly decreased, without statistical significance (P=0.055) (Fig. 3A). In addition, we confirmed that pretreatment of the cells with TP0427736 (an ALK5 inhibitor), which inhibits the TGF-β/p-Smad signaling pathway, greatly prevented the overexpression of CCN3 induced by LPS treatment, while knockdown of CCN3 by siRNA effectively attenuated the LPS-induced p-Smad2/3 expression (Fig. 3E and F). To conclude, the anti-inflammatory activity of CCN3-siRNA in LPS-induced lung injury is modulated by TGF-β/p-Smad signaling.

Suppression of CCN3 inhibits apoptosis in A549 cells through the Bcl-2/caspase-3 pathway

Lung epithelial cell apoptosis is increased after LPS treatment (24). Bcl-2 is an important anti-apoptotic factor, and decreased expression of Bcl-2 can lead to the activation of caspase-3 and apoptosis (32). To assess the effect of CCN3 on apoptosis, we performed flow cytometry using an apoptosis detection kit. Our observations indicated that the sum of the proportions of early apoptosis and late apoptosis was significantly decreased in the CCN3 knockdown group with or without LPS treatment, but increased after LPS treatment compared with the negative group (P<0.001; Fig. 4A). In addition, the western blot assays revealed that silencing of CCN3 expression upregulated Bcl-2 protein levels and downregulated the expression of caspase-3 protein, also after LPS treatment (Fig. 4B-D). Our data suggest that CCN3 is associated with the apoptosis of lung epithelial cells.

CCN3-siRNA knockdown reduces the activation of the NF-κB signaling pathway

A previous study demonstrated that LPS could cause the activation of NF-κB, which is involved in the process of apoptosis in ALI/ARDS (33). In order to establish whether the CCN3-induced pro-apoptotic effects are mediated through the NF-κB signaling pathway, we used confocal microscopy to analyze the localization of NF-κB p65 and western blot analysis of cytoplasmic and nuclear NF-κB p65 expression levels to establish whether nuclear translocation activation occurs. The results demonstrated that activation of NF-κB was largely reduced in the CCN3 knockdown group, whereas it was greatly stimulated after LPS exposure (Fig. 5A). As shown in Fig. 5B, pretreatment of the cells with PDTC, which inhibits the NF-κB signaling pathway, significantly attenuated the overexpression of CCN3 induced by LPS treatment. Meanwhile, the protein expression levels of NF-κB p65 in the nucleus following pretreatment with PDTC or CCN3 knockdown, were significantly decreased compared to those without pretreatment, namely the LPS-treated only group (P<0.001, Fig. 5C). Therefore, we suggest that CCN3 caused activation of NF-κB in A549 cells by the promotion of nuclear translocation of NF-κB p65.

Discussion

Acute lung injury (ALI)/acute respiratory distress syndrome (ARDS) is a highly refractory disease, and its complex pathology in lung epithelial cells is not fully understood. In the present study, we aimed to identify a potential signaling pathway to target in order to prevent or treat the disease. This study demonstrated that nephroblastoma overexpressed (NOV; also known as CCN3) is critical for LPS-induced lung alveolar epithelial cell injury and apoptosis. Firstly, we investigated the presence of CCN3 using an in vitro cell culture ALI model. We found that CCN3 mRNA and protein expression were significantly increased after LPS treatment. These observations confirmed that LPS treatment strongly induced the expression of CCN3 in lung alveolar epithelial cells. This was consistent with a previous study (16), revealing elevated CCN3/NOV levels as a potential indicator for lung injury severity.

However, the precise biological role, mechanism of action and physiological function of CCN3 proteins in ARDS has remained elusive until recently. Kular et al (7) indicated that CCN3 expression in vitro is finely regulated by diverse inflammatory mediators and cytokines, such as TNF-α, IL-1β and TGF-β. In this study, an in vitro siRNA approach showed that inhibition of CCN3 significantly attenuated the expression levels of pro-inflammatory cytokines (IL-1β and TGF-β1), which have been linked to the initiation and amplification of the inflammatory response in ALI/ARDS (2,34). Surprisingly, we found no significant changes in the expression level of TNF-α after transfection with CCN3-siRNA. This could be explained by the insensitivity of TNF-α production by the alveolar epithelial cells in our study. TNF-α was possibly not involved in this process. In addition, recent studies have revealed that CCNs and TNF-α are co-expressed at sites of inflammation (35). It is therefore tempting to speculate that CCNs may help to counterbalance the inflammatory effects of TNF-α. A previous study has shown that A549 cells release IL-1β and TNF-α after LPS stimulation though autocrine modes (36). This exerts a strong and synergic induction signal for IL-6 (37), since a high increase of IL-6 in ALI/ARDS accelerates the development of the local inflammatory microenvironment (38). Moreover, high levels of IL-1β, IL-6 and TNF-α have been considered as the most promising biomarkers for predicting morbidity and mortality in patients with ALI/ARDS (39). Taken together, we demonstrated that CCN3 plays an important pro-inflammatory role in lung epithelial cell injury by promoting the activities of specific cytokines, such as IL-1β and TGF-β1.

TGF-β1 is a secretory cytokine that binds to the Type II and Type I TGF β receptor (TGF-β RII and TGF-β RI, respectively), which initiates TGF-β signaling via Smad phosphorylation and nuclear translocation (40,41). Many studies have demonstrated that the TGF-β1 pathway plays a critical role in the development of ALI (18,4042). One study has demonstrated that early activation of TGF-β1/Smad2 signaling might contribute to acute pancreatitis-associated ALI, through regulation of lung permeability, epithelial ion transport, fibrinolysis and the extracellular matrix (31). In the present study, we observed a reduction in the levels of TGF-βR II and p-Smad2/3 following CCN3 silencing. Notably, overexpression of CCN3 in A549 cells might contribute to the activation of the TGF-β signaling pathway, leading to the destruction of epithelial integrity and aggregation of lung injury. Therefore, to further explore the direct roles of the TGF-β and p-Smad2/3 signaling pathways in the effect of CCN3, TP0427736, which inhibits the phosphorylation of Smad2/3 (43), was chosen to treat the A549 cells. We observed a significant decrease in CCN3 expression induced by LPS after TP0427736 treatment in the A549 cells, suggesting that CCN3 may promote the release of inflammatory mediators by the TGF-β/p-Smad2/3 signaling pathway in A549 cells. This reveals an alternative pathway that could aid in future studies of the pathogenesis of ALI.

Apoptosis of AEC II cells plays an essential role in the pathogenesis of ARDS (44). Our study showed that 0.1 µg/ml LPS could promote apoptosis in A549 cells. CCN3 knockdown greatly reduced the apoptotic rate of AEC II cells, while overexpression of CCN3 promoted AEC II apoptosis. LPS-triggered alveolar epithelial type II cell apoptosis is thought to primarily depend on the mitochondrial apoptosis signaling pathway (45). Bcl-2 regulates the mitochondrial apoptotic pathway by preventing the release of cytochrome c from mitochondria to cytosol, and activating caspase-3 (46). Doghman et al (47) showed that CCN3 induced human adrenocortical cell apoptosis through the activation of caspase 3. Consistent with these results, the changes in Bcl-2 and caspase-3 levels highlighted that the inhibition of CCN3 expression prevented AEC II apoptosis at the cellular level. Therefore, the activation of CCN3 induced by LPS may be involved in promoting AEC II cell apoptosis through the Bcl-2/caspase-3 pathway.

Moreover, this study showed that CCN3 activated NF-κB in A549 cells by promoting nuclear translocation of NF-κB p65. As a central mediator of the human immune response, NF-κB is a critical transcription factor in the pathogenesis of ALI (48). It directly activates downstream signaling pathways by interacting with MyD88, promoting the degradation of IκBα and the phosphorylation of NF-κB (49), leading to epithelial cell apoptosis by the Fas/Fas ligand (Fas L) signaling pathway (5052). In addition, previous studies have demonstrated that the NF-κB pathway promoted lung inflammation and injury in response to local and systemic stresses in airway epithelial cells, by triggering the transcription of inflammatory cytokines and chemokines (TNF-α, IL-1β and IL-6) (5355). Because this study did not illuminate the relationship between IL-1β and NF-κB, it is not clear whether the same response to stimuli could be observed in A549 cells. Additionally, overexpression of CCN3 has been observed to have anti-inflammatory effects on endothelial cells by inhibiting the activation of NF-κB (9), which is in contrast with our results. These differences may be due to differences in the cell types analyzed. Our results demonstrated that pretreatment with PDTC (a specific NF-κB inhibitor) significantly suppressed LPS-induced CCN3 and nuclear NF-κB p65 expression, indicating that CCN3 plays a role in human lung alveolar epithelial cells through the NF-κB signaling pathway. It has been shown that excessive epithelial cell apoptosis could lead to the damage of the pulmonary alveolar-capillary barrier and aggravate the inflammatory responses in lung diseases (52,56), suggesting a close association between inflammation and apoptosis. In summary, our study revealed that CCN3 may have potential clinical value in the occurrence and development of ALI via the TGF-β/p-Smad or NF-κB signaling pathways. Further research is needed to validate our findings using in vivo models, yet our data suggest a novel potential target for future clinical studies.

In conclusion, the present study demonstrated that CCN3 expression in alveolar epithelial cells was significantly increased under inflammatory conditions and/or in response to stimuli such as LPS. The overexpression of CCN3 can be perturbed by a TGF-β/p-Smad or NF-κB inhibitor, which explains how CCN3-siRNA led to the inhibition of the release of inflammatory cytokines and apoptosis in human alveolar epithelial cells.

Acknowledgements

Not applicable.

Funding

This research study was supported by the Wenzhou Municipal Science and Technology Plan Project (grant no. 2017Y0877), National Key R&D Program of China (grant nos. 2017YFC0908700 and 2017YFC0908703), Key R&D Program of Shandong Province (grant no. 2016ZDJS07A14), Natural Science Foundation of Zhejiang Province (grant no. LY18H010006) and National Nature Science Foundation of China (grant no. 81600062).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

HPZ, CSC and YGC conceived and designed the experiments, analyzed the data and wrote the manuscript. HYH, DMW, CLC, LD and ND carried out the experiments, prepared and analyzed the figures and tables. LD, CSC, CLC and YGC obtained the study materials and reagents in preparation for the experiments. All authors reviewed drafts of the paper. All authors read and approved the manuscript and agree to be accountable for all aspects of the research in ensuring that the accuracy or integrity of any part of the work are appropriately investigated and resolved.

Ethics approval and consent to participate

The protocol of the present study was approved by the Use Committee of Wenzhou Medical University (Wenzhou, China).

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Matthay MA, Ware LB and Zimmerman GA: The acute respiratory distress syndrome. J Clin Invest. 122:2731–2740. 2012. View Article : Google Scholar : PubMed/NCBI

2 

Ware LB and Matthay MA: The acute respiratory distress syndrome. N Engl J Med. 342:1334–1349. 2000. View Article : Google Scholar : PubMed/NCBI

3 

Rooney SA: Regulation of surfactant secretion. Comp Biochem Physiol A Mol Integr Physiol. 129:233–243. 2001. View Article : Google Scholar : PubMed/NCBI

4 

Galani V, Tatsaki E, Bai M, Kitsoulis P, Lekka M, Nakos G and Kanavaros P: The role of apoptosis in the pathophysiology of Acute Respiratory Distress Syndrome (ARDS): An up-to-date cell-specific review. Pathol Res Pract. 206:145–150. 2010. View Article : Google Scholar : PubMed/NCBI

5 

Imazu Y, Yanagi S, Miyoshi K, Tsubouchi H, Yamashita SI, Matsumoto N, Ashitani JI, Kangawa K and Nakazato M: Ghrelin ameliorates bleomycin-induced acute lung injury by protecting alveolar epithelial cells and suppressing lung inflammation. Eur J Pharmacol. 672:153–158. 2011. View Article : Google Scholar : PubMed/NCBI

6 

Kutsukake M, Matsutani T, Tamura K, Matsuda A, Kobayashi M, Tachikawa E and Uchida E: Pioglitazone attenuates lung injury by modulating adipose inflammation. J Surg Res. 189:295–303. 2014. View Article : Google Scholar : PubMed/NCBI

7 

Kular L, Pakradouni J, Kitabgi P, Laurent M and Martinerie C: The CCN family: A new class of inflammation modulators. Biochimie. 93:377–388. 2011. View Article : Google Scholar : PubMed/NCBI

8 

Perbal B: NOV (nephroblastoma overexpressed) and the CCN family of genes: Structural and functional issues. Mol Pathol. 54:57–79. 2001. View Article : Google Scholar : PubMed/NCBI

9 

Lin Z, Natesan V, Shi H, Hamik A, Kawanami D, Hao C, Mahabaleshwar GH, Wang W, Jin ZG, Atkins GB, et al: A novel role of CCN3 in regulating endothelial inflammation. J Cell Commun Signal. 4:141–153. 2010. View Article : Google Scholar : PubMed/NCBI

10 

Wu W, Hu X, Zhou X, Klenotic PA, Zhou Q and Lin Z: Myeloid deficiency of CCN3 exacerbates liver injury in a mouse model of nonalcoholic fatty liver disease. J Cell Commun Signal. 12:389–399. 2018. View Article : Google Scholar : PubMed/NCBI

11 

Chen PP, Li WJ, Wang Y, Zhao S, Li DY, Feng LY, Shi XL, Koeffler HP, Tong XJ and Xie D: Expression of Cyr61, CTGF, and WISP-1 correlates with clinical features of lung cancer. PLoS One. 2:e5342007. View Article : Google Scholar : PubMed/NCBI

12 

Dolinay T, Kaminski N, Felgendreher M, Kim HP, Reynolds P, Watkins SC, Karp D, Uhlig S and Choi AM: Gene expression profiling of target genes in ventilator-induced lung injury. Physiol Genomics. 26:68–75. 2006. View Article : Google Scholar : PubMed/NCBI

13 

Llinàs L, Peinado VI, Ramon Goñi J, Rabinovich R, Pizarro S, Rodriguez-Roisin R, Barberà JA and Bastos R: Similar gene expression profiles in smokers and patients with moderate COPD. Pulm Pharmacol Ther. 24:32–41. 2011. View Article : Google Scholar : PubMed/NCBI

14 

Moon HG, Kim SH, Gao J, Quan T, Qin Z, Osorio JC, Rosas IO, Wu M, Tesfaigzi Y and Jin Y: CCN1 secretion and cleavage regulate the lung epithelial cell functions after cigarette smoke. Am J Physiol Lung Cell Mol Physiol. 307:L326–L337. 2014. View Article : Google Scholar : PubMed/NCBI

15 

Shahzeidi S, Mulier BD, de Crombrugghe B, Jeffery PK, McAnulty RJ and Laurent GJ: Enhanced type III collagen gene expression during bleomycin induced lung fibrosis. Thorax. 48:622–628. 1993. View Article : Google Scholar : PubMed/NCBI

16 

Chen C, Shi L, Li Y, Wang X and Yang S: Disease-specific dynamic biomarkers selected by integrating inflammatory mediators with clinical informatics in ARDS patients with severe pneumonia. Cell Biol Toxicol. 32:169–184. 2016. View Article : Google Scholar : PubMed/NCBI

17 

Cui X, Zeni F, Vodovitz Y, Correa-de-Araujo R, Quezado M, Roberts A, Wahl S, Danner RL, Banks SM, Gerstenberger E, et al: TGF-beta1 increases microbial clearance but worsens lung injury during Escherichia coli pneumonia in rats. Cytokine. 24:115–127. 2003. View Article : Google Scholar : PubMed/NCBI

18 

Dhainaut JF, Charpentier J and Chiche JD: Transforming growth factor-beta: A mediator of cell regulation in acute respiratory distress syndrome. Crit Care Med. 31 (Suppl 4):S258–S264. 2003. View Article : Google Scholar : PubMed/NCBI

19 

Fahy RJ, Lichtenberger F, McKeegan CB, Nuovo GJ, Marsh CB and Wewers MD: The acute respiratory distress syndrome: A role for transforming growth factor-beta 1. Am J Respir Cell Mol Biol. 28:499–503. 2003. View Article : Google Scholar : PubMed/NCBI

20 

Lin J, Tian J, Wang L, Wu W, Li H, Wang X, Zeng X and Zhang W: Apoptosis and surfactant protein-C expression inhibition induced by lipopolysaccharide in AEC II cell may associate with NF-κB pathway. J Toxicol Sci. 42:53–61. 2017. View Article : Google Scholar : PubMed/NCBI

21 

Yang KY, Arcaroli JJ and Abraham E: Early alterations in neutrophil activation are associated with outcome in acute lung injury. Am J Respir Crit Care Med. 167:1567–1574. 2003. View Article : Google Scholar : PubMed/NCBI

22 

Boots AW, Gerloff K, Bartholomé R, van Berlo D, Ledermann K, Haenen GR, Bast A, van Schooten FJ, Albrecht C and Schins RP: Neutrophils augment LPS-mediated pro-inflammatory signaling in human lung epithelial cells. Biochim Biophys Acta. 1823:1151–1162. 2012. View Article : Google Scholar : PubMed/NCBI

23 

Cabrera-Benítez NE, Pérez-Roth E, Ramos-Nuez Á, Sologuren I, Padrón JM, Slutsky AS and Villar J: Inhibition of endotoxin-induced airway epithelial cell injury by a novel family of pyrrol derivates. Lab Invest. 96:632–640. 2016. View Article : Google Scholar : PubMed/NCBI

24 

Chuang CY, Chen TL, Cherng YG, Tai YT, Chen TG and Chen RM: Lipopolysaccharide induces apoptotic insults to human alveolar epithelial A549 cells through reactive oxygen species-mediated activation of an intrinsic mitochondrion-dependent pathway. Arch Toxicol. 85:209–218. 2011. View Article : Google Scholar : PubMed/NCBI

25 

MacRedmond R, Singhera GK and Dorscheid DR: Erythropoietin inhibits respiratory epithelial cell apoptosis in a model of acute lung injury. Eur Respir J. 33:1403–1414. 2009. View Article : Google Scholar : PubMed/NCBI

26 

Muroya M, Chang K, Uchida K, Bougaki M and Yamada Y: Analysis of cytotoxicity induced by proinflammatory cytokines in the human alveolar epithelial cell line A549. Biosci Trends. 6:70–80. 2012.PubMed/NCBI

27 

Rodríguez-González R, Ramos-Nuez Á, Martín-Barrasa JL, López-Aguilar J, Baluja A, Álvarez J, Rocco PR, Pelosi P and Villar J: Endotoxin-induced lung alveolar cell injury causes brain cell damage. Exp Biol Med (Maywood). 240:135–142. 2015. View Article : Google Scholar : PubMed/NCBI

28 

Shao L, Meng D, Yang F, Song H and Tang D: Irisin-mediated protective effect on LPS-induced acute lung injury via suppressing inflammation and apoptosis of alveolar epithelial cells. Biochem Biophys Res Commun. 487:194–200. 2017. View Article : Google Scholar : PubMed/NCBI

29 

Fong YC, Maa MC, Tsai FJ, Chen WC, Lin JG, Jeng LB, Yang RS, Fu WM and Tang CH: Osteoblast-derived TGF-beta1 stimulates IL-8 release through AP-1 and NF-kappaB in human cancer cells. J Bone Miner Res. 23:961–970. 2008. View Article : Google Scholar : PubMed/NCBI

30 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

31 

Akbarshahi H, Sam A, Chen C, Rosendahl AH and Andersson R: Early activation of pulmonary TGF-β1/Smad2 signaling in mice with acute pancreatitis-associated acute lung injury. Mediators Inflamm. 2014:1480292014. View Article : Google Scholar : PubMed/NCBI

32 

Scorrano L and Korsmeyer SJ: Mechanisms of cytochrome c release by proapoptotic BCL-2 family members. Biochem Biophys Res Commun. 304:437–444. 2003. View Article : Google Scholar : PubMed/NCBI

33 

Lin WC, Chen CW, Huang YW, Chao L, Chao J, Lin YS and Lin CF: Kallistatin protects against sepsis-related acute lung injury via inhibiting inflammation and apoptosis. Sci Rep. 5:124632015. View Article : Google Scholar : PubMed/NCBI

34 

Dolinay T, Kim YS, Howrylak J, Hunninghake GM, An CH, Fredenburgh L, Massaro AF, Rogers A, Gazourian L, Nakahira K, et al: Inflammasome-regulated cytokines are critical mediators of acute lung injury. Am J Respir Crit Care Med. 185:1225–1234. 2012. View Article : Google Scholar : PubMed/NCBI

35 

Chen CC and Lau LF: Deadly liaisons: Fatal attraction between CCN matricellular proteins and the tumor necrosis factor family of cytokines. J Cell Commun Signal. 4:63–69. 2010. View Article : Google Scholar : PubMed/NCBI

36 

Feng T, Yunfeng N, Jinbo Z, Zhipei Z, Huizhong Z, Li L, Tao J and Yunjie W: Single immunoglobulin IL-1 receptor-related protein attenuates the lipopolysaccharide-induced inflammatory response in A549 cells. Chem Biol Interact. 183:442–449. 2010. View Article : Google Scholar : PubMed/NCBI

37 

Aloisi F, Carè A, Borsellino G, Gallo P, Rosa S, Bassani A, Cabibbo A, Testa U, Levi G and Peschle C: Production of hemolymphopoietic cytokine s (IL-6, IL-8, colony-stimulating factors) by normal human astrocytes in response to IL-1 beta and tumor necrosis factor-alpha. J Immunol. 149:2358–2366. 1992.PubMed/NCBI

38 

Shi L, Dong N, Ji D, Huang X, Ying Z, Wang X and Chen C: Lipopolysaccharide-induced CCN1 production enhances interleukin-6 secretion in bronchial epithelial cells. Cell Biol Toxicol. 34:39–49. 2018. View Article : Google Scholar : PubMed/NCBI

39 

Butt Y, Kurdowska A and Allen TC: Acute lung injury: A clinical and molecular review. Arch Pathol Lab Med. 140:345–350. 2016. View Article : Google Scholar : PubMed/NCBI

40 

Hurst V VI, Goldberg PL, Minnear FL, Heimark RL and Vincent PA: Rearrangement of adherens junctions by transforming growth factor-beta1: Role of contraction. Am J Physiol. 276:L582–L595. 1999.PubMed/NCBI

41 

Sureshbabu A, Syed MA, Boddupalli CS, Dhodapkar MV, Homer RJ, Minoo P and Bhandari V: Conditional overexpression of TGFβ1 promotes pulmonary inflammation, apoptosis and mortality via TGFβR2 in the developing mouse lung. Respir Res. 16:42015. View Article : Google Scholar : PubMed/NCBI

42 

Pittet JF, Griffiths MJ, Geiser T, Kaminski N, Dalton SL, Huang X, Brown LA, Gotwals PJ, Koteliansky VE, Matthay MA and Sheppard D: TGF-beta is a critical mediator of acute lung injury. J Clin Invest. 107:1537–1544. 2001. View Article : Google Scholar : PubMed/NCBI

43 

Naruse T, Aoki M, Fujimoto N, Arase S, Oura H, Ueda Y and Ikeda A: Novel ALK5 inhibitor TP0427736 reduces TGF-β induced growth inhibition in human outer root sheath cells and elongates anagen phase in mouse hair follicles. Pharmacol Rep. 69:485–491. 2017. View Article : Google Scholar

44 

Bardales RH, Xie SS, Schaefer RF and Hsu SM: Apoptosis is a major pathway responsible for the resolution of type II pneumocytes in acute lung injury. Am J Pathol. 149:845–852. 1996.PubMed/NCBI

45 

Aggarwal S, Dimitropoulou C, Lu Q, Black SM and Sharma S: Glutathione supplementation attenuates lipopolysaccharide-induced mitochondrial dysfunction and apoptosis in a mouse model of acute lung injury. Front Physiol. 3:1612012. View Article : Google Scholar : PubMed/NCBI

46 

Borner C: The Bcl-2 protein family: Sensors and checkpoints for life-or-death decisions. Mol Immunol. 39:615–647. 2003. View Article : Google Scholar : PubMed/NCBI

47 

Doghman M, Arhatte M, Thibout H, Rodrigues G, De Moura J, Grosso S, West AN, Laurent M, Mas JC, Bongain A, et al: Nephroblastoma overexpressed/cysteine-rich protein 61/connective tissue growth factor/nephroblastoma overexpressed gene-3 (NOV/CCN3), a selective adrenocortical cell proapoptotic factor, is down-regulated in childhood adrenocortical tumors. J Clin Endocrinol Metab. 92:3253–3260. 2007. View Article : Google Scholar : PubMed/NCBI

48 

Pahl HL: Activators and target genes of Rel/NF-kappaB transcription factors. Oncogene. 18:6853–6866. 1999. View Article : Google Scholar : PubMed/NCBI

49 

Nighot M, Rawat M, Al-Sadi R, Castillo EF, Nighot P and Ma TY: Lipopolysaccharide-induced increase in intestinal permeability is mediated by TAK-1 activation of IKK and MLCK/MYLK gene. Am J Pathol. 189:797–812. 2019. View Article : Google Scholar : PubMed/NCBI

50 

Lopez AD, Avasarala S, Grewal S, Murali AK and London L: Differential role of the Fas/Fas ligand apoptotic pathway in inflammation and lung fibrosis associated with reovirus 1/L-induced bronchiolitis obliterans organizing pneumonia and acute respiratory distress syndrome. J Immunol. 183:8244–8257. 2009. View Article : Google Scholar : PubMed/NCBI

51 

Matsui K, Fine A, Zhu B, Marshak-Rothstein A and Ju ST: Identification of two NF-kappa B sites in mouse CD95 ligand (Fas ligand) promoter: Functional analysis in T cell hybridoma. J Immunol. 161:3469–3473. 1998.PubMed/NCBI

52 

White MK, Baireddy V and Strayer DS: Natural protection from apoptosis by surfactant protein A in type II pneumocytes. Exp Cell Res. 263:183–192. 2001. View Article : Google Scholar : PubMed/NCBI

53 

Cheng DS, Han W, Chen SM, Sherrill TP, Chont M, Park GY, Sheller JR, Polosukhin VV, Christman JW, Yull FE, et al: Airway epithelium controls lung inflammation and injury through the NF-kappa B pathway. J Immunol. 178:6504–6513. 2007. View Article : Google Scholar : PubMed/NCBI

54 

Gu LZ, Sun H and Chen JH: Histone deacetylases 3 deletion restrains PM2.5-induced mice lung injury by regulating NF-κB and TGF-β/Smad2/3 signaling pathways. Biomed Pharmacother. 85:756–762. 2017. View Article : Google Scholar : PubMed/NCBI

55 

Rosendahl A, Checchin D, Fehniger TE, ten Dijke P, Heldin CH and Sideras P: Activation of the TGF-beta/activin-Smad2 pathway during allergic airway inflammation. Am J Respir Cell Mol Biol. 25:60–68. 2001. View Article : Google Scholar : PubMed/NCBI

56 

Sharp C, Millar AB and Medford AR: Advances in understanding of the pathogenesis of acute respiratory distress syndrome. Respiration. 89:420–434. 2015. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

April-2020
Volume 21 Issue 4

Print ISSN: 1791-2997
Online ISSN:1791-3004

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Zhu HP, Huang HY, Wu DM, Dong N, Dong L, Chen CS, Chen CL and Chen YG: Regulatory mechanism of NOV/CCN3 in the inflammation and apoptosis of lung epithelial alveolar cells upon lipopolysaccharide stimulation. Mol Med Rep 21: 1872-1880, 2020
APA
Zhu, H., Huang, H., Wu, D., Dong, N., Dong, L., Chen, C. ... Chen, Y. (2020). Regulatory mechanism of NOV/CCN3 in the inflammation and apoptosis of lung epithelial alveolar cells upon lipopolysaccharide stimulation. Molecular Medicine Reports, 21, 1872-1880. https://doi.org/10.3892/mmr.2019.10655
MLA
Zhu, H., Huang, H., Wu, D., Dong, N., Dong, L., Chen, C., Chen, C., Chen, Y."Regulatory mechanism of NOV/CCN3 in the inflammation and apoptosis of lung epithelial alveolar cells upon lipopolysaccharide stimulation". Molecular Medicine Reports 21.4 (2020): 1872-1880.
Chicago
Zhu, H., Huang, H., Wu, D., Dong, N., Dong, L., Chen, C., Chen, C., Chen, Y."Regulatory mechanism of NOV/CCN3 in the inflammation and apoptosis of lung epithelial alveolar cells upon lipopolysaccharide stimulation". Molecular Medicine Reports 21, no. 4 (2020): 1872-1880. https://doi.org/10.3892/mmr.2019.10655