Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
March-2017 Volume 13 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
March-2017 Volume 13 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

The role of FADD in pancreatic cancer cell proliferation and drug resistance

  • Authors:
    • Rong Zhang
    • Yingting Liu
    • Kahina Hammache
    • Liangqiang He
    • Bo Zhu
    • Wei Cheng
    • Zi‑Chun Hua
  • View Affiliations / Copyright

    Affiliations: State Key Laboratory of Pharmaceutical Biotechnology, College of Life Sciences and School of Stomatology, Affiliated Stomatological Hospital, Nanjing University, Nanjing, Jiangsu 210093, P.R. China
  • Pages: 1899-1904
    |
    Published online on: January 25, 2017
       https://doi.org/10.3892/ol.2017.5636
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Pancreatic cancer has one of the poorest patient outcomes and is highly resistant to chemotherapy. Identifying the molecular mechanisms involved in drug resistance is critical in the development of novel strategies to treat pancreatic cancer. The results of the present study demonstrate that Fas‑associated death domain protein (FADD), a classical adaptor protein mediating apoptotic stimuli‑induced cell death, protects pancreatic cancer cells from drug‑induced apoptosis. In contrast to its classical apoptotic roles, it was observed that FADD is required for pancreatic cancer cell proliferation and that it is overexpressed to varying degrees in various types of pancreatic cancer cell. This leads to differing levels of drug resistance in pancreatic cancer cells, where drug resistance is positively correlated with FADD expression. Notably, the results of the present study demonstrate that FADD protects pancreatic cancer cells from drug‑induced apoptosis, while RNA interference of FADD sensitizes drug‑resistant cells to Adriamycin®‑mediated apoptosis. The results of the present study reveal unexpected roles for FADD in pancreatic cancer cell proliferation and drug resistance.

Introduction

Fas-associated death domain protein (FADD) is a classical adaptor protein involved in the cytoplasmic transduction of extracellular apoptotic signals by mediating the association of Fas and caspase-8 (1,2). FADD deficiency largely leads to compromised death receptor-mediated apoptosis (3,4). However, previous studies have indicated that FADD is also required for embryonic development and lymphocyte differentiation, which is independent of apoptosis, suggesting that FADD interacts with non-apoptotic cooperators in vivo (5–7). Previously, the role of FADD in programmed necrosis has been revealed (8–10). Inhibition of programmed necrosis by inactivation of the receptor interacting protein 1 rescues FADD-deficient embryos from death (8).

As a pro-apoptotic protein, FADD functions as a tumor suppressor in certain types of cancer, including thymic lymphoblastic lymphoma and thyroid adenoma/adenocarcinoma (11). Downregulation of FADD has also been observed in the leukemic cells of acute myeloid leukemia patients (12). By contrast, FADD is overexpressed in certain types of cancer. FADD is located on chromosome 11q13, a region that is frequently amplified in several types of cancer, including lung, head and neck squamous cell carcinoma, laryngeal and pharyngeal carcinomas, and breast and ovarian carcinomas (13). FADD mRNA and protein levels are known to be increased in these forms of cancer (14–18). However, the role of FADD in these diseases remains to be fully elucidated.

Pancreatic cancer is one of the most lethal types of cancer worldwide and the early stages are difficult to diagnose, thus hindering prompt surgery, chemotherapy and radiotherapy (19). Additionally, pancreatic cancer is highly resistant to traditional chemotherapy and radiotherapy, which is primarily due to failure of inducing cell cycle arrest and apoptosis in pancreatic cancer cells (20). Cyclin-dependent kinase inhibitor 1 (p21) is a potent cell cycle inhibitor at G1 and S phase, and is usually suppressed in cancer cells (21). Therefore, identifying the mechanisms for p21 repression in pancreatic cancer cell in response to drugs may shed light on more efficient chemotherapy strategies.

Although the role of FADD in several types of cancer has been revealed, its role in pancreatic cancer remains to be elucidated. In the present study, it was demonstrated that FADD is overexpressed in pancreatic cancer cells. Furthermore, its expression level is correlated with pancreatic cancer cell drug resistance. FADD RNA interference resulted in increased cell cycle arrest and apoptosis in response to Adriamycin® treatment in drug-resistant cells. The present data indicates that FADD may have an important role in the development of drug resistance in pancreatic cancer cells.

Materials and methods

Cell culture

Pancreatic cancer cells (Colo357, Capan-1 and MIA-PaCa-2) were purchased from American Type Culture Collection (Manassas, VA, USA) and cultured in Dulbecco's modified Eagle's medium (DMEM) or RPMI-1640 (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) with 10% fetal bovine serum (FBS; Invitrogen; Thermo Fisher Scientific, Inc.). Normal epithelial cell line (HPDE6) was a gift from Dr. Zhangjun Cheng (Southeast University, Nanjing, China) and cultured in RPMI-1640 with 10% fetal bovine serum. All cells were maintained at 37°C with 5% CO2 and a humidity of 95%.

Cell viability assay

Colo357, Capan-1 and MIA-PaCa-2 cells (2,000 cells/well) were plated into each well of multiple 96-well plates and cultured for 24 h at 37°C in DMEM or RPMI-1640. Cells were then treated with 0, 0.25, 0.5, 1, 2 or 4 µM of Adriamycin (Sigma-Aldrich; Merck Millipore, Darmstadt, Germany). Cell viability was determined by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium (MTT) assay. Cells were incubated with MTT for 2 h at 37°C. Following removal of the media containing MTT solution, the remaining dark blue formazan crystals in each well were dissolved in dimethyl sulfoxide. The absorbance was determined with a microplate reader. Each experiment was performed in triplicate.

RNA interference

FADD small interfering (siRNA) and negative control siRNA (NC siRNA) were synthesized by GenePharma Co., Ltd. (Shanghai, China). The FADD siRNA sequences used were as follows: sense, 5′-CACAGAGAAGGAGAACGCA-3′; and antisense, 5′-UGCGUUCUCCUUCUCUGUG-3′ as described by Varfolomeev et al (22). The NC siRNA sequences used were as follows: sense, 5′-GGCAGCAACCGAGAAGAAA-3′ and antisense, 5′-UUUCUUCUCGGUUGCUGCC-3′, generated by siRNA Wizard v3.1 (InvivoGen, San Diego, CA, USA). The NC siRNA was a scrambled sequence of the FADD siRNA, which had no match in the human genome sequence. Colo-357 and Capan-1 cells (5×105) were plated in a 6-well plate and cultured overnight at 37°C in RPMI-1640. siRNA and Lipofectamine® 2000 Reagent (Invitrogen; Thermo Fisher Scientific, Inc.) were mixed and incubated with the cells in serum-free Gibco™ Opti-MEM (Thermo Fisher Scientific, Inc.) for 6 h at 37°C. Fresh RPMI-1640 with 10% FBS was then added into the cells. For the effect of FADD on the proliferation of Colo-357, the concentrations of FADD siRNA were 0, 10, 25, 50, 100 and 200 nM, and the concentrations of the total siRNA were made up to 200 nM with NC siRNA for those transfections with a FADD siRNA concentration <200 nM. For the effect of FADD on the drug resistance of Colo-357 and Capan-1, the concentration of FADD siRNA was 100 nM and cells were treated with Adriamycin following 48 h of siRNA transfection.

Western blotting

Briefly, cells were collected and washed with phosphate-buffered saline (PBS) and lysed in lysis buffer (20 mM Tris-HCl (pH 7.5), 150 mM NaCl, 1 mM Na2 EDTA, 1 mM EGTA, 1% Triton, 2.5 mM sodium pyrophosphate, 1 mM beta-glycerophosphate, 1 mM Na3VO4, 1 µg/ml leupeptin) for 30 min on ice, and subsequently centrifuged at 11,700 × g for 10 min at 4°C. The supernatants were collected. Western blotting was performed, as described by Cheng et al (23). Briefly, 50 µg of protein from each sample were separated by using SDS-PAGE on a 12% SDS gel and subsequently transferred onto PVDF membranes (Merck Millipore). The membranes were then blocked in 5% non-fat milk in Tris-buffered saline containing 0.1% Tween 20 for 1 h at room temperature and probed with primary antibodies at a dilution of 1:500 overnight at 4°C (anti-FADD; cat. no. sc-5559; anti-p21; cat. no. sc-6246; anti-GAPDH; cat no. sc-47724), then probed with corresponding horseradish peroxidase-conjugated secondary antibodies at a dilution of 1:5,000 (goat anti-mouse IgG-HRP; cat. no. sc-2302; goat anti-rabbit IgG-HRP; cat no. sc-2301) (all Santa Cruz Biotechnology, Inc., Dallas, TX, USA). Bands were visualized with 20X LumiGLO® Reagent and 20X Peroxide (cat. no. 7003; Cell Signaling Technology, Inc., Danvers, MA, USA).

Cell cycle analysis

Following siRNA transfection and Adriamycin treatment, Capan-1 cells were subjected to cell cycle analysis with propidum iodide using standard flow cytometry protocols. Briefly, cells were trypsinized, fixed with cold ethanol and stored overnight at 4°C. Cells were subsequently pelleted and rinsed in cold PBS containing RNase A and incubated for 30 min at 37°C. Propidium iodide was added and incubated for an additional 30 min at 37°C. Cells were analyzed using FACSCalibur™ (BD Biosciences, Franklin Lakes, NJ, USA) for the fluorescence signals collected in the FL-2 detector. A total of 100,000 events were collected. Cell cycle profiles were analyzed using FlowJo software (version 10.0.8; FlowJo, LLC, Ashland, OR, USA).

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

RNA was extracted with TRIzol® reagent (Thermo Fisher Scientific, Inc.) and cDNA was synthesized with PrimeScript™ RT Master Mix (Takara Bio, Inc., Otsu, Japan) according to the manufacturer's protocol. RT-qPCR was then performed using the StepOne/StepOnePlus™ Real-time PCR system and SYBR Green PCR Master Mix (Applied Biosystems; Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. Cycling conditions were: 10 min of denaturation at 95°C and 40 cycles at 95°C for 15 sec and at 60°C for 1 min. The relative FADD mRNA expression level was calculated using the 2−ΔΔCq method (24), where ΔCq was calculated as follows: Cq value of FADD-Cq value of GAPDH. PCR primers for RT-qPCR were as follows: FADD forward, ATTAATGCCTCTCCCGCACC and reverse, TCTCTGCTTCGCTCCGATTC; GAPDH forward, CACCATCTTCCAGGAGCGAG and reverse, GCAGGAGGCATTGCTGAT.

Statistical analysis

Data are expressed as the mean ± standard deviation, and paired Student's t-test analysis was performed. Comparisons within groups were conducted using a t-test with repeated measures. P<0.05 was considered to indicate a statistically significant difference. All statistical analyses were performed with Prism software version 6.0 (GraphPad Software Inc., La Jolla, CA, USA).

Results

FADD is overexpressed in pancreatic cancer cells

To determine the expression of FADD in pancreatic cancer cells, FADD mRNA levels were examined in the wild-type epithelial cell line (HPDE6) and cancerous pancreatic cells. FADD mRNA expression was elevated significantly in pancreatic cancer cells compared to in HPDE6 cell, with P-values of 0.0051, 0.0014 and 0.0001 in MIA-PaCa-2, Colo357 and Capan-1, respectively (Fig. 1A). To confirm the changes in the FADD mRNA level, the protein levels were subsequently determined using western blotting. FADD protein expression was also increased in pancreatic cancer cells (Fig. 1B). Increased levels of FADD in pancreatic cancer cells were in conflict to its classic apoptotic role, suggesting a non-apoptotic functions of FADD in these cells.

Figure 1.

FADD is overexpressed in pancreatic cancer cells. (A) Normalized mRNA levels of FADD among pancreatic cells (n=3). Values are presented as the mean ± standard deviation. (B) Western blot analysis of FADD and GAPDH protein levels in pancreatic cancer cells. FADD, Fas-associated death domain protein; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.

FADD is required for pancreatic cancer cell proliferation

As FADD is overexpressed in pancreatic cancer cells, its effect on pancreatic cancer cell proliferation was examined. Cell proliferation was inhibited significantly by FADD RNAi at 4 days subsequent to FADD siRNA transfection compared to NC siRNA transfection, indicated by P-values of 0.0087, 0.0061, 0.0051, and 0.0022 corresponding to the FADD siRNA concentrations of 10, 25, 50, 100 and 200 nM, respectively. A total of 7 days following transfection, FADD knockdown inhibited Colo357 proliferation by >50% with concentrations of FADD siRNA of 25 nM or higher, , with P-values of 0.00092, 0.00045, 0.00063 and 0.0003 corresponding to FADD siRNA concentrations of 10, 25, 50, 100 and 200 nM, respectively (Fig. 2).

Figure 2.

FADD regulates pancreatic cancer cell proliferation. Colo357 cells were transfected with FADD siRNA at the concentrations indicated. (A) The FADD protein levels corresponding to the siRNA concentrations were analyzed with western blotting. (B) Cell proliferation was determined at indicated time points (n=6). Values are presented as the mean ± standard deviation. FADD, Fas-associated death domain protein; siRNA, small interfering RNA; GAPDH, glyceraldehyde 3-phosphate aldehyde.

FADD is correlated with drug resistance in pancreatic cancer cells

It has been demonstrated that FADD is overexpressed in 3 pancreatic cancer cell lines to varying degrees (Fig. 1). It has previously been demonstrated that Capan-1 cells exhibit increased resistance to anti-cancer drugs compared with other cancer cell lines (25). As FADD is highly expressed in Capan-1, the effect of FADD on drug resistance was analyzed. The Adriamycin sensitivity of the cell lines was initially measured. Capan-1 exhibited increased resistance to Adriamycin compared with Colo357 and MIA-PaCa2 (Fig. 3A). Furthermore, FADD knockdown sensitized Colo357 to Adriamycin significantly, with P-values of 0.021 and 0.014 corresponding to Adriamycin concentrations of 2 and 4 µM, respectively (Fig. 3B). Additionally, FADD RNAi increased the sensitivity of Capan-1 cells to Adriamycin significantly, with P-values of 0.003, 0.0004, 0.0006 and 0.0001 corresponding to Adriamycin concentrations of 0.5, 1, 2 and 4 µM, respectively (Fig. 3C). The present data indicate a promoting role for FADD in the development of drug resistance in pancreatic cancer cells.

Figure 3.

FADD sensitizes pancreatic cancer cells to Adriamycin. (A) Pancreatic cancer cells were treated with Adriamycin at the concentrations indicated. Cell number was determined 48 h following treatment (n=6). (B) Colo357 cells were transfected with FADD siRNA or NC for 48 h. Cells were subsequently treated with Adriamycin at the concentrations indicated for 24 h (n=6). (C) Capan-1 cells were transfected with FADD siRNA or NC for 48 h. Cells were subsequently treated with Adriamycin at the concentrations indicated for 24 h (n=6). Values are presented as the mean ± standard deviation. FADD, Fas-associated death domain protein; siRNA, small interfering RNA; NC, negative control.

FADD protects pancreatic cancer cells from drug-induced apoptosis

Adriamycin-induced apoptosis in FADD knockdown cells was examined. While FADD RNAi alone had no effect on apoptosis, 2 µM Adriamycin treatment was able to induce a moderate level of apoptosis. FADD RNAi dramatically promoted Adriamycin-induced apoptosis (Annexin V+/PI-) (Fig. 4). The present data indicates that FADD is critical to the development of drug resistance in Capan-1 cells and protects them from apoptosis.

Figure 4.

FADD protects pancreatic cancer cells from ADR-induced apoptosis. Capan-1 cells were transfected with NC siRNA or FADD siRNA as indicated for 48 h. Cells were subsequently treated with ADR for 48 h and collected for Annexin V immunostaining. Apoptotic cells were denoted as Annexin V+/PI-. FADD, Fas-associated death domain protein; ADR, Adriamycin; NC, negative control; siRNA, small interfering RNA; PI, propidium iodide.

FADD regulates the cell cycle

It has been shown that Adriamycin induces cell cycle arrest, which subsequently leads to apoptosis (21). Cell cycle phase distribution in FADD knockdown Capan-1 cells was examined. Adriamycin treatment resulted in cell cycle arrest (Fig. 5A). FADD RNAi promoted increased cell cycle arrest in the S phase when combined with Adriamycin treatment. p21 levels were also significantly elevated in FADD knockdown Capan-1 cells following Adriamycin treatment (Fig. 5B). Thus the present data indicate that FADD partially inhibits Adriamycin induced cell cycle arrest.

Figure 5.

FADD regulates pancreatic cell cycle progression. (A) Capan-1 cells were transfected with NC siRNA or FADD siRNA for 48 h. Cells were subsequently treated with ADR for 48 h, prior to being fixed for cell cycle analysis. (B) P21 protein levels were determined in the samples from (A) by western blot analysis. FADD, Fas-associated death domain protein; NC, negative control; siRNA, small interfering RNA; ADR, Adriamycin; FL2-A, FL2-area; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.

Discussion

FADD was initially identified as an adaptor protein that couples Fas receptor and procaspase-8 to form a death-inducing signaling complex. Procaspase-8 is subsequently cleaved leading to its activation and the initiation of apoptosis (2). It is therefore reasonable to hypothesize that FADD has a repressive role in cancer cell proliferation and survival. This concept was supported by the fact that FADD is deficient in certain types of cancer (11,12). However, multiple studies have revealed that FADD is overexpressed in many other forms of cancer (14–17). Consistent with previous observations, the present study indicated that FADD is overexpressed in pancreatic cancer cells. Knockdown of FADD impairs pancreatic cancer cell proliferation, suggesting that FADD is required for cell proliferation in the context of cancer. It has been shown that FADD translocates into the nucleus during mitosis to promote cell cycle progression, implying that FADD has apoptotic and non-apoptotic roles depending upon its cellular localization (26,27). Its nuclear localization promotes cell cycle progression and simultaneously deprives proliferative cells of apoptotic stimuli (18). This model proposes a mechanism for the FADD-mediated coupling of cancer cell proliferation and resistance to apoptosis, however further research is required (18).

In addition to facilitating proliferation, the present study also demonstrated that FADD induces drug resistance in pancreatic cancer cells, indicating that FADD is required for cancer cell survival in response to certain apoptotic stimuli. Although FADD is required for death receptor-mediated apoptosis, it is not required in Adriamycin-induced fibroblast apoptosis (5). As demonstrated by the present study, FADD deficiency results in apoptosis in response to Adriamycin in pancreatic cancer cells. This discrepancy largely depends on cellular context. Accelerated cell cycle machinery in cancer cells may be more sensitive to stimuli that cause cell cycle arrest. However, the complete mechanisms remain to be fully elucidated.

In conclusion, the present data demonstrated critical roles for FADD in pancreatic cancer cell proliferation and the development of resistance to Adriamycin. The results indicate more complex regulatory mechanisms for pancreatic cancer cell proliferation and survival. The data also reveal new strategies in the development of more efficient pancreatic cancer treatments.

Acknowledgements

The authors are grateful for grants from the National Key Basic Research Program of the Ministry of Science and Technology (grant nos. 2012CB967004, 2014CB744501 and 2011CB933502), the Chinese National Nature Sciences Foundation (grant nos. 81121062, 30425009, 30330530 and 30270291), the Jiangsu Provincial Nature Science Foundation (grant nos. BE2013630, BZ2012050 and BK2011573) and the Bureau of Science and Technology of Changzhou (grant nos. CM20122003, CZ20120004, CZ20130011 and CE20135013s).

References

1 

Zhang J and Winoto A: A mouse Fas-associated protein with homology to the human Mort1/FADD protein is essential for Fas-induced apoptosis. Mol Cell Biol. 16:2756–2763. 1996. View Article : Google Scholar : PubMed/NCBI

2 

Chinnaiyan AM, O'Rourke K, Tewari M and Dixit VM: FADD, a novel death domain-containing protein, interacts with the death domain of Fas and initiates apoptosis. Cell. 81:505–512. 1995. View Article : Google Scholar : PubMed/NCBI

3 

Kuang AA, Diehl GE, Zhang J and Winoto A: FADD is required for DR4- and DR5-mediated apoptosis: Lack of trail-induced apoptosis in FADD-deficient mouse embryonic fibroblasts. J Biol Chem. 275:25065–25068. 2000. View Article : Google Scholar : PubMed/NCBI

4 

Chinnaiyan AM, Tepper CG, Seldin MF, O'Rourke K, Kischkel FC, Hellbardt S, Krammer PH, Peter ME and Dixit VM: FADD/MORT1 is a common mediator of CD95 (Fas/APO-1) and tumor necrosis factor receptor-induced apoptosis. J Biol Chem. 271:4961–4965. 1996. View Article : Google Scholar : PubMed/NCBI

5 

Yeh WC, de la Pompa JL, McCurrach ME, Shu HB, Elia AJ, Shahinian A, Ng M, Wakeham A, Khoo W, Mitchell K, et al: FADD: Essential for embryo development and signaling from some, but not all, inducers of apoptosis. Science. 279:1954–1958. 1998. View Article : Google Scholar : PubMed/NCBI

6 

Kabra NH, Kang C, Hsing LC, Zhang J and Winoto A: T cell-specific FADD-deficient mice: FADD is required for early T cell development. Proc Natl Acad Sci USA. 98:6307–6312. 2001. View Article : Google Scholar : PubMed/NCBI

7 

Zhang J, Cado D, Chen A, Kabra NH and Winoto A: Fas-mediated apoptosis and activation-induced T-cell proliferation are defective in mice lacking FADD/Mort1. Nature. 392:296–300. 1998. View Article : Google Scholar : PubMed/NCBI

8 

Zhang H, Zhou X, McQuade T, Li J, Chan FK and Zhang J: Functional complementation between FADD and RIP1 in embryos and lymphocytes. Nature. 471:373–376. 2011. View Article : Google Scholar : PubMed/NCBI

9 

Osborn SL, Diehl G, Han SJ, Xue L, Kurd N, Hsieh K, Cado D, Robey EA and Winoto A: Fas-associated death domain (FADD) is a negative regulator of T-cell receptor-mediated necroptosis. Proc Natl Acad Sci USA. 107:13034–13039. 2010. View Article : Google Scholar : PubMed/NCBI

10 

Welz PS, Wullaert A, Vlantis K, Kondylis V, Fernández-Majada V, Ermolaeva M, Kirsch P, Sterner-Kock A, van Loo G and Pasparakis M: FADD prevents RIP3-mediated epithelial cell necrosis and chronic intestinal inflammation. Nature. 477:330–334. 2011. View Article : Google Scholar : PubMed/NCBI

11 

Newton K, Harris AW and Strasser A: FADD/MORT1 regulates the pre-TCR checkpoint and can function as a tumour suppressor. EMBO J. 19:931–941. 2000. View Article : Google Scholar : PubMed/NCBI

12 

Tourneur L, Delluc S, Lévy V, Valensi F, Radford-Weiss I, Legrand O, Vargaftig J, Boix C, Macintyre EA, Varet B, et al: Absence or low expression of fas-associated protein with death domain in acute myeloid leukemia cells predicts resistance to chemotherapy and poor outcome. Cancer Res. 64:8101–8108. 2004. View Article : Google Scholar : PubMed/NCBI

13 

Fantl V, Smith R, Brookes S, Dickson C and Peters G: Chromosome 11q13 abnormalities in human breast cancer. Cancer Surv. 18:77–94. 1993.PubMed/NCBI

14 

Gibcus JH, Menkema L, Mastik MF, Hermsen MA, de Bock GH, van Velthuysen ML, Takes RP, Kok K, Marcos CA Alvarez, van der Laan BF, et al: Amplicon mapping and expression profiling identify the Fas-associated death domain gene as a new driver in the 11q13.3 amplicon in laryngeal/pharyngeal cancer. Clin Cancer Res. 13:6257–6266. 2007. View Article : Google Scholar : PubMed/NCBI

15 

Prapinjumrune C, Morita K, Kuribayashi Y, Hanabata Y, Shi Q, Nakajima Y, Inazawa J and Omura K: DNA amplification and expression of FADD in oral squamous cell carcinoma. J Oral Pathol Med. 39:525–532. 2010.PubMed/NCBI

16 

Rasamny JJ, Allak A, Krook KA, Jo VY, Policarpio-Nicolas ML, Sumner HM, Moskaluk CA, Frierson HF Jr and Jameson MJ: Cyclin D1 and FADD as biomarkers in head and neck squamous cell carcinoma. Otolaryngol Head Neck Surg. 146:923–931. 2012. View Article : Google Scholar : PubMed/NCBI

17 

Kwek SS, Roy R, Zhou H, Climent J, Martinez-Climent JA, Fridlyand J and Albertson DG: Co-amplified genes at 8p12 and 11q13 in breast tumors cooperate with two major pathways in oncogenesis. Oncogene. 28:1892–1903. 2009. View Article : Google Scholar : PubMed/NCBI

18 

Chen G, Bhojani MS, Heaford AC, Chang DC, Laxman B, Thomas DG, Griffin LB, Yu J, Coppola JM, Giordano TJ, et al: Phosphorylated FADD induces NF-kappaB, perturbs cell cycle, and is associated with poor outcome in lung adenocarcinomas. Proc Natl Acad Sci USA. 102:12507–12512. 2005. View Article : Google Scholar : PubMed/NCBI

19 

Siegel R, Naishadham D and Jemal A: Cancer statistics, 2012. CA Cancer J Clin. 62:10–29. 2012. View Article : Google Scholar : PubMed/NCBI

20 

Andrán-Sandberg A: Pancreatic cancer: Chemotherapy and radiotherapy. N Am J Med Sci. 3:1–12. 2011. View Article : Google Scholar : PubMed/NCBI

21 

King KL and Cidlowski JA: Cell cycle regulation and apoptosis. Annu Rev Physiol. 60:601–617. 1998. View Article : Google Scholar : PubMed/NCBI

22 

Varfolomeev E, Maecker H, Sharp D, Lawrence D, Renz M, Vucic D and Ashkenazi A: Molecular determinants of kinase pathway activation by Apo2 ligand/tumor necrosis factor-related apoptosis-inducing ligand. J Biol Chem. 280:40599–40608. 2005. View Article : Google Scholar : PubMed/NCBI

23 

Cheng W, Wang L, Zhang R, Du P, Yang B, Zhuang H, Tang B, Yao C, Yu M, Wang Y, et al: Regulation of protein kinase C inactivation by Fas-associated protein with death domain. J Biol Chem. 287:26126–26135. 2012. View Article : Google Scholar : PubMed/NCBI

24 

Schmittgen TD and Livak KJ: Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc. 3:1101–1108. 2008. View Article : Google Scholar : PubMed/NCBI

25 

Arlt A, Vorndamm J, Breitenbroich M, Fölsch UR, Kalthoff H, Schmidt WE and Schäfer H: Inhibition of NF-kappaB sensitizes human pancreatic carcinoma cells to apoptosis induced by etoposide (VP16) or doxorubicin. Oncogene. 20:859–868. 2001. View Article : Google Scholar : PubMed/NCBI

26 

Alappat EC, Feig C, Boyerinas B, Volkland J, Samuels M, Murmann AE, Thorburn A, Kidd VJ, Slaughter CA, Osborn SL, et al: Phosphorylation of FADD at serine 194 by CKIalpha regulates its nonapoptotic activities. Mol Cell. 19:321–332. 2005. View Article : Google Scholar : PubMed/NCBI

27 

Cheng W, Wang L, Yang B, Zhang R, Yao C, He L, Liu Z, Du P, Hammache K, Wen J, et al: Self-renewal and differentiation of muscle satellite cells are regulated by the Fas-associated death domain. J Biol Chem. 289:5040–5050. 2014. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Zhang R, Liu Y, Hammache K, He L, Zhu B, Cheng W and Hua ZC: The role of FADD in pancreatic cancer cell proliferation and drug resistance. Oncol Lett 13: 1899-1904, 2017.
APA
Zhang, R., Liu, Y., Hammache, K., He, L., Zhu, B., Cheng, W., & Hua, Z. (2017). The role of FADD in pancreatic cancer cell proliferation and drug resistance. Oncology Letters, 13, 1899-1904. https://doi.org/10.3892/ol.2017.5636
MLA
Zhang, R., Liu, Y., Hammache, K., He, L., Zhu, B., Cheng, W., Hua, Z."The role of FADD in pancreatic cancer cell proliferation and drug resistance". Oncology Letters 13.3 (2017): 1899-1904.
Chicago
Zhang, R., Liu, Y., Hammache, K., He, L., Zhu, B., Cheng, W., Hua, Z."The role of FADD in pancreatic cancer cell proliferation and drug resistance". Oncology Letters 13, no. 3 (2017): 1899-1904. https://doi.org/10.3892/ol.2017.5636
Copy and paste a formatted citation
x
Spandidos Publications style
Zhang R, Liu Y, Hammache K, He L, Zhu B, Cheng W and Hua ZC: The role of FADD in pancreatic cancer cell proliferation and drug resistance. Oncol Lett 13: 1899-1904, 2017.
APA
Zhang, R., Liu, Y., Hammache, K., He, L., Zhu, B., Cheng, W., & Hua, Z. (2017). The role of FADD in pancreatic cancer cell proliferation and drug resistance. Oncology Letters, 13, 1899-1904. https://doi.org/10.3892/ol.2017.5636
MLA
Zhang, R., Liu, Y., Hammache, K., He, L., Zhu, B., Cheng, W., Hua, Z."The role of FADD in pancreatic cancer cell proliferation and drug resistance". Oncology Letters 13.3 (2017): 1899-1904.
Chicago
Zhang, R., Liu, Y., Hammache, K., He, L., Zhu, B., Cheng, W., Hua, Z."The role of FADD in pancreatic cancer cell proliferation and drug resistance". Oncology Letters 13, no. 3 (2017): 1899-1904. https://doi.org/10.3892/ol.2017.5636
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team