Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
May-2018 Volume 15 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
May-2018 Volume 15 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Prognostic significance of CD117 expression and TP53 missense mutations in triple-negative breast cancer

  • Authors:
    • Yanli Luo
    • Wentao Huang
    • Huizhen Zhang
    • Guang Liu
  • View Affiliations / Copyright

    Affiliations: Department of Pathology, Shanghai Jiao Tong University Affiliated Sixth People's Hospital, Shanghai 200233, P.R. China, Department of Vascular Surgery, Ninth People's Hospital, School of Medicine, Shanghai Jiao Tong University, Shanghai 200011, P.R. China
    Copyright: © Luo et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 6161-6170
    |
    Published online on: February 22, 2018
       https://doi.org/10.3892/ol.2018.8104
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:



Abstract

Triple-negative breast cancer (TNBC) is extremely aggressive and associated with poor prognosis. There are no known predictive or prognostic markers for TNBC. Inhibition of tumor protein P53 (TP53) has been demonstrated to increase the levels of cluster of differentiation 117 (CD117) in human colorectal cancer cells. However, the function of TP53 in the regulation of CD117 in TNBC has, to the best of our knowledge, not been reported. In the present study, the association between the expression of CD117 protein and TP53 mutations was investigated, and their prognostic value in patients with TNBC was assessed. A total of 58 TNBC and 48 non‑TNBC breast cancer tissue samples were assessed for the expression of CD117, p53 and TP53 mutations. The marker of proliferation Ki‑67 (MKI67) proliferation index and vascular invasion index (obtained by measuring D2‑40 and CD34) was investigated via immunohistochemistry, and mutations in exons 4-8 of TP53 were measured using direct sequencing. Associations between CD117 and p53 levels or TP53 mutations and clinical parameters were statistically evaluated. The rates of CD117 or MKI67 positivity, CD117+/TP53 missense mutation+, TP53 missense mutations or recurrence were significantly higher in patients with TNBC than in patients with non-TNBC. In TNBC tissues, the presence of CD117 was associated with TP53 missense mutations (P=0.031), vascular invasion, recurrence and MKI67. CD117+/TP53 missense mutation+ also associated with vascular invasion, recurrence and MKI67. Under univariate analysis, MKI67, vascular invasion, CD117, CD117+/TP53 missense mutation+ and TP53 missense mutations were associated with the overall survival of patients with TNBC. Multivariate analysis revealed that vascular invasion and CD117+/TP53 missense mutation+ in primary tumors were independent prognostic factors in patients with TNBC. In conclusion, CD117+/TP53 missense mutation+ was associated with MKI67, vascular invasion and tumor recurrence in TNBC. The presence of CD117 and TP53 missense mutations together in the primary tumors was an independent prognostic factor for survival of patients with TNBC.

Introduction

Triple-negative breast cancer (TNBC) is characterized by the absence of estrogen, progesterone and human epidermal growth factor receptor 2 (HER2) receptors. TNBC makes up between 15 and 20% of all types of breast cancer, are aggressive, and are associated with poorer survival rates compared with non-TNBC (1,2). Although patients with TNBC respond to chemotherapy, they are more likely to suffer early relapse than patients with other breast cancer subtypes (3). Therefore, there is a requirement to identify prognostic and predictive markers in TNBC.

Cluster of differentiation 117 (CD117; encoded by KIT) regulates cellular differentiation, proliferation, adhesion and apoptosis (4). CD117 is involved in the development of several malignant tumor types including gastrointestinal stromal cell tumors, small-cell lung, ovarian and breast cancer (4–7). Immunohistochemical staining has revealed that CD117 protein is overexpressed in primary malignant tumors, including operable esophageal squamous cell carcinoma and vulvar melanoma, and may be a valuable prognostic marker in esophageal squamous cell carcinoma (8). However, the results of studies concerning the prognostic significance of CD117 in patients with breast cancer or TNBC are conflicting: Kashiwagi et al have suggested that CD117 protein is associated with poor prognosis (9), whereas others identified no significant association between CD117 and prognosis in breast cancer or TNBC (10,11).

The tumor protein P53 (TP53) gene encodes the tumor suppressor protein p53, and is activated by various stresses including genotoxic damage, hypoxia and heat shock (12,13). TP53 mutations are most often located at exons 5–8, inhibiting the tumor suppressor activity of p53 (14). The association between TP53 mutations, p53 expression and the prognosis of patients with breast cancer or TNBC is inconsistent (15–17); a group of patients with TP53 missense mutations experienced the shortest survival and a reduction in relapse-free survival rates (15,16); however, there was no association between TP53 mutations and clinical outcome in another study (17).

A previous study revealed that mutations to TP53 upregulated CD117 expression in colon cancer cells and promoted the invasion of tumor cells (18). TP53 mutations have been demonstrated to inactivate the microRNA miR-34, and to promote CD117 expression in human colorectal cancer cells (18); however, there are no reports regarding the association between TP53 mutations and CD117 expression in TNBC.

In the present study, it was hypothesized that CD117 expression was associated with TP53 mutations in patients with TNBC. The expression levels of CD117 and p53 were measured and TP53 mutations were assessed in 58 TNBC tumor specimens and 48 control specimens, and their association with the clinicopathological characteristics of patients with TNBC was analyzed.

Materials and methods

Patients

The Ethics Committee for Human Studies at Shanghai Jiao Tong University (Shanghai, China) approved the present study, which was conducted in accordance with The Declaration of Helsinki. Participants were fully informed of the procedures, and written informed consent was obtained from each.

Between January 2008 and August 2012 at Shanghai Jiao Tong University Affiliated Sixth People's Hospital, 58 TNBC tissues and 48 non-TNBC samples were collected during surgery. All patients were women, with a mean age of 55.30±9.95 years (range, 32–80 years). Patients with non-TNBC had a mean age of 55.27±8.75 years (range, 43–77 years); patients with TNBC had a mean age of 55.33±10.92 (range, 32–80 years). Stages of breast cancer were determined using Nottingham staging, recommended by the American Joint Committee on Cancer (19). A total of 39 specimens (20 TNBC and 19 non-TNBC cases) were determined to be stage I, and 67 specimens (38 TNBC and 29 non-TNBC cases) as stage II–III. All patients received modified radical mastectomy without preoperative chemotherapy or radiotherapy. Following surgery, routine neoadjuvant chemotherapy was administered.

The end of follow-up was June 2014. The 5-year survival rate for the entire cohort of 106 patients was 49%. The recurrence rate was 35.8%. During the follow-up period, recurrence occurred in 38 cases (30 patients succumbed to metastasis, and 8 patients succumbed whilst receiving chemotherapy). The median follow-up period was 50.6 months. The overall survival time of patients was calculated from the date of surgery to the date of mortality or the date of last contact.

Immunohistochemistry

Immunohistochemistry was performed on 4-µm-thick sections from 10% formalin-fixed paraffin-embedded (FFPE) tissue specimens as previously described (20). Sections were deparaffinized with 100% xylene (25°C) and rehydrated through a graded ethanol series (100, 95 and 70% ethanol) and were subjected to microwave antigen retrieval by incubating sections at 98 to 100°C in 0.01 M citrate buffer (pH 6.0) for 15 min. Antibodies targeting D2-40 (cat. no. sc-59347; 1:100) were purchased from Santa Clara Biotechnology, Inc. (Dallas, TX, USA). Other antibodies were purchased from Dako (Agilent Technologies, Inc.), directed against the following: Estrogen receptor (ER; cat. no. IS657; 1:80), progesterone receptor (PR; cat. no. IS068; 1:50), human epidermal growth factor receptor 2 (HER2; cat. no. 20027850; 1:200), CD117 (cat. no. 10109679; 1:200), CD34 (cat. no. GA632; 1:50), marker of proliferation Ki-67 (MKI67; cat. no. IR626; 1:200), and p53 (cat. no. IS616; 1:100), which reacts with an epitope between amino acids 19–26 and recognizes wild-type and mutant p53 protein. The sections were incubated with the primary antibodies for 1 h at 25°C, followed by an incubation for 30 min at 37°C with a horseradish peroxidase-conjugated secondary antibody [Dako EnVision+ System-HRP (DAB); Dako, Agilent Technologies, Inc.]. The slides were assessed in an auto immunostainer Link 48 (Agilent Technologies, Inc.; Dako) according to the manufacturer's protocols. Slides were counterstained with Mayer's hematoxylin. H&E staining of other slides from the same samples was also performed in order to assess the presence/absence of vascular invasion of tumors. Slides were stained with hematoxylin (Harris Formula, Surgipath Medical Industries, Inc., Richmond, IL, USA) at 25°C for 1 min, rinsed in running distilled water (10 min), and then stained with an eosin solution (Surgipath Medical Industries, Inc.) for 1 min and washed with distilled water again, dehydrated with 100% ethanol (25°C) and mounted.

All the results of immunohistohchemistry were blindly accessed by 2 independent pathologists with long-standing experience in the Department of Pathology, Shanghai Jiao Tong University Affiliated Sixth People's Hospital. Nuclear staining >10% in tumor cells was considered to indicate p53- or MKI67-positivity. Nuclear staining in >1% of tumor cell nuclei was considered a positive indication of the presence of ER and PR. Immunostaining for HER2 and CD117 (11,21) was graded according to the percentage of cells: 0, none; 1+, <10% staining weak and incomplete; 2+, ≥10%, staining weak to moderate; and 3+, ≥10% strong staining. HER2 immunostaining was considered positive if graded 3+, or if gene amplification was confirmed by fluorescence in situ hybridization (FISH) in patients exhibiting 2+ immunostaining. Breast cancer samples with ≥10% positive cells and with scores ≥2 were considered to indicate CD117 positivity. Vascular invasion was identified by staining for CD34 (endothelial cell marker) or D2-40 (podoplanin, a membrane protein specific for lymphatic endothelium), in accordance with a previous study (22).

FISH

HER2 status was detected using FISH. A PathVysion dual-color fluorescence probes kit (HER2/CEP17) was purchased from Vysis, Inc. (Abbott Pharmaceutical Co. Ltd., Lake Bluff, IL, USA). The assay was performed according to the manufacturer's protocol. All samples were analyzed using an Olympus BX51 fluorescence microscope (Olympus Corporation, Tokyo, Japan, original magnification, ×1,000) equipped with a set of the appropriate filters (Vysis Inc.; Abbott Pharmaceutical Co. Ltd.). The hybridization results were evaluated by 2 independent pathologists in the Department of Pathology, Shanghai Jiao Tong University Affiliated Sixth People's Hospital, blinded to the clinical outcomes. Categories of FISH were classified as previously described (23).

TP53 mutation analysis

For each case, 10 5-µm-thick slices were collected in a 1.5 ml tube, these FFPE specimen tissue sections were first deparaffinized with 100% xylene at 25°C and 100% ethanol at 25°C. Subsequently, DNA was extracted from FFPE tissue specimens using a QIAamp DNA extraction kit (Qiagen GmbH, Hilden, Germany) according to the manufacturer's protocol. The samples were incubated in 20 µl proteinase K solution at 56°C for 1 h, and then incubated in FTB buffer at 90°C for 1 h, then wash buffers (500 µl AW1 and 500 µl AW2) washing for 1 min at 25°C. Finally, the DNA was eluted in DTE buffer (all Qiagen GmbH).

Mutations in the TP53 gene were identified via direct sequencing. Polymerase chain reaction (PCR) amplification and direct sequencing of the TP53 gene (exon 4–8) were performed in 106 breast cancer samples. The primers were designed to amplify exons 4–8 of TP53 (Table I). PCR was performed using a Mastercycler gradient PCR machine (Eppendorf, Hamburg, Germany) under the following amplification conditions: 94°C for 10 min; 40 cycles of 94°C for 45 sec, 61°C for 45 sec, and 72°C for 45 sec; with a final extension at 72°C for 7 min. The PCR products were purified using a QIAquick Gel Extraction kit (Qiagen GmbH) and were prepared for sequencing via a 3500Dx genetic analyzer (Applied Biosystems; Thermo Fisher Scientific, Inc., Waltham, MA, USA) with a BigDye Terminator Cycle Sequencing Ready Reaction kit (Applied Biosystems; Thermo Fisher Scientific, Inc.). The cycling conditions were: 94°C for 1 min; 24 cycles of 94°C for 10 sec, 50°C for 5 sec, and 60°C for 1 min; and final extension at 72°C for 5 min. The sequences were analyzed using Chromas Lite software version 2.01 (Technelysium Pty Ltd., South Brisbane, Australia).

Table I.

Polymerase chain reaction primers for the tumor protein P53 gene.

Table I.

Polymerase chain reaction primers for the tumor protein P53 gene.

ExonForward, 5′-3′Reverse, 5′-3′
4I GCTCTTTTCACCCATCTACAG GAAGGGACAGAAGATGACAG
4II CTGCACCAGCAGCTCCTA GAAGTCTCATGGAAGCCAG
5 TCACTTGTGCCCTGACTTTCA TCTCCAGCCCCAGCTGCT
6 TTCCTCACTGATTGCTCTTAG GACCCCAGTTGCAAACCAG
7 GCGCACTGGCCTCATCTTG CACAGCAGGCCAGTGTGCA
8 AGGACCTGATTTCCTTACTGC GAATCTGAGGCATAACTGCAC
Statistical analysis

The significance of association between TNBC and the various clinical factors or potential prognostic markers was determined using the χ2 test. Survival analysis was performed using a Kaplan-Meier plot analysis and a log-rank test. Hazard ratios with 95% confidence intervals were calculated using the Cox proportional hazards model, which was used to compute univariate and multivariate hazard ratios for the study parameters. P<0.05 was considered to indicate a statistically significant difference. Statistical analyses were performed using SPSS software (version 13.0; SPSS, Inc., Chicago, IL, USA).

Results

Clinical characteristics of TNBC patients

A total of 58 patients with TNBC and 48 patients with non-TNBC were included in the study. Positive stains of ER, PR, and MKI67 were primarily located in the nuclei (Fig. 1A-C). Immunohistochemistry revealed that HER2 protein was located at the cell membrane, and gene amplification of HER2 was detected using FISH analysis (Fig. 1D and E). Vascular invasion was assessed by hematoxylin and eosin staining (Fig. 1F) and by immunohistochemistry using anti-CD34 (recognizing endothelial cells) and anti-D2-40 (recognizing lymphatic endothelial cells) antibodies (Fig. 1G and H). Compared with patients with non-TNBC, those with TNBC had a higher rate of vascular invasion (P=0.043), lymph node metastasis (P=0.017) and tumor recurrence (P=0.012; Table II), and a higher proliferation index (MKI67; P=0.025; Table III).

Figure 1.

Immunohistochemical analysis of breast cancer tissues. Examples of positive immunohistochemical staining for the (A) estrogen receptor, (B) progesterone receptor, (C) MKI67, and (D) HER2 in tumor cells (original magnification, ×400). (E) Representative image of HER2 gene amplification in tumor tissue was observed using FISH in non-TNBC tumor cells (original magnification, ×1,000). (F) Tumor thrombus was observed in vessels (original magnification, ×200). (G) Blood vessel invasion was indicated by CD34 staining (original magnification, ×400). (H) Lymphatic invasion indicated by D2-40 staining (original magnification, ×400). Representative examples of (I) positive CD117 protein staining (J) nuclear localization of p53 and were observed in breast cancer (original magnification, ×400). HER2, human epidermal growth factor receptor 2; CD, cluster of differentiation; FISH, fluorescence in situ hybridization; TNBC, triple negative breast cancer; MKI67, marker of proliferation Ki-67.

Table II.

Summary of clinical and pathological features of 106 patients with breast cancer.

Table II.

Summary of clinical and pathological features of 106 patients with breast cancer.

VariableNon-TNBC, n (%)TNBC, n (%)Total, n (%)P-value
Subjects4858106
Age at operation, years 0.245
  ≤5021 (43.8)19 (32.8)40 (37.7)
  >5027 (56.3)39 (67.2)66 (62.3)
Tumor grade 0.588
  I19 (39.6)20 (34.5)39 (36.8)
  II/III29 (60.4)38 (65.5)67 (63.2)
Tumor, cm 0.302
  ≤228 (58.3)28 (48.3)56 (52.8)
  >220 (41.7)30 (51.7)50 (47.2)
Lymph node status 0.017
  Negative31 (64.6)24 (41.4)55 (51.9)
  Positive17 (35.4)34 (58.6)51 (48.1)
Vascular invasion 0.043
  No43 (89.6)43 (74.1)85 (80.2)
  Yes5 (10.4)15 (25.9)21 (19.8)
Nerve invasion 0.726
  No37 (77.1)43 (74.1)80 (75.5)
  Yes11 (22.9)15 (25.9)26 (24.5)
Recurrence 0.012
  No37 (77.1)31 (53.4)68 (64.2)
  Yes11 (22.9)27 (46.6)38 (35.8)

[i] TNCB, triple negative breast cancer.

Table III.

TP53 and CD117 expression in patients with breast cancer.

Table III.

TP53 and CD117 expression in patients with breast cancer.

VariableNon-TNBC, n (%)TNBC, n (%)P-value
CD117 0.045a
  Negative34 (70.8)30 (51.7)
  Positive14 (29.2)28 (48.3)
CD117/TP53MIS 0.009a
  Negative42 (87.5)38 (65.5)
  Positive6 (12.5)20 (34.5)
TP53 MIS 0.027a
  Negative31 (64.6)25 (43.1)
  Positive17 (35.4)33 (56.9)
MKI67 0.025a
  Negative27 (56.3)20 (34.5)
  Positive21 (43.8)38 (65.5)
p53 0.530
  Negative31 (64.6)34 (58.6)
  Positive17 (35.4)24 (41.4)
TP53 mutation 0.055
  Negative16 (33.3)10 (17.2)
  Positive32 (66.7)48 (82.8)
Codon 72 0.530
  Negative31 (64.6)34 (58.6)
  Positive17 (35.4)24 (41.4)

a P<0.05. TNCB, triple negative breast cancer; CD, cluster of differentiation; TP53, tumor protein p53; MKI67, marker of proliferation Ki-67.

Expression of CD117 is increased in TNBC patients

CD117 expression was identified in 28/58 of TNBC samples (48.3%), and in 14/48 of non-TNBC samples (29.2%). Positive staining for CD117 was observed in the cytoplasm or at the cell membrane (Fig. 1I). The TNBC tissues exhibited a higher rate of positive staining for CD117 compared with non-TNBC tissues (P=0.045; Table III). The presence of p53 protein, localized in the nuclei (Fig. 1J), was similar in TNBC and non-TNBC patients (P=0.530; Table III). Furthermore, in TNBC, positive expression of CD117 was associated with vascular invasion (P=0.024), proliferation index (P=0.01) and tumor recurrence (P=0.001; Table IV). No association was identified between CD117 expression and tumor size, tumor grade, nerve invasion, lymph node metastasis, p53 protein or TP53 mutation in TNBC (Table IV).

Table IV.

Association of CD117 with clinicopathological features of 58 patients with TNBC.

Table IV.

Association of CD117 with clinicopathological features of 58 patients with TNBC.

CD117

VariableNegative, n (%)Positive, n (%)P-value
p53 0.825
  Negative18 (60.0)16 (57.1)
  Positive12 (40.0)12 (42.9)
TP53 MIS 0.031
  Negative17 (56.7)8 (28.6)
  Positive13 (43.3)20 (48.3)
TP53 mutation 0.380
  Negative7 (23.3)4 (14.3)
  Positive23 (76.7)24 (85.7)
Codon 72 0.754
  Negative17 (56.7)17 (60.7)
  Positive13 (43.3)11 (39.3)
MKI67 0.010
  Negative15 (50.0)5 (17.9)
  Positive15 (50.0)23 (82.1)
Age, years 0.512
  ≤5011 (36.7)8 (28.6)
  >5019 (63.3)20 (71.4)
Tumor grade 0.849
  I10 (33.3)10 (35.7)
  II and III20 (66.7)18 (64.3)
Tumor, cm 0.786
  ≤215 (50.0)13 (46.4)
  >215 (50.0)15 (53.6)
Lymph node status 0.451
  Negative11 (36.7)13 (46.4)
  Positive19 (63.3)15 (53.6)
Vascular invasion 0.024
  No26 (86.7)17 (60.7)
  Yes4 (13.3)11 (39.9)
Recurrence 0.001
  No23 (76.7)9 (32.1)
  Yes7 (23.3)19 (67.9)
Nerve invasion 0.649
  No23 (76.7)20 (71.4)
  Yes7 (23.3)8 (28.6)

[i] TNCB, triple negative breast cancer; CD, cluster of differentiation; p53/TP53, tumor protein p53; MKI67, marker of proliferation Ki-67.

TP53 missense mutations occur at a high frequency in TNBC

Missense mutations were the most common type of TP53 mutations (40/106, 37.7%) in breast cancer. Frame-shift mutations were identified in 7 patients (6.6%), nonsense mutations were observed in 6 patients (5.67%) and silent mutations in 3 (1.89%). A polymorphism of codon 72 in exon 4 was present in 38.68% (41/106) of patients. A codon 72 polymorphism (CCG to CCC) in exon 4 (Fig. 2A), and codon 248 mutations (CGG to TGG) in exon 7 (Fig. 2B) were the most common mutations. Wild-type codons 72, 61.3% (65/106) of breast cancer patients, and codon 248, 82.1% (87/106) of breast cancer patients were observed (Fig. 2C and D).

Figure 2.

TP53 gene mutations in breast cancer. (A) Codon 72 polymorphism identified in breast cancer (black arrow). (B) Codon 248 point mutations marked by black arrow were observed in breast cancer. (C) Codon 72 with no mutation. (D) Codon 248 with no mutation. TP53, tumor protein P53.

TP53 missense mutations in exons 4–8 were all functional mutations, with the exception of codon 72 mutations. The rate of missense mutations in TNBC tissues (33/58, 56.9%) was significantly higher than in non-TNBC tissues (17/48, 35.4%; P=0.027); however, rates of total TP53 mutations (82.8 vs. 66.7%, respectively) and polymorphisms at codon 72 (41.4 vs. 35.4%, respectively) were similar in TNBC vs. non-TNBC groups (Table III). The presence of p53 protein was similar in the TNBC and non-TNBC patients (P=0.530; Table III). No association was identified between TP53 mutations and the positive expression of p53 protein (Table V). TP53 mutations (P=0.001) were associated with tumor recurrence, whereas expression of p53 protein was not associated with tumor recurrence (Table V). TP53 missense mutations were associated with tumor recurrence (P=0.006), but not tumor grade, size, vascular invasion or lymph node metastasis (Table V).

Table V.

Association between clinicopathological features and TP53 missense mutations.

Table V.

Association between clinicopathological features and TP53 missense mutations.

TP53 missense mutations

VariableNegativePositiveP-value
MKI67 0.442
  Negative10 (40.0)10 (30.3)
  Positive15 (60.0)23 (69.7)
p53 0.853
  Negative15 (60.0)19 (57.6)
  Positive10 (40.0)14 (42.4)
Age, years 0.502
  ≤507 (28.0)12 (36.4)
  >5018 (72.0)21 (63.6)
Tumor grade 0.059
  I12 (48.0)8 (24.2)
  II and III13 (52.0)25 (75.8)
Tumor, cm 0.971
  ≤212 (48.0)16 (48.5)
  >213 (52.0)17 (51.5)
Lymph node status 0. 853
  Negative10 (40.0)14 (42.4)
  Positive15 (60.0)19 (57.6)
Vascular invasion 0.135
  No21 (84.0)22 (66.7)
  Yes4 (16.0)11 (33.3)
Recurrence 0.006
  No19 (76.0)13 (39.4)
  Yes6 (24.0)20 (60.6)
Nerve invasion 0.746
  No18 (72.0)25 (75.8)
  Yes7 (28.0)8 (24.2)

[i] TP53/p53, tumor protein p53; MKI67, marker of proliferation Ki-67.

Expression of CD117 is associated with TP53 missense mutations in TNBC

The TNBC tissues exhibit a higher rate of CD117 positive/TP53 missense mutations (20/58, 34.5%) than non-TNBC tissues (6/48, 12.5%; P=0.009; Table III). The presence of CD117 was associated with TP53 missense mutations (P=0.031) in TNBC (Table IV). The CD117 positive/TP53 missense mutations were associated with vascular invasion (P=0.016), proliferation index (P=0.004) and particularly tumor recurrence (P<0.001). There was no association identified between CD117 positive/TP53 missense mutations and age, grade, tumor size, node status and nerve invasion (Table VI).

Table VI.

Association of CD117+/TP53 missense mutation+ with clinicopathological features of 58 patients with TNBC.

Table VI.

Association of CD117+/TP53 missense mutation+ with clinicopathological features of 58 patients with TNBC.

CD117/TP53 missense

VariableNegativePositiveP-value
MKI67 0.004
  Negative18 (47.4)2 (10.0)
  Positive20 (52.6)18 (90.0)
Age, years 0.792
  ≤5012 (31.6)7 (35.0)
  >5026 (68.4)13 (65.0)
Tumor grade 0.270
  I15 (39.5)5 (25.0)
  II and III23 (60.5)15 (75.0)
Size, cm 0.360
  ≤220 (52.6)8 (40.0)
  >218 (47.4)12 (60.0)
Lymph node status 0.877
  Negative16 (42.1)8 (40.0)
  Positive22 (57.9)12 (60.0)
Vascular invasion 0.016
  No32 (84.2)11 (55.0)
  Yes6 (15.8)9 (45.0)
Recurrence <0.001
  No28 (73.7)4 (20.0)
  Yes10 (26.3)16 (80.0)
Nerve invasion 0.913
  No28 (73.7)15 (75.0)
  Yes10 (26.3)5 (25.0)

[i] TNBC, triple negative breast cancer; CD, cluster of differentiation; MKI67, marker of proliferation Ki-67.

CD117+/TP53 missense mutation+ and vascular invasion are independent prognostic factors in TNBC

Survival analysis of the 58 patients with TNBC revealed that tumor grade, vascular invasion, expression of CD117 and MKI67 protein, TP53 missense mutations, TP53 mutations or the CD117+/TP53 missense mutation+ (CD117 and TP53 missense mutations together), were associated with overall survival (Fig. 3 and Table VII). The following features were not associated with the overall survival rate of patients with TNBC: Age, tumor size, lymph node status, nerve invasion, codon 72 mutations or expression of p53 protein. The Cox proportional hazards model revealed that CD117+/TP53 missense mutation+ [positive vs. negative group, P=0.004, RR=3.153; 95% confidence interval (CI), 1.430–6.952] and vascular invasion (present vs. not present, P=0.043, RR=2.234; 95% CI, 1.026–4.863) were independent prognostic factors in patients with TNBC (Fig. 3; Table VII).

Figure 3.

Survival analysis in patients with TNBC. Kaplan-Meier plots of overall survival in patients with TNBC and with (A) positive and negative vascular invasion, (B) high and low grade tumors, (C) positive and negative MKI67 protein expression, (D) CD117 protein expression, (E) TP53 missense mutations, (F) TP53 mutations, and (G) CD117 with TP53 missense mutations. TNBC, triple negative breast cancer; MKI67, marker of proliferation Ki-67; TP53, tumor protein P53.

Table VII.

Univariate and multivariate survival analysis of 58 patients with TNBC.

Table VII.

Univariate and multivariate survival analysis of 58 patients with TNBC.

P-value

VariableUnivariateMultivariateRR95% CI
Age, years (≤50 vs. >50)0.738
Tumor size, cm (≤2 vs. >2)0.389
Lymph node status (+ vs. −)0.601
Histological grade (high vs. low)0.014
Vascular invasion (yes vs. no) <0.001a0.043a2.2341.026–4.863
Nerve invasion (yes vs. no)0.898
CD117 (+ vs. −)<0.001
MKI67 (+ vs. −)0.040
P53 (+ vs. −)0.651
TP53 MIS (+ vs. −)0.011
TP53 mutation (+ vs. −)0.022
Codon 72 (+ vs. −)0.837
CD117/TP53MIS (+ vs. −) <0.001a0.004a3.1531.430–6.952

a Statistically significant. CI, confidence interval; RR, risk ratio; CD, cluster of differentiation; MKI67, marker of proliferation Ki67; TP53, tumor protein P53.

Discussion

In the present study, patients with TNBC had a higher rate of CD117 expression, TP53 missense mutations and CD117+/TP53 missense mutation+ than patients with non-TNBC. CD117, TP53 missense mutations and CD117+/TP53 missense mutation+ were associated with poor prognosis and tumor recurrence in patients with TNBC. It was confirmed that CD117+/TP53 missense mutation+ was an independent prognostic factor in patients with TNBC. CD117+/TP53 missense mutation+ was associated with positive expression of MKI67 and vascular invasion. It was identified that tumor grade and the proliferation index (as indicated by MKI67 levels) were poor prognostic factors, associated with a high risk of relapse in patients with TNBC, consistent with previous reports (24–26). Vascular invasion, an independent prognostic factor, was associated with tumor recurrence in patients with TNBC in the present study. The data generated in the present study were consistent with that of a previous study (27), which reported that the 5-year metastasis-free survival rate in patients with TNBC and vascular invasion was lower than in TNBC patients without vascular invasion (P=0.003) (27).

Simon et al (28) demonstrated that none of these tumors contained mutated KIT; however, in the present study a higher rate of CD117 expression was identified in patients with TNBC than in patients with non-TNBC, consistent with previous studies (11,29). It was also confirmed that the presence of CD117 was associated with the expression of MKI67 and vascular invasion in patients with TNBC, consistent with previous observations (6,29).

There are conflicting reports regarding the prognostic value of CD117 in TNBC; Several reports have demonstrated that CD117 may not influence the survival of patients with TNBC (11,30), whereas Kashiwagi et al have confirmed a poorer outcome for CD117-positive TNBC (9). Overexpression of CD117 protein was associated with poor prognosis and recurrence in TNBC, but was not identified as an independent prognostic factor in the present study. A possible explanation for these opposing results is differences in threshold for categorizing samples as KIT-positive; Thike et al (6) used ≥1% of tumor cells as positive criteria, whereas Kashiwagi et al (9) set their threshold as ≥10%. In the present study, the threshold was set at 10% of stained cells. Another explanation for these opposing results is differences in criteria of HER2 positive expression for the determination of TNBC. Nielsen et al (30) classified the HER2 expression according to a three-point scoring system, in which patients were divided into three groups (negative, weakly-positive and positive groups); overexpression of CD117 protein was considered not to be associated the poor prognosis of TNBC patients. However, in the present study, HER2 immunostaining was considered positive (graded 3+, or gene amplification confirmed by FISH), since it is a standard threshold for TNBC assessment.

A number of previous studies have investigated TP53 gene mutations in TNBC (31). In the present study, the frequency of TP53 missense mutations was increased in TNBC compared with non-TNBC tissues, consistent with previous observations (32). A positive association was not observed between the expression of p53 protein and TP53 missense mutations in TNBC in the present study using direct sequencing, consistent with previous reports (33). However, Kim et al (34) reported that expression levels of p53 were also influenced by TP53 mutation status and mRNA level of TP53. The authors detected TP53 mutations using next-generation sequencing (34), while direct sequencing in our study. Taylor et al (35) found that results of p53 by IHC could identifying TP53 missense mutations in exons 4–8 in breast cancer, because moderate/average nuclear staining intensity for TP53 as a positive criterion, rather than the >10% positive tumor cells that was used in the present study. Furthermore, a previous study reported the Arg72Pro polymorphism in the TNBC NIPBC-2 cell line (36). In the present study, the Arg72Pro polymorphism was identified in 41.4% of patients with TNBC and in 35.4% of the non-TNBC patients; the positive rate in patients of TNBC compared with in the non-TNBC patients was similar (P=0.530).

It has been reported that p53 expression is associated with the prognosis of patients with TNBC (15). The present study revealed that TP53 missense mutations were associated with poor patient prognosis and a high risk of relapse in patients with TNBC, which was consistent with a previous report (37). Silwal-Pandit et al identified that TP53 mutations in TNBC are not associated with an unfavorable prognosis (38). TP53 mutations were also detected in exon2-8 (38), whereas the present study analyzed TP53 missense mutations in exon4-8.

To the best of our knowledge, the present study reported an association between CD117 expression and TP53 missense mutations for the first time, but not the association between CD117 expression and codon 72 polymorphisms, or synonymous mutations in patients with TNBC. CD117+/TP53 missense mutation+ was associated with positive MKI67 expression, vascular invasion and tumor recurrence. On the basis of these results, it may be hypothesized that CD117+/TP53 missense mutation+ is associated with the malignant biological behavior of patients with TNBC. p53 has been reported to regulate numerous genes, including MYC proto-oncogene and KIT, affecting the aggressive biological behavior of cancer (39–41). p53 may also directly regulate microRNA-34 (miR-34), with inactivation of p53 reducing miR-34 expression, promoting the invasion of colon cancer cells (18). Furthermore, the present study demonstrated that the expression of CD117 protein in TNBC tissues was an independent prognostic factor in patients with TNBC with TP53 missense mutations.

It was not possible to perform sub-categorization of patients with TNBC according to biological characteristics such as EGFR amplification, which may be one limitation of the present study. CD117+/TP53 missense mutation+ was not analyzed in patients with TNBC of different genotypes. The present study also did not detect the level of miR-34 or analyze the association between miR-34 and CD117+/TP53 missense mutation+. Therefore, further study into the effect of CD117+/TP53 missense mutation+ in patients with TNBC with different genotypes and the association between miR-34 and CD117+/TP53 missense mutation+ is required.

In conclusion, the present study confirmed that CD117+/TP53 missense mutation+ was associated with MKI67 expression, vascular invasion and tumor recurrence in patients with TNBC. CD117 expression was indicative of poor prognosis in patients with TNBC with TP53 missense mutations.

Acknowledgements

The authors would like to thank thank Keyang Sun, Liang Liu and Jie Chen for preparing the paraffin-embedded slides, and Miss Liang Liu and Mr Jie Chen as technicians (Department of Pathology, Shanghai No. 6 People's Hospital, Shanghai, China) for their help with immunohistochemical staining was.

Funding

This project was supported by grants from the National Natural Science Foundation (grant no. 81100223) and from Shanghai Municipal Health Bureau Program (grant no. 20134052).

Availability of data and materials

The analyzed data sets generated during the study are available from the corresponding author, on reasonable request.

Authors' contributions

Preparation of the DNA, sequencing, IHC and analysis of data were performed by YLL. Statistical analysis was also performed by YLL. The slides were analyzed by HZZ and WTH. GL participated in analysis of experimental data and conducted the PCR experiment. The manuscript was written by YLL and reviewed by HZZ and GL.

Ethics approval and consent to participate

The Ethics Committee for Human Studies at Shanghai Jiao Tong University (Shanghai, China) approved the present study, which was conducted in accordance with The Declaration of Helsinki. Participants were fully informed of the procedures, and written informed consent was obtained from all patients.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Foulkes WD, Smith IE and Reis-Filho JS: Triple-negative breast cancer. N Engl J Med. 363:1938–1948. 2010. View Article : Google Scholar : PubMed/NCBI

2 

Changavi AA, Shashikala A and Ramji AS: Epidermal growth factor receptor expression in triple negative and nontriple negative breast carcinomas. J Lab Physicians. 7:79–83. 2015. View Article : Google Scholar : PubMed/NCBI

3 

Metzger-Filho O, Tutt A, de Azambuja E, Saini KS, Viale G, Loi S, Bradbury I, Bliss JM, Azim HA Jr, Ellis P, et al: Dissecting the heterogeneity of triple-negative breast cancer. J Clin Oncol. 30:1879–1887. 2012. View Article : Google Scholar : PubMed/NCBI

4 

Lasota J and Miettinen M: Clinical significance of oncogenic KIT and PDGFRA mutations in gastrointestinal stromal tumours. Histopathology. 53:245–266. 2008. View Article : Google Scholar : PubMed/NCBI

5 

Yoshida C, Tsuji AB, Sudo H, Sugyo A, Kikuchi T, Koizumi M, Arano Y and Saga T: Therapeutic efficacy of c-kit-targeted radioimmunotherapy using 90Y-labeled anti-c-kit antibodies in a mouse model of small cell lung cancer. PLoS One. 8:e592482013. View Article : Google Scholar : PubMed/NCBI

6 

Thike AA, Iqbal J, Cheok PY, Chong AP, Tse GM, Tan B, Tan P, Wong NS and Tan PH: Triple negative breast cancer: Outcome correlation with immunohistochemical detection of basal markers. Am J Surg Pathol. 34:956–964. 2010. View Article : Google Scholar : PubMed/NCBI

7 

Blassl C, Kuhlmann JD, Webers A, Wimberger P, Fehm T and Neubauer H: Gene expression profiling of single circulating tumor cells in ovarian cancer-Establishment of a multi-marker gene panel. Mol Oncol. 10:1030–1042. 2016. View Article : Google Scholar : PubMed/NCBI

8 

Fan H, Yuan Y, Wang J, Zhou F, Zhang M, Giercksky KE, Nesland JM and Suo Z: CD117 expression in operable oesophageal squamous cell carcinomas predicts worse clinical outcome. Histopathology. 62:1028–1037. 2013. View Article : Google Scholar : PubMed/NCBI

9 

Kashiwagi S, Yashiro M, Takashima T, Aomatsu N, Kawajiri H, Ogawa Y, Onoda N, Ishikawa T, Wakasa K and Hirakawa K: c-Kit expression as a prognostic molecular marker in patients with basal-like breast cancer. Br J Surg. 100:490–496. 2013. View Article : Google Scholar : PubMed/NCBI

10 

Medinger M, Kleinschmidt M, Mross K, Wehmeyer B, Unger C, Schaefer HE, Weber R and Azemar M: c-kit (CD117) expression in human tumors and its prognostic value: An immunohistochemical analysis. Pathol Oncol Res. 16:295–301. 2010. View Article : Google Scholar : PubMed/NCBI

11 

Jansson S, Bendah PO, Grabau DA, Falck AK, Fernö M, Aaltonen K and Rydén L: The three receptor tyrosine kinases c-KIT, VEGFR2 and PDGFRα, closely spaced at 4q12, show increased protein expression in triple-negative breast cancer. PLoS One. 9:e1021762014. View Article : Google Scholar : PubMed/NCBI

12 

Kim HW, Lee HM, Hwang SH, Ahn SG, Lee KA and Jeong J: Patterns and biologic features of p53 mutation types in Korean breast cancer patients. J Breast Cancer. 17:1–7. 2014. View Article : Google Scholar : PubMed/NCBI

13 

Kruiswijk F, Labuschagne CF and Vousden KH: p53 in survival, death and metabolic health: A lifeguard with a licence to kill. Nat Rev Mol Cell Biol. 16:393–405. 2015. View Article : Google Scholar : PubMed/NCBI

14 

Fernández-Cuesta L, Oakman C, Falagan-Lotsch P, Smoth KS, Quinaux E, Buyse M, Dolci MS, Azambuja ED, Hainaut P, Dell'orto P, et al: Prognostic and predictive value of TP53 mutations in node-positive breast cancer patients treated with anthracycline- or anthracycline/taxane-based adjuvant therapy: Results from the BIG 02–98 phase III trial. Breast Cancer Res. 14:R702012. View Article : Google Scholar : PubMed/NCBI

15 

Chae BJ, Bae JS, Lee A, Park WC, Seo YJ, Song BJ, Kim JS and Jung SS: p53 as a specific prognostic factor in triple-negative breast cancer. Jpn J Clin Oncol. 39:217–224. 2009. View Article : Google Scholar : PubMed/NCBI

16 

Olivier M, Langerød A, Carrieri P, Bergh J, Klaar S, Eyfjord J, Theillet C, Rodriguez C, Lidereau R, Bièche I, et al: The clinical value of somatic TP53 gene mutations in 1,794 patients with breast cancer. Clin Cancer Res. 12:1157–1167. 2006. View Article : Google Scholar : PubMed/NCBI

17 

Foedermayr M, Sebesta M, Rudas M, Berghoff AS, Promberger R, Preusser M, Dubsky P, Fitzal F, Gnant M, Steger GG, et al: BRCA-1 methylation and TP53 mutation in triple-negative breast cancer patients without pathological complete response to taxane-based neoadjuvant chemotherapy. Cancer Chemother Pharmacol. 73:771–778. 2014. View Article : Google Scholar : PubMed/NCBI

18 

Siemens H, Jackstadt R, Kaller M and Hermeking H: Repression of c-Kit by p53 is mediated by miR-34 and is associated with reduced chemoresistance, migration and stemness. Oncotarget. 4:1399–1415. 2013. View Article : Google Scholar : PubMed/NCBI

19 

Mittendorf EA, Ballman KV, McCall LM, Yi M, Sahin AA, Bedrosian I, Hansen N, Gabram S, Hurd T, Giuliano AE and Hunt KK: Evaluation of the stage IB designation of the American Joint Committee on Cancer staging system in breast cancer. J Clin Oncol. 33:1119–1127. 2015. View Article : Google Scholar : PubMed/NCBI

20 

Penault-Llorca F, André F, Sagan C, Lacroix-Triki M, Denoux Y, Verriele V, Jacquemier J, Baranzelli MC, Bibeau F, Antoine M, et al: Ki67 expression and docetaxel efficacy in patients with estrogen receptor-positive breast cancer. J Clin Oncol. 27:2809–2815. 2009. View Article : Google Scholar : PubMed/NCBI

21 

Huang Q, Li F, Liu X, Li W, Shi W, Liu FF, O'Sullivan B, He Z, Peng Y, Tan AC, et al: Caspase 3-mediated stimulation of tumor cell repopulation during cancer radiotherapy. Nat Med. 17:860–866. 2011. View Article : Google Scholar : PubMed/NCBI

22 

Yaman S, Gumuskaya B, Ozkan C, Aksoy S, Guler G and Altundag K: Lymphatic and capillary invasion patterns in triple negative breast cancer. Am Surg. 78:1238–1242. 2012.PubMed/NCBI

23 

Varga Z, Noske A, Ramach C, Padberg B and Moch H: Assessment of HER2 status in breast cancer: Overall positivity rate and accuracy by fluorescence in situ hybridization and immunohistochemistry in a single institution over 12 years: A quality control study. BMC Cancer. 13:6152013. View Article : Google Scholar : PubMed/NCBI

24 

Yue YI, Astvatsaturyan K, Cui X, Zhang X, Fraass B and Bose S: Stratification of prognosis of triple-negative breast cancer patients using combinatorial biomarkers. PLoS One. 11:e01496612016. View Article : Google Scholar : PubMed/NCBI

25 

Ricciardi GR, Adamo B, Ieni A, Licata L, Cardia R, Ferraro G, Franchina T, Tuccari G and Adamo V: Androgen Receptor (AR), E-cadherin, and Ki-67 as emerging targets and novel prognostic markers in Triple-Negative Breast Cancer (TNBC) patients. PLoS One. 10:e01283682015. View Article : Google Scholar : PubMed/NCBI

26 

Keam B, Im SA, Lee KH, Han SW, Oh DY, Kim JH, Lee SH, Han W, Kim DW, Kim TY, et al: Ki-67 can be used for further classification of triple negative breast cancer into two subtypes with different response and prognosis. Breast Cancer Res. 13:R222011. View Article : Google Scholar : PubMed/NCBI

27 

Sabatier R, Jacquemier J, Bertucci F, Esterni B, Finetti P, Azario F, Birnbaum D, Viens P, Gonçalves A and Extra JM: Peritumoural vascular invasion: A major determinant of triple-negative breast cancer outcome. Eur J Cancer. 47:1537–1545. 2011. View Article : Google Scholar : PubMed/NCBI

28 

Simon R, Panussis S, Maurer R, Spichtin H, Glatz K, Tapia C, Mirlacher M, Rufle A, Torhorst J and Sauter G: KIT (CD117)-positive breast cancers are infrequent and lack KIT gene mutations. Clin Cancer Res. 10:178–183. 2004. View Article : Google Scholar : PubMed/NCBI

29 

Kanapathy Pillai SK, Tay A, Nair S and Leong CO: Triple-negative breast cancer is associated with EGFR, CK5/6 and c-KIT expression in Malaysian women. BMC Clin Pathol. 12:182012. View Article : Google Scholar : PubMed/NCBI

30 

Nielsen TO, Hsu FD, Jensen K, Cheang M, Karaca G, Hu Z, Hernandez-Boussard T, Livasy C, Cowan D, Dressler L, et al: Immuno-histochemical and clinical characterization of the basal-like subtype of invasive breast carcinoma. Clin Cancer Res. 10:5367–5374. 2004. View Article : Google Scholar : PubMed/NCBI

31 

Fountzilas G, Giannoulatou E, Alexopoulou Z, Zagouri F, Timotheadou E, Papadopoulou K, Lakis S, Bobos M, Poulios C, Sotiropoulou M, et al: TP53 mutations and protein immunopositivity may predict for poor outcome but also for trastuzumab benefit in patients with early breast cancer treated in the adjuvant setting. Oncotarget. 7:32731–32753. 2016. View Article : Google Scholar : PubMed/NCBI

32 

Kim Y, Kim J, Lee HD, Jeong J, Lee W and Lee KA: Spectrum of EGFR gene copy number changes and KRAS gene mutation status in korean triple negative breast cancer patients. PLoS One. 8:e790142013. View Article : Google Scholar : PubMed/NCBI

33 

Végran F, Rebucci M, Chevrier S, Cadouot M, Boidot R and Lizard-Nacol S: Only missense mutations affecting the DNA binding domain of p53 influence outcomes in patients with breast carcinoma. PLoS One. 8:e551032013. View Article : Google Scholar : PubMed/NCBI

34 

Kim JY, Park K, Jung HH, Lee E, Cho EY, Lee KH, Bae SY, Lee SK, Kim SW, Lee JE, et al: Association between mutation and expression of TP53 as a potential prognostic marker of triple-negative breast cancer. Cancer Res Treat. 48:1338–1350. 2016. View Article : Google Scholar : PubMed/NCBI

35 

Taylor NJ, Nikolaishvili-Feinberg N, Midkiff BR, Conway K, Millikan RC and Geradts J: Rational manual and automated scoring thresholds for the immunohistochemical detection of TP53 missense mutations in human breast carcinomas. Appl Immunohistochem Mol Morphol. 24:398–404. 2016. View Article : Google Scholar : PubMed/NCBI

36 

Pandrangi SL, Raju Bagadi SA, Sinha NK, Kumar M, Dada R, Lakhanpal M, Soni A, Malvia S, Simon S, Chintamani C, et al: Establishment and characterization of two primary breast cancer cell lines from young Indian breast cancer patients: Mutation analysis. Cancer Cell Int. 14:142014. View Article : Google Scholar : PubMed/NCBI

37 

Dobes P, Podhorec J, Coufal O, Jureckova A, Petrakova K, Vojtesek B and Hrstka R: Influence of mutation type on prognostic and predictive values of TP53 status in primary breast cancer patients. Oncol Rep. 32:1695–1702. 2014. View Article : Google Scholar : PubMed/NCBI

38 

Silwal-Pandit L, Vollan HK, Chin SF, Rueda OM, McKinney S, Osako T, Quigley DA, Kristensen VN, Aparicio S, Børresen-Dale AL, et al: TP53 mutation spectrum in breast cancer is subtype specific and has distinct prognostic relevance. Clin Cancer Res. 20:3569–3580. 2014. View Article : Google Scholar : PubMed/NCBI

39 

Abraham SA, Hopcroft LE, Carrick E, Drotar ME, Dunn K, Williamson AJ, Korfi K, Baquero P, Park LE, Scott MT, et al: Dual targeting of p53 and c-MYC selectively eliminates leukaemic stem cells. Nature. 534:341–346. 2016. View Article : Google Scholar : PubMed/NCBI

40 

Yogev O, Barker K, Sikka A, Almeida GS, Hallsworth A, Smith LM, Jamin Y, Ruddle R, Koers A, Webber HT, et al: p53 loss in MYC-driven neuroblastoma leads to metabolic adaptations supporting radioresistance. Cancer Res. 76:3025–3035. 2016. View Article : Google Scholar : PubMed/NCBI

41 

Lai JH, Fleming KE, Ly TY, Pasternak S, Godlewski M, Doucette S and Walsh NM: Pure versus combined Merkel cell carcinomas: Immunohistochemical evaluation of cellular proteins (p53, Bcl-2 and c-kit) reveals significant overexpression of p53 in combined tumors. Hum Pathol. 46:1290–1296. 2015. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Luo Y, Huang W, Zhang H and Liu G: Prognostic significance of CD117 expression and TP53 missense mutations in triple-negative breast cancer. Oncol Lett 15: 6161-6170, 2018.
APA
Luo, Y., Huang, W., Zhang, H., & Liu, G. (2018). Prognostic significance of CD117 expression and TP53 missense mutations in triple-negative breast cancer. Oncology Letters, 15, 6161-6170. https://doi.org/10.3892/ol.2018.8104
MLA
Luo, Y., Huang, W., Zhang, H., Liu, G."Prognostic significance of CD117 expression and TP53 missense mutations in triple-negative breast cancer". Oncology Letters 15.5 (2018): 6161-6170.
Chicago
Luo, Y., Huang, W., Zhang, H., Liu, G."Prognostic significance of CD117 expression and TP53 missense mutations in triple-negative breast cancer". Oncology Letters 15, no. 5 (2018): 6161-6170. https://doi.org/10.3892/ol.2018.8104
Copy and paste a formatted citation
x
Spandidos Publications style
Luo Y, Huang W, Zhang H and Liu G: Prognostic significance of CD117 expression and TP53 missense mutations in triple-negative breast cancer. Oncol Lett 15: 6161-6170, 2018.
APA
Luo, Y., Huang, W., Zhang, H., & Liu, G. (2018). Prognostic significance of CD117 expression and TP53 missense mutations in triple-negative breast cancer. Oncology Letters, 15, 6161-6170. https://doi.org/10.3892/ol.2018.8104
MLA
Luo, Y., Huang, W., Zhang, H., Liu, G."Prognostic significance of CD117 expression and TP53 missense mutations in triple-negative breast cancer". Oncology Letters 15.5 (2018): 6161-6170.
Chicago
Luo, Y., Huang, W., Zhang, H., Liu, G."Prognostic significance of CD117 expression and TP53 missense mutations in triple-negative breast cancer". Oncology Letters 15, no. 5 (2018): 6161-6170. https://doi.org/10.3892/ol.2018.8104
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team