TP53 Arg72Pro polymorphism is associated with increased overall survival but not response to therapy in Portuguese/Caucasian patients with advanced cervical cancer
- Authors:
- Published online on: March 26, 2018 https://doi.org/10.3892/ol.2018.8354
- Pages: 8165-8171
Abstract
Introduction
Cervical cancer is the fourth most common cancer in women, and the seventh overall, with an estimated 528,000 new cases and 266,000 deaths worldwide in 2012 (1). Currently, for locally advanced cervical cancer standard therapy is cisplatin-based concurrent chemoradiotherapy, with an overall survival (OS) of approximately 66% at 5 years (2–5).
Chemotherapy and radiotherapy are both considered as DNA damage agents, more precisely capable to introduce DNA double-strand breaks (DSBs) in order to induce cell death (6–8). When cellular DNA damage is not repaired one alternative response is apoptosis, which is the objective of the current therapeutic approach with cytotoxic agents and radiotherapy, but genetic alterations at key proteins in the pathway may result in the development of resistance to therapy (9,10). Therefore, studies involving variations in genes involved in cellular response to damage are important to understand how the development of resistant phenotypes occurs. One example may be the TP53 gene, the ‘guardian of genome’ due to its role on cell cycle arrest, DNA repair activation and regulation of apoptosis (11–13). This suppressor gene is located on chromosome 17 (17p13.1) and encodes a phosphoprotein of 393 long amino acids (14,15).
Polymorphic variants are the substitution of a single base which results in alteration of the codon may have different conformation and function, i.e., no changes cannot occur or can be gain or loss of protein function (16,17). Several TP53 mutant proteins associated with tumors, have gained oncogenic function besides losing the suppressive function (18,19). The most studied polymorphism of the TP53 gene is the TP53 Arg72Pro (rs1042522), which influences the protein expression of TP53 protein expression (20). This variant results from a change of guanine (G) to cytosine (C) in codon 72 in exon 4, that leads to the replacement of arginine (Arg) by proline (Pro) (21–23). It should be noted that due to the location in the proline-rich region of the TP53 gene, this single nucleotide polymorphism (SNP) may interfere with protein stability (24,25). The two allelic variants confer different susceptibilities to cancer progression, because they are structurally and functionally different (26). In studies in vivo and in vitro, the Arg allele has a higher capacity to induce apoptosis than the Pro allele. The functions associated with Pro allele include higher induction of cell cycle arrest in G1 and better activation of TP53 dependent DNA repair (27). It has also been mentioned that this polymorphism can influence the individual response (28).
Concerning cervical cancer, few studies have evaluated the predictive role of TP53 Arg72Pro polymorphism in clinical outcome and the results are contradictory (29,30). Therefore, we have conducted this study to assess the possible influence of the TP53 Arg72Pro polymorphism (rs1042522) in OS and disease-free survival (DFS) in patients with advanced cervical cancer.
Materials and methods
Patients
We conducted a retrospective hospital-based study analyzing a total of 260 Caucasians patients with histologically confirmed locally advanced cervical carcinoma (FIGO stage IB2-IVA). These patients were recruited between February 2002 and October 2009, from the north region of Portugal and treated with cisplatin-based chemotherapy (40 mg/m2 per week) and concomitant external radiotherapy and/or brachytherapy in Portuguese Institute of Oncology Francisco Gentil (Porto, Portugal). All women were selected consecutively according to the following inclusion criteria: Women with histological and cytology diagnosis of cervical cancer, age greater than or equal to 18 years, stage IB2-IVA and QTRT concomitant. Regarding exclusion criteria, these were surgery before treatment; absence of informed consent; failure to comply with any of the inclusion criteria.
Patients' clinical characteristics obtained from medical records are described in Table I. The median age at diagnosis was 48.00 years, the more frequent histological type was squamous cancer cell, the stage more common was IIB and the median follow up time was 63.5 months. The tumor stage was evaluated according to the International Federation of Gynecology and Obstetrics (FIGO) classification system, and the assessment of histology type was based the on system of Bethesda classification. Genomic DNA was extracted from peripheral blood samples by using FavorPrep™ Genomic DNA Mini kit (FABGK® 300; Favorgen Biotech Corp., Ping-Tung, Taiwan), according to the manufacturers protocol. All samples were obtained with the informed consent of the participants prior to their inclusion in the study, according to Helsinki Declaration principles and after approval of the Portuguese Institute of Oncology ethics committee (CES.287/014).
Evaluation of chemoradiotherapy response
The therapy response was evaluated according to RECIST criteria (31). Complete response (CR) indicates disappearance of the disease, partial response (PR) indicates at least 50% reduction in tumor load, stable disease (SD) indicates that the lesion showed ≤25% progression or <50% shrinkage, and progression of disease (PD) indicates >25% enlargement of the lesion, or appearance of a new lesion. CR and PR were considered to be a good response; SD and PD, a poor response.
Genotyping of TP53 Arg72Pro (rs1042522) polymorphism
The selected SNP was chosen from the best evidence from published studies (29,30,32,33), through public databases who provide information on the phenotypic risks, had a minor allele frequency of an at least 10 to 20% and the SNP biological effect. The genotyping was performed using Taqman™ Allelic Discrimination methodology by quantitative polymerase chain reaction (qPCR). This method uses probes labeled with fluorochromes specific for each allele, thus VIC probe is allele C and the FAM probe is allele G (AGGAGCTGCTGGvTGCAGGGGCCACG [C/G] GGGGAGCAGCCTCTGGCATTCTGGG). The allelic discrimination PCR reactions were carried out in 6 µl volumes using 2.5 µl of TaqMan® Universal PCR Master Mix (2X), 0.125 µl of 40× assay mix 2.375 µl of sterile H2O and 1 µl of genomic DNA. Amplification of DNA was carried out using the following amplification conditions: 95°C for 10 min, followed by 45 cycles of 95°C for 15 sec and 60°C for 1 min. Data capture and analysis was carried thought the ABI 7300 Real Time PCR System (Applied Biosystems; Thermo Fisher Scientific, Inc., Waltham, MA, USA) and the Sequence Detection Systems software (version 1.2.3; Applied Biosystems; Thermo Fisher Scientific, Inc.).
Quality control included the use of negative controls in all runs, double sampling in at least 10% of the samples, genotyping performed blindly regarding to clinical and pathologic characteristics of patients and the results independently evaluated by two researchers. We observed complete concordance among duplicates.
Statistical analysis
Difference in frequencies of the TP53 Arg72Pro genotypes between the different chemoradiotherapy responses groups were evaluated by χ2 test. The OS and the overall survival at 5 years was defined from the date of diagnosis to the date of death and the percentage of patients alive after 5 years of diagnosis, respectively. The DFS times were defined from the data from the date of diagnosis to the date of disease recurrence. Patients without progression, lost to follow-up or died from other causes were censored at their last date of record. In the evaluation of OS and DFS was used Kaplan-Meier survival estimate and log-rank test. We applied a multivariate analysis using COX regression method to calculate hazard ratio (HR) and 95% confidence intervals (CI) for the association between the genotypes and the risk of death in advanced cervical cancer patients. This analysis was used to adjust for potential confounders, such as age (<48 years vs. ≥48 years), stage (<IIB vs. ≥IIB), smoking habits (non-smokers vs. smokers and former smokers) and histological type (adenosquamous cell carcinomas and small cell carcinoma vs. adenocarcinoma and squamous cell carcinoma), with TP53 Arg72Pro genotypes fitted as indicator variables. A level of P<0.05 was considered statistically significant. All analysis of data was performed using the computer software Statistical Package for Social Sciences (SPSS) for Windows (version 22.0; IBM Corp., Armonk, NY, USA).
As our study was performed based on DNA availability, we did not carry out any power analysis before the study. Therefore, we cannot report on any original study power. However, two-way analysis of variance followed by post hoc analysis was performed as follows: The power to detect a hazard ratio of 2.001 obtained by multivariate analysis, depended on the distribution of the polymorphism genotypes, patients' median survival time, recruitment period (93 months) and additional follow-up time (63.5 months). Consequently, assuming a type I error probability of 0.05, we estimate a post hoc power higher than 80%. This analysis was performed using the Power and Sample Size program (version 3.1.2).
Results
As mentioned before, the TP53 Arg72Pro polymorphism studied in this work results from a change of guanine (G) to cytosine (C) in codon 72 in exon 4 that leads to the replacement of arginine (Arg) by proline (Pro). Besides that, all results are presented for an analysis comparing heterozygote genotypes (Arg/Pro) with homozygous genotypes (Arg/Arg and Pro/Pro).
Of the 260 patients included in this study (Table I), only 249 patients have results for genotyping. The frequencies of Arg/Arg, Arg/Pro and Pro/Pro genotypes were 0.10, 0.33 and 0.56, respectively. The allele frequency for Arg allele and Pro allele was 27.11 and 72.89%, respectively. The good treatment response rate was 10.7, 33.9 and 55.4% for Arg/Arg, Arg/Pro and Pro/Pro genotypes, respectively. Poor treatment response rate for Arg/Arg, Arg/Pro and Pro/Pro genotypes was 6.3, 25.0 and 68.8%, respectively. This polymorphism were found to be not associated with response to therapy (P=0.571) (Table II).
 | Table II.Response to treatment of the advanced cervical cancer patients treated with chemoradiotherapy according to genotypes of the TP53 Arg72Pro polymorphism. |
Regarding OS rates found using Kaplan-Meier method and log-rank test, we observed that the mean survival rates were not statistically different according to the patients TP53 Arg72Pro genotypes (P=0.058), age (P=0.630) and histology (P=0.758). Stage (P=0.008) and recurrence (P<0.001) were independent prognostic factors that influenced significantly OS of women with advanced cervical cancer treated with chemoradiotherapy (QTRT). Moreover, there are significant differences in mean survival between heterozygote genotypes (Arg/Pro) and homozygous genotypes (Arg/Arg and Pro/Pro). The group of patients carrying heterozygous genotype present a higher mean survival rate than the other patients (126 vs. 111 months, P=0.047) (Fig. 1).
Concerning smoking history, our results demonstrate that OS time differed according to the Arg/Arg and Pro/Pro homozygous genotype vs Arg/Pro heterozygous genotypes carriers in non-smoker individuals, but these results are in the threshold for statistical significance (P=0.052; Fig. 2A). No statistically significant differences were found in the genotype frequencies and OS rate among smokers and former smokers (P=0.194; Fig. 2B). Using the Cox regression analysis, we found that carriers of TP53 Arg72Pro homozygous genotypes (Arg/Arg and Pro/Pro) present a 2-fold increase of risk of death which is not statistically significant, when compared with TP53 Arg72Pro heterozygous genotypes, with tumor stage, median age, histology and smoking history as covariates [hazard ratio (HR), 2.001; 95% CI, 0.917–4.368; P=0.082] (Table III).
| Table III.Multivariate analysis of death risk at 5 years by Cox regression for the TP53 genotypes, adjusted to different clinical and pathological variables. |
No difference was found for DFS according to the distribution of genotypes of TP53 Arg72Pro polymorphism (P=0.205), same when comparing patients with heterozygous and homozygous genotypes (P=0.081; Fig. 3).
Discussion
The activation of the response to DNA damage aims to cell cycle arrest and DNA repair, and the lesions correction failure can result in the senescence or apoptosis (34). Assuming that cells respond differently to DNA damage taking into account whether or not they are tumor cells, understanding this mechanisms will allow selection of therapeutic strategies to individualize response to DNA damage in altered in cancer cells (35). Apoptosis is the main mechanism by which anti-cancer agents originate toxicity (36).
One major mechanism of resistance to therapy and cell survival is the inactivation of the function of TP53 gene, so observed resistance in tumor cells harboring wild type TP53 for a large variety of agents, such as ionizing radiation and several classes of cytotoxic drugs, can occur directly by factors that regulate or negate the functional activity of this protein, or indirectly, by deregulation of pathways downstream of this gene (37).
The role of the TP53 Arg72Pro polymorphism remains controversial (17). The segregation of this polymorphism shows pronounced ethnic differences, so results will be dependent of the study population (32,38). It is also important to refer that in this study we did not consider HPV infections, although it might be a relevant issue for additional studies. However, Medeiros and colleagues (39) studied HPV genotyping profile in squamous cervical lesions in Portugal, and then they find high prevalence of HPV-16 and −18, approximately 80 and 15%, respectively, in cases with invasive cervical cancer. Thus, future studies may include HPV genotyping to evaluate its role in disease progression and clinical outcome under the influence of the genetic background.
In our study, carriers of the heterozygous genotype (Arg/Pro) had a higher mean survival overall than patients with both homozygous genotypes (Arg/Arg and Pro/Pro). Several studies have evaluated the influence of TP53 codon 72 polymorphism in the clinical outcome of cancer patients with controversial results (29,30,33,40). Investigation of Piña-Sánchez et al (30) in Mexican women with cervical cancer found a higher survival in heterozygous women (Arg/Pro) than in homozygous women (Arg/Arg and Pro/Pro), however without significant statistical differences. In study of Liu et al (29), they did not find association of TP53 Arg72Pro polymorphism and clinical outcome in Chinese women with cervical carcinoma.
In patients with pancreatic, testicular and prostate cancer no significant effect of this polymorphism was found (40,41). Pro allele homozygosis has been linked with lower sensitivity to chemotherapy in breast and head and neck cancer and lower survival in breast, lung and colorectal cancer (42–46). Moreover other studies show that carriers of Arg genotype have a higher treatment response rate and survival after chemoradiotherapy in advanced head and neck cancer and lung and breast cancer (43,44,47). The presence of one mutated Arg allele may be associated with a reduced sensitivity to cancer therapy in head and neck cancer as well as retention of the Arg allele in heterozygous women with breast cancer are associated with a reduced OS and progression-free disease (48). In this sense, Sullivan and colleagues (44) found that drugs exert their cytotoxic effect in different ways, according to the two codon 72 mutant variant of TP53 gene, thus verifying a differentiated cell resistance.
There are four possible reasons that may explain the fact that homozygous patients had lower survival than heterozygous patients: i) As seen in other types of cancer, patients with homozygous Pro allele have lower survival than heterozygous carriers, since this allele has a major role in cell cycle arrest and DNA repair than Arg allele (27). Wild type TP53 Pro variant activates several genes involved in DNA repair more effectively than TP53 Arg variant. At the same time, cells expressing the TP53 Pro allele were able to repair the DNA damage much more effectively than cells expressing TP53 Arg allele (25); ii) Patients with homozygous Arg allele showed lower survival rates compared to heterozygous. It is important refer that the Arg variant has been correlated with a higher affinity of binding and degradation of TP53 protein by E6 oncoprotein of HPV-16/HPV-18 (38,49–51). One of the better well-known functions of the HPV E6 is the ability to increase the tolerance of normal response to DNA damage or then the independent regulation of cellular growth (52,53). These actions are promoted by TP53 degradation as well as the inhibition of the gene and the multiple repair pathways. Furthermore, the expression of E6 decreases the ability to repair DSBs (53). In this sense, it is believed that carriers of the Arg/Arg homozygous genotype have lower apoptotic capacity, which results in poor survival; iii) the low survival for Arg/Arg homozygous patients have a greater affinity for the mutant TP53 creating mutants with gain-of-function. Furthermore this variant seems to inhibit the pro-apoptotic activity of the TP73 gene, which determines the cellular response to different anticancer drugs. In head and neck tumors where TP53 gene is frequently mutated it is noted that Arg allele carriers had higher resistance to chemotherapy leads to shorter survival. It should be noted that the Pro allele is more frequent with TP53 wild type and tumors are less sensitive to apoptosis (25); d) it is known that tumors with Arg allele were associated with insufficient or absence of apoptosis, because it was observed the absence of coexpression of Fas and FasL, as well as high expression of Bcl-2 protein. In heterozygous carriers of Arg72Pro polymorphism the absence of expression of Bcl-2 and co-expression of Fas/FasL is not found. The Bcl-2, Fas and FasL are three apoptosis-related proteins and the down regulation of Fas expression is common in vary type of cancers, including gynecological cancers (54).
This study also indicates that the influence of Arg72Pro polymorphism in treatment response of cervical cancer patients seems to be modulated by smoking history. Our results demonstrate that non-smoker carriers of homozygous genotype present a lower mean OS time comparing with patients with heterozygous genotype (P=0.052), but these results are in the threshold for statistical significance. However, this potential association was not observed in smoker or former-smokers (P=0.194). In a similar study in lung cancer no association was found between genotype of the polymorphism and OS of patients, taking into account their smoking history (P=0.850) (55). Moreover, the biological mechanism that may explain these differences in results is not yet known.
One of the possible limitations of the present study was the exclusion of participants with cervical intraepithelial neoplasia (CIN) or uninfected controls. Therefore, future studies including these types of participants will be relevant to make this study more complete, so to compare the impact of the TP53 Arg72Pro polymorphism in clinical outcome between pre-invasive cancer patients and advanced cervical cancer patients.
In conclusion, our results demonstrate survival advantage in heterozygous carriers of Arg72Pro polymorphism and a trend to greater risk of death in the homozygous carriers of this polymorphism. Furthermore, TP53 genotypes could be a useful molecular tools for predicting the clinical outcome of cervical cancer patients and may allow to evaluate optional therapeutic regimens in patients with lower survival. Therefore, in the attempt of optimizing responses and minimizing toxicities associated with chemoradiotherapy, the analysis of a wide range of genetic polymorphisms in DNA damages response genes may indicate the more suitable therapeutic procedure for each cancer patient.
Acknowledgements
This authors thank the Research Department-Portuguese League against Cancer (NRNorte) for their general support provided.
Funding
The present study was funded by a research grant for Doctoral project of Augusto Nogueira from the Ministério da Ciência, Tecnologia e Ensino Superior-FCT (Fundação para a Ciência e a Tecnologia: SFRH/BD/124155/2016) and by Project no. CI-IPOP-22-2015 from the Research Center the Portuguese Institute of Oncology of Porto, (Porto, Portugal).
Availability of data and materials
The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.
Authors' contributions
AC and AN conceived and designed the experiments. AC and AN performed the experiments. AC, AN and RM analyzed the data. SS, JA, IB and RC contributed to the interpretation of results obtained and manuscript construction. DP analyzed and interpreted the patients' data regarding the clinical characteristics. AC and AN wrote the paper. All authors read and approved the final manuscript.
Ethics approval and consent to participate
All samples were obtained with the informed consent of the participants prior to their inclusion in the study, according to Helsinki Declaration principles and after approval of the ethics committee of Portuguese Oncology Institute of Porto (CES.287/014).
Consent for publication
Not applicable.
Competing interests
The authors declare that they have no competing interests.
References
|
Ferlay J, Soerjomataram I, Dikshit R, Eser S, Mathers C, Rebelo M, Parkin DM, Forman D and Bray F: Cancer incidence and mortality worldwide: Sources, methods and major patterns in GLOBOCAN 2012. Int J Cancer. 136:E359–E386. 2015. View Article : Google Scholar : PubMed/NCBI | |
|
Noordhuis MG, Eijsink JJH, Roossink F, de Graeff P, Pras E, Schuuring E, Wisman GB, de Bock GH and van der Zee AG: Prognostic cell biological markers in cervical cancer patients primarily treated with (chemo)radiation: A systematic review. Int J Radiat Oncol Biol Phys. 79:325–334. 2011. View Article : Google Scholar : PubMed/NCBI | |
|
Downs L: Advances in cervical cancer treatment. Gynecol Oncol. 121:431–433. 2011. View Article : Google Scholar : PubMed/NCBI | |
|
Fujiwara M, Isohashi F, Mabuchi S, Yoshioka Y, Seo Y, Suzuki O, Sumida I, Hayashi K, Kimura T and Ogawa K: Efficacy and safety of nedaplatin-based concurrent chemoradiotherapy for FIGO Stage IB2-IVA cervical cancer and its clinical prognostic factors. J Radiat Res. 56:305–314. 2015. View Article : Google Scholar : PubMed/NCBI | |
|
Tangjitgamol S, Katanyoo K, Laopaiboon M, Lumbiganon P, Manusirivithaya S and Supawattanabodee B: Adjuvant chemotherapy after concurrent chemoradiation for locally advanced cervical cancer. Cochrane Database Syst Rev. 3:CD0104012014. | |
|
Hosoya N and Miyagawa K: Targeting DNA damage response in cancer therapy. Cancer Sci. 105:370–388. 2014. View Article : Google Scholar : PubMed/NCBI | |
|
Bajinskis A, Natarajan AT, Erixon K and Harms-Ringdahl M: DNA double strand breaks induced by the indirect effect of radiation are more efficiently repaired by non-homologous end joining compared to homologous recombination repair. Mutat Res. 756:21–29. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Goldstein M and Kastan MB: The DNA damage response: Implications for tumor responses to radiation and chemotherapy. Annu Rev Med. 66:129–143. 2015. View Article : Google Scholar : PubMed/NCBI | |
|
Khan KH, Blanco-Codesido M and Molife LR: Cancer therapeutics: Targeting the apoptotic pathway. Crit Rev Oncol Hematol. 90:200–219. 2014. View Article : Google Scholar : PubMed/NCBI | |
|
Jekimovs C, Bolderson E, Suraweera A, Adams M, O'Byrne KJ and Richard DJ: Chemotherapeutic compounds targeting the DNA double-strand break repair pathways: The good, the bad and the promising. Front Oncol. 4:862014. View Article : Google Scholar : PubMed/NCBI | |
|
Basu A and Krishnamurthy S: Cellular responses to Cisplatin-induced DNA damage. J nucleic acids. 2010:2013672010. View Article : Google Scholar : PubMed/NCBI | |
|
Zhou X, Gu Y and Zhang SL: Association between p53 codon 72 polymorphism and cervical cancer risk among Asians: A huge review and meta-analysis. Asian Pac J Cancer Prev. 13:4909–4914. 2012. View Article : Google Scholar : PubMed/NCBI | |
|
Sionov RV and Haupt Y: The cellular response to p53: The decision between life and death. Oncogene. 18:6145–6157. 1999. View Article : Google Scholar : PubMed/NCBI | |
|
Naccarati A, Polakova V, Pardini B, Vodickova L, Hemminki K, Kumar R and Vodicka P: Mutations and polymorphisms in TP53 gene-an overview on the role in colorectal cancer. Mutagenesis. 27:211–218. 2012. View Article : Google Scholar : PubMed/NCBI | |
|
Golubovskaya VM and Cance WG: Targeting the p53 pathway. Surg Oncol Clin N Am. 22:747–764. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Dos Santos HG, Nunez-Castilla J and Siltberg-Liberles J: Functional diversification after gene duplication: Paralog specific regions of structural disorder and phosphorylation in p53, p63 and p73. PLoS One. 11:e01519612016. View Article : Google Scholar : PubMed/NCBI | |
|
Donehower LA: p53: Guardian and suppressor of longevity? Exp Gerontol. 40:7–9. 2005. View Article : Google Scholar : PubMed/NCBI | |
|
Haupt S, Raghu D and Haupt Y: Mutant p53 drives cancer by subverting multiple tumor suppression pathways. Front Oncol. 6:122016. View Article : Google Scholar : PubMed/NCBI | |
|
Liu J, Zhang C and Feng Z: Tumor suppressor p53 and its gain-of-function mutants in cancer. Acta biochim biophys Sin (Shanghai). 46:170–179. 2014. View Article : Google Scholar : PubMed/NCBI | |
|
Dastjerdi MN: TP53 codon 72 polymorphism and P53 protein expression in colorectal cancer specimens in Isfahan. Acta Med Iran. 49:71–77. 2011.PubMed/NCBI | |
|
Hu X, Zhang Z, Ma D, Huettner PC, Massad LS, Nguyen L, Borecki I and Rader JS: TP53, MDM2, NQO1 and susceptibility to cervical cancer. Cancer Epidemiol Biomarkers Prev. 19:755–761. 2010. View Article : Google Scholar : PubMed/NCBI | |
|
Santos AM, Sousa H, Catarino R, Pinto D, Pereira D, Vasconcelos A, Matos A, Lopes C and Medeiros R: TP53 codon 72 polymorphism and risk for cervical cancer in Portugal. Cancer Genet Cytogenet. 159:143–147. 2005. View Article : Google Scholar : PubMed/NCBI | |
|
Dokianakis DN and Spandidos DA: P53 codon 72 polymorphism as a risk factor in the development of HPV-associated cervical cancer. Mol Cell Biol Res Commun. 3:111–114. 2000. View Article : Google Scholar : PubMed/NCBI | |
|
Sousa H, Santos AM, Pinto D and Medeiros R: Is there a biological plausability for p53 codon 72 polymorphism influence on cervical cancer development? Acta Med Port. 24:127–134. 2011.PubMed/NCBI | |
|
Hrstka R, Coates PJ and Vojtesek B: Polymorphisms in p53 and the p53 pathway: Roles in cancer susceptibility and response to treatment. J Cell Mol Med. 13:440–453. 2009. View Article : Google Scholar : PubMed/NCBI | |
|
Dahabreh IJ, Schmid CH, Lau J, Varvarigou V, Murray S and Trikalinos TA: Genotype misclassification in genetic association studies of the rs1042522 TP53 (Arg72Pro) polymorphism: A systematic review of studies of breast, lung, colorectal, ovarian and endometrial cancer. Am J Epidemiol. 177:1317–1325. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Bojesen SE and Nordestgaard BG: The common germline Arg72Pro polymorphism of p53 and increased longevity in humans. Cell Cycle. 7:158–163. 2008. View Article : Google Scholar : PubMed/NCBI | |
|
Bergamaschi D, Gasco M, Hiller L, Sullivan A, Syed N, Trigiante G, Yulug I, Merlano M, Numico G, Comino A, et al: p53 polymorphism influences response in cancer chemotherapy via modulation of p73-dependent apoptosis. Cancer Cell. 3:387–402. 2003. View Article : Google Scholar : PubMed/NCBI | |
|
Liu JH, Xi P, Chai YL, Wang J, Wang T, Liu Z and Dai PG: Association of DNA repair gene polymorphisms with response to cisplatin-based concurrent chemoradiotherapy in patients with cervical carcinoma. DNA Repair (Amst). 41:69–72. 2016. View Article : Google Scholar : PubMed/NCBI | |
|
Piña-Sánchez P, Hernández-Hernández DM, Taja-Chayeb L, Cerda-Flores RM, González-Herrera AL, Rodea-Avila C, Apresa-García T, Ostrosky-Wegman P, Vázquez-Ortíz G, Mendoza-Lorenzo P, et al: Polymorphism in exon 4 of TP53 gene associated to HPV 16 and 18 in Mexican women with cervical cancer. Med Oncol. 28:1507–1513. 2011. View Article : Google Scholar : PubMed/NCBI | |
|
Eisenhauer EA, Therasse P, Bogaerts J, Schwartz LH, Sargent D, Ford R, Dancey J, Arbuck S, Gwyther S, Mooney M, et al: New response evaluation criteria in solid tumours: Revised RECIST guideline (version 1.1). Eur J Cancer. 45:228–247. 2009. View Article : Google Scholar : PubMed/NCBI | |
|
Sousa H, Santos AM, Pinto D and Medeiros R: Is the p53 codon 72 polymorphism a key biomarker for cervical cancer development? A meta-analysis review within European populations. Int J Mol Med. 20:731–741. 2007.PubMed/NCBI | |
|
Papadakis ED, Soulitzis N and Spandidos DA: Association of p53 codon 72 polymorphism with advanced lung cancer: The Arg allele is preferentially retained in tumours arising in Arg/Pro germline heterozygotes. Br J Cancer. 87:1013–1018. 2002. View Article : Google Scholar : PubMed/NCBI | |
|
Hollingworth R and Grand RJ: Modulation of DNA damage and repair pathways by human tumour viruses. Viruses. 7:2542–2591. 2015. View Article : Google Scholar : PubMed/NCBI | |
|
Rassool FV and Tomkinson AE: Targeting abnormal DNA double strand break repair in cancer. Cell Mol Life Sci. 67:3699–3710. 2010. View Article : Google Scholar : PubMed/NCBI | |
|
Johnstone RW, Ruefli AA and Lowe SW: Apoptosis: A link between cancer genetics and chemotherapy. Cell. 108:153–164. 2002. View Article : Google Scholar : PubMed/NCBI | |
|
Martinez-Rivera M and Siddik ZH: Resistance and gain-of-resistance phenotypes in cancers harboring wild-type p53. Biochem Pharmacol. 83:1049–1062. 2012. View Article : Google Scholar : PubMed/NCBI | |
|
Petitjean A, Achatz MI, Borresen-Dale AL, Hainaut P and Olivier M: TP53 mutations in human cancers: Functional selection and impact on cancer prognosis and outcomes. Oncogene. 26:2157–2165. 2007. View Article : Google Scholar : PubMed/NCBI | |
|
Medeiros R, Prazeres H, Pinto D, Macedo-Pinto I, Lacerda M, Lopes C and Cruz E: Characterization of HPV genotype profile in squamous cervical lesions in Portugal, a southern European population at high risk of cervical cancer. Eur J Cancer Prev. 14:467–471. 2005. View Article : Google Scholar : PubMed/NCBI | |
|
Dong M, Nio Y, Yamasawa K, Toga T, Yue L and Harada T: p53 alteration is not an independent prognostic indicator, but affects the efficacy of adjuvant chemotherapy in human pancreatic cancer. J Surg Oncol. 82:111–120. 2003. View Article : Google Scholar : PubMed/NCBI | |
|
Wu WJ, Kakehi Y, Habuchi T, Kinoshita H, Ogawa O, Terachi T, Huang CH, Chiang CP and Yoshida O: Allelic frequency of p53 gene codon 72 polymorphism in urologic cancers. Jpn J Cancer Res. 86:730–736. 1995. View Article : Google Scholar : PubMed/NCBI | |
|
Wang YC, Chen CY, Chen SK, Chang YY and Lin P: p53 codon 72 polymorphism in Taiwanese lung cancer patients: Association with lung cancer susceptibility and prognosis. Clin Cancer Res. 5:129–134. 1999.PubMed/NCBI | |
|
Xu Y, Yao L, Ouyang T, Li J, Wang T, Fan Z, Lin B, Lu Y and Xie Y: p53 Codon 72 polymorphism predicts the pathologic response to neoadjuvant chemotherapy in patients with breast cancer. Clin Cancer Res. 11:7328–7333. 2005. View Article : Google Scholar : PubMed/NCBI | |
|
Sullivan A, Syed N, Gasco M, Bergamaschi D, Trigiante G, Attard M, Hiller L, Farrell PJ, Smith P, Lu X and Crook T: Polymorphism in wild-type p53 modulates response to chemotherapy in vitro and in vivo. Oncogene. 23:3328–3337. 2004. View Article : Google Scholar : PubMed/NCBI | |
|
Tommiska J, Eerola H, Heinonen M, Salonen L, Kaare M, Tallila J, Ristimäki A, von Smitten K, Aittomäki K, Heikkilä P, et al: Breast cancer patients with p53 Pro72 homozygous genotype have a poorer survival. Clin Cancer Res. 11:5098–5103. 2005. View Article : Google Scholar : PubMed/NCBI | |
|
Starinsky S, Figer A, Ben-Asher E, Geva R, Flex D, Fidder HH, Zidan J, Lancet D and Friedman E: Genotype phenotype correlations in Israeli colorectal cancer patients. Int J Cancer. 114:58–73. 2005. View Article : Google Scholar : PubMed/NCBI | |
|
Pietsch EC, Humbey O and Murphy ME: Polymorphisms in the p53 pathway. Oncogene. 25:1602–1611. 2006. View Article : Google Scholar : PubMed/NCBI | |
|
Bonafé M, Ceccarelli C, Farabegoli F, Santini D, Taffurelli M, Barbi C, Marzi E, Trapassi C, Storci G, Olivieri F and Franceschi C: Retention of the p53 codon 72 arginine allele is associated with a reduction of disease-free and overall survival in arginine/proline heterozygous breast cancer patients. Clin Cancer Res. 9:4860–4864. 2003.PubMed/NCBI | |
|
Storey A, Thomas M, Kalita A, Harwood C, Gardiol D, Mantovani F, Breuer J, Leigh IM, Matlashewski G and Banks L: Role of a p53 polymorphism in the development of human papillomavirus-associated cancer. Nature. 393:229–234. 1998. View Article : Google Scholar : PubMed/NCBI | |
|
Chansaenroj J, Theamboonlers A, Junyangdikul P, Swangvaree S, Karalak A, Chinchai T and Poovorawan Y: Polymorphisms in TP53 (rs1042522), p16 (rs11515 and rs3088440) and NQO1 (rs1800566) genes in thai cervical cancer patients with HPV 16 infection. Asian Pac J Cancer Prev. 14:341–346. 2013. View Article : Google Scholar : PubMed/NCBI | |
|
Santos AM, Sousa H, Pinto D, Portela C, Pereira D, Catarino R, Duarte I, Lopes C and Medeiros R: Linking TP53 codon 72 and P21 nt590 genotypes to the development of cervical and ovarian cancer. Eur J Cancer. 42:958–963. 2006. View Article : Google Scholar : PubMed/NCBI | |
|
Peralta-Zaragoza O, Bermúdez-Morales VH, Pérez-Plasencia C, Salazar-León J, Gómez-Cerón C and Madrid-Marina V: Targeted treatments for cervical cancer: A review. Onco Targets Ther. 5:315–328. 2012. View Article : Google Scholar : PubMed/NCBI | |
|
Wallace NA and Galloway DA: Manipulation of cellular DNA damage repair machinery facilitates propagation of human papillomaviruses. Semin Cancer Biol. 26:30–42. 2014. View Article : Google Scholar : PubMed/NCBI | |
|
Schneider-Stock R, Mawrin C, Motsch C, Boltze C, Peters B, Hartig R, Buhtz P, Giers A, Rohrbeck A, Freigang B and Roessner A: Retention of the arginine allele in codon 72 of the p53 gene correlates with poor apoptosis in head and neck cancer. Am J Pathol. 164:1233–1241. 2004. View Article : Google Scholar : PubMed/NCBI | |
|
Matakidou A, El Galta R, Webb EL, Rudd MF, Bridle H, Eisen T and Houlston RS: GELCAPS Consortium: Lack of evidence that p53 Arg72Pro influences lung cancer prognosis: An analysis of survival in 619 female patients. Lung Cancer. 57:207–212. 2007. View Article : Google Scholar : PubMed/NCBI |
