p53 protein expression affected by TP53 polymorphism is associated with the biological behavior and prognosis of low rectal cancer

  • Authors:
    • Guangzhe Zhang
    • Qian Xu
    • Zeyang Wang
    • Liping Sun
    • Zhi Lv
    • Jingwei Liu
    • Chengzhong Xing
    • Yuan Yuan
  • View Affiliations

  • Published online on: October 18, 2019     https://doi.org/10.3892/ol.2019.10999
  • Pages: 6807-6821
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Low rectal cancer is a subtype of colorectal cancer at a special anatomic site with distinct biological behavior. TP53 is one of the most important cancer suppressor genes, and its structural variation and abnormal expression has been revealed to be associated with multiple cancer types. However, to the best of our knowledge, the association of p53 protein expression with its gene polymorphism, biological behavior and prognosis in low rectal cancer has not been clarified. Therefore, the current study aimed to explore these associations. In the present study, 347 patients with low rectal cancer and 353 controls were enrolled. Kompetitive Allele‑Specific Polymerase Chain Reaction was used to detect five polymorphic sites of the TP53 gene (rs1042522, rs12947788, rs1625895, rs2909430 and rs12951053), while immunohistochemistry was used to detect the protein expression of TP53. The associations between p53 protein expression and TP53 polymorphism, biological behavior and prognosis in low rectal cancer were systematically analyzed. In low rectal cancer, p53 protein expression was markedly higher in TP53 rs1042522 mutant carriers compared with that in other genotypes where expression was higher in poorly differentiated, III‑IV phase and T3‑4 phase tumors, and in III‑IV phase female patients. The survival time of patients with low p53 protein expression was evidently longer in females, non‑smokers and patients >60 years old. In summary, p53 protein expression was identified to be affected by TP53 rs1042522 polymorphism, and was associated with the biological behavior and prognosis of low rectal cancer. TP53 rs1042522 and the associated protein expression could be used as indicators for biological behavior and prognosis in low rectal cancer.

Introduction

Low rectal cancer (LRC) is located in an area that is 6–8 cm away from the rectum (1). LRC is a type of colorectal cancer that occurs at a specific anatomical site and exhibits a specific biological behavior. Compared with middle and upper rectal cancer, LRC possesses different pathological types, clinical outcomes and surgical options (2,3). Despite advancements in treatment options for LRC and an improved understanding of its biological characteristics, LRC remains a challenge to human health due to its high local recurrence risk (4). The accurate classification of molecular phenotype may significantly contribute to monitoring the biological behavior of LRC and improve the personalized prognosis for the disease.

The TP53 gene, located at the 17p13.1 locus of the short arm of the human chromosome, covers an overall length of 16–20 kb and consists of 11 exons and 10 introns (5). The TP53 gene encodes an intranuclear phosphorylated protein that consists of 393 amino acids, with a 25-kb mRNA transcription product (6,7). Wild-type TP53 is a cancer suppressor gene that serves a crucial role in multiple cellular processes, including the cell cycle, cell apoptosis, cell aging, gene stability and the inhibition of angiogenesis (810). By contrast, mutated TP53 can stimulate cell division and function as an oncogene. It is well understood that mutation of the TP53 gene and dysfunction of the TP53 pathway is a characteristic hallmark of various types of human malignancy (11). In addition to mutations, polymorphisms in the TP53 gene may occur in coding and non-coding sequences. According to previous studies, at least eight polymorphic sites have been detected in the promoter region of the TP53 gene, as well as in the first, second, third, sixth, seventh and tenth intron regions, and in the seventh exon region. Among these polymorphisms, three polymorphic sites have been associated with genetic susceptibility to multiple cancer types. These include a CD72 Arg/Pro polymorphism, a repetitive sequence inserted in 16 bp of the third intron region and a polymorphism of the restriction enzyme digestion site of MspI in the sixth intron (1214). As one of these functional TP53 single nucleotide polymorphisms (SNPs), the CD72 Arg/Pro polymorphism (rs1042522) has been studied in colon cancer. One study reported that there was no evident association between rs1042522 and colorectal cancer (15), while two study groups identified that the rs1042522 polymorphic genotype was associated with increased colon cancer risk (16,17).

With structural variation of the TP53 gene, abnormal protein expression of p53 has also been revealed to be associated with multiple cancer types, including colorectal cancer. A literature review revealed that the overexpression of p53 is an independent predictor for cancer survival (18). However, another study did not identify a prognostic value of p53 in colorectal cancer (19). A further study demonstrated that p53 protein expression is associated with short-term prognosis in colorectal cancer, since a significant association between p53 expression and rectal carcinoma was identified and the percentage of p53 positive cells was associated with clinicopathological variables (20).

Although the association between p53 and colorectal cancer has been studied for a number of years, the majority of previous studies failed to investigate colorectal cancer based on the position of the lesion site or only divided colorectal cancer into colon cancer and rectum cancer. Furthermore, the conclusions of these previous studies have been contradictory. To the best of our knowledge, the association between p53 and LRC has not been investigated in previous studies. Therefore, it remains unclear whether p53 protein expression is associated with TP53 gene polymorphisms in LRC, and whether p53 protein expression is associated with the biological behavior and prognosis of LRC.

Based on patients with or without LRC, associations between the five most common polymorphic sites of the TP53 gene (rs1042522, rs12947788, rs1625895, rs2909430 and rs12951053) and p53 protein expression were investigated in the present study. In addition, the associations between p53 protein expression and biological behavior and the prognosis of LRC were systematically studied. The overall aim of the current study was to provide information that may be useful for the development of individualized therapeutic strategies prior to surgery, and to improve the biological behavior and prognosis of patients with LRC in clinical practice.

Materials and methods

Patients

The current study was approved by the Medical Ethics Committee of the First Hospital of China Medical University (Shenyang, China) and written informed consent for use of samples was obtained from all participants. A total of 347 patients diagnosed with LRC (within 8 cm from the anal verge), treated by surgery at the Department of Anus and Intestine Surgery of the First Hospital of China Medical University (Shenyang, China) between December 2011 and June 2016, were included in the present study. A total of 353 patients with an anal benign lesion, but no colorectal cancer, as determined by colonoscopy and rectal examination, were hospitalized during the same period and used as controls. The mean ages of patients with LRC and patients with an anal benign lesion were 61.4±11.0 and 59.6±14.4 years, respectively. The sex distribution (male vs. female) in patients group and control group were 203:144 and 185:168, respectively.

The inclusion criteria were as follows: i) Rectal cancer diagnosed within 8 cm of the anal verge; and ii) age >18 years old. The clinical diagnostic criteria for LRC were defined according to the literature (21). The exclusion criteria were as follows: i) Patients with an immune system disease; ii) patients with an infectious disease; iii) patients with primary tumors on other visceral organs prior to surgery; and iv) patients who received neoadjuvant chemoradiotherapy prior to surgery.

Sample and patient history collection

The peripheral blood of each individual included in the present study was collected prior to surgery for patients or prior to colonoscopy for controls for genomic DNA extraction. Each sample was immediately frozen and kept at −80°C until further use. The basic information of each individual was collected using a questionnaire, which included their sex, age, and smoking status and alcohol consumption. Data regarding the Tumor-Node-Metastasis (TNM) system classification, depth of invasion, growth pattern, histological type, paracancerous lymphocyte infiltration status, peripheral ganglion violation status, cancer embolus in vascularization, lymph node metastasis and implantation in extra nodes were extracted from the medical records of patients with LRC. The overall survival (OS) of individuals following diagnosis or treatment was assessed until August 2016.

Candidate TP53 gene SNP selection

To explore the association between TP53 gene polymorphisms and p53 protein expression, a total of 5 SNPs (rs1042522, rs12947788, rs1625895, rs2909430 and rs12951053) with a minimum allele frequency <5% in the Chinese population were selected based on the tagging information from the NCBI dbSNP (https://www.ncbi.nlm.nih.gov/snp) and International HapMap Project (www.hapmap.org) in 2016.

Kompetitive allele-specific polymerase chain reaction (KASP™) genotyping assay

Genomic DNA was prepared from peripheral blood mononuclear cells collected from patients using the QIAamp DNA Blood Mini kit (Qiagen China Co., Ltd., Shanghai, China) according to the manufacture's protocol and stored at −80°C. SNP genotyping was performed applying KASP with an SNPLine platform (LGC Genomics). The steps of the PCR were as follows: i) The extracted DNA samples were diluted in 30 µl TE buffer (concentration ≥60 ng/µl) in 96-well plates, and transferred into 384-well plates and 1536-well plates by Replikator (final concentration ~10 ng/µl); ii) the 1536-well plates containing DNA samples were dried in an oven at 65°C for 30 min; iii) the PCR reaction system (1 µl) was constructed and the sequences of primers used were presented in Table I; iv) plates with reaction system were sealed and centrifuged at 12,000 × g; v) PCR was performed in water bath after centrifugation according to the thermal cycling conditions presented in Table II; vi) plates with completed reaction were cooled down and read with a microplate reader Pherastar (BMG Labtech GmbH); and vii) additional PCR would be performed to double check the genotyping results if necessary.

Table I.

Sequences of the primers used for the Kompetitive allele specific polymerase chain reaction.

Table I.

Sequences of the primers used for the Kompetitive allele specific polymerase chain reaction.

SNPsPrimer sequences
rs1042522
  Forward GGGTCTTACGGTCTCCGACGAGGGG
  Reverse GCACCGGGGACGTGGTCGTCGAGGA
rs12947788
  Forward CCTCTGCTTGCCTCTGACCCCTGGG
  Reverse CCACCTCTTACCGATTTCTTCCATA
rs1625895
  Forward ATTCCCACCAACAGTCACCGGGAGG
  Reverse CCACTCGTCATCCCCCCGAAAGAGG
rs2909430
  Forward GATCACCCAACGTCCTCCACGAATG
  Reverse GTACAAACAAAGAAACGACGGCAGA
rs12951053
  Forward CTGGGCCCACCTCTTACCGATTTCT
  Reverse CCATACTACTACCCATCCACCTCTC

Table II.

Thermocycling conditions for the polymerase chain reaction.

Table II.

Thermocycling conditions for the polymerase chain reaction.

StepsTemperatureDurationNumber of cycles
1
  Activation94°C15 min  1
2
  Denaturation94°C20 sec10
  Annealing/Elongation55-61°C60 sec
3
  Denaturation94°C20 sec26
Annealing/Elongation55°C60 sec
Immunohistochemistry assay

Tissue specimens were fixed with 10% formalin at room temperature for 24 h and embedded with paraffin and cut into 4-µm sections. Immunohistochemical staining was performed using Ultra Sensitive™ SP kit (cat. no. KIT-9709/9719; Maixin, Fuzhou, China) according to the manufacturer's protocol. Sections were deparaffinized and rehydrated through ethanol gradient (100, 95 and 75% ethanol for 5 min each), incubated in 10 mM citrate buffer (pH 6.0) and heated in a microwave oven for 5 min. After cooling, slides were incubated with blocker of endogenous peroxidase activity (buffer A in the kit) at room temperature for 1 h, and blocked with normal goat serum (one drop; buffer B in the kit) for 30 min at room temperature. Sections were washed with PBS, incubated with anti-p53 rabbit polyclonal antibody (1:100; cat. no. ab131442; Abcam, Cambridge, UK) for 1 h r at room temperature, with biotin-conjugated secondary antibody (one drop, buffer C in the kit) for 10 min at room temperature, and with HPR-Streptomycin (one drop, buffer D in the kit) for 10 min at room temperature. Signal was visualized with the 3′-diaminobenzidine visualization kit. (cat. no. dab-0031; Fuzhou Maixin Biotech Co., Ltd.). Slides were observed with an inverted microscopy (Olympus Corporation, Tokyo, Japan).

p53 protein expression was independently read and scored by two pathologists, in accordance with the double-blind principle. A senior pathologist was consulted with regard to inconsistent scores in order to arrive at a consensus. Positive p53 protein expression was located in the nuclei of cancer cells and appeared as stronger brown granules under a microscope with high magnification (×40). Subsequently, the positive p53 protein expression area was detected under a microscope with low magnification (×10). A total of 10 fields of each slide were randomly selected under a microscope with high magnification and 100 cancer cells were counted in each field. The percentage of cancer cells with positive p53 protein expression was calculated. The scores for positive p53 expression were determined according to the percentage of p53-positive cells in each sample as follows: Negative, <10%; positive +, 10–30%); ++, 30–50%; and +++, 50–100%.

Statistical analysis

Statistical analysis was performed using SPSS 20.0 software (IBM Corp., Armonk, NY, USA). Independent sample t-test was used to compare the differences between two groups, and one-way ANOVA followed by Tukey post-hoc analysis was used to compare the differences among multiple groups (>2). Parameters that reflected the behavior and prognosis of LRC in each genotype were represented by hazard ratios (HR) and 95% confidence intervals (CIs). The HR values were calculated by multivariate Cox proportional hazards regression analysis. The χ2 test was used to evaluate the association between TP53 gene polymorphism and p53 protein expression, or between p53 protein expression and the clinical pathological parameters of LRC. The log-rank test was used to compare the survival times between the groups. P<0.05 was considered to indicate a statistically significant difference.

Results

Association between TP53 gene polymorphism and p53 protein expression

To study the influence of TP53 gene polymorphism on the protein expression of p53, five polymorphic loci of the TP53 gene (rs1042522, rs12947788, rs1625895, rs2909430 and rs12951053) and the protein expression level of p53 in the 347 patients diagnosed with LRC were detected. Results revealed that the TP53 rs1042522 polymorphism was associated with p53 protein expression [CG (heterozygous) vs. GG (mutant), P=0.027; CC (wide-type) + CG vs. GG, P=0.032], indicating that positive p53 protein expression was significantly higher compared with other genotypes in the heterozygous and dominant models (Table III and Fig. 1). The other four polymorphic loci were not identified to be associated with p53 protein expression.

Table III.

Associations between polymorphisms of the TP53 gene and p53 protein expression.

Table III.

Associations between polymorphisms of the TP53 gene and p53 protein expression.

GenotypeHeterozygous vs.wild-typeMutant vs. wild-typeDominant modelRecessive model





p53 protein expressionWild-type, nHeterozygous, nMutant, nP-valueP-valueP-valueP-value
rs1042522 0.0270.2390.0320.905
  Positive6413549
  Negative374319
rs12947788 0.2030.9900.2780.659
  Positive9712526
  Negative454212
rs1625895 0.280
  Positive22127
  Negative927
rs2909430 0.204
  Positive21632
  Negative918
rs12951053 0.1540.7870.1910.905
  Positive11610824
  Negative543510
Protein expression of p53 is associated with the biological characteristics of LRC

In the present study, the association between time survival and clinicopathological parameters of LRC, including TNM classification, depth of invasion, histological type, paracancerous lymphocyte infiltration, ganglion infiltration, vascular cancer embolus, lymph node metastasis and extranodal implantation status were analyzed (Table IV). The χ2 test revealed that the protein expression of p53 was not significantly associated with the clinicopathological parameters in the whole population (Table V). However, following stratification of the patients by classic risk factors, including sex, age, smoking status and alcohol consumption, the results revealed a significant association between the protein expression of p53 and the clinicopathological parameters of LRC. In female patients, the protein expression of p53 in stage III–IV was significantly higher compared with that in stage I–II (P=0.044). Furthermore, in patients with an age ≥60 years, histological type, TNM stage and depth of tumor invasion were all associated with the protein expression of p53 (P=0.002, P=0.049 and P=0.034, respectively). The protein expression of p53 was significantly higher in poorly-differentiated tumors compared with well-differentiated tumors, in stage III–IV compared with stage I–II, and in the T3-4 stage compared with the T1-2 stage. In patients with a history of smoking, the p53 protein expression was significantly associated with the occurrence of lymph node metastasis (P=0.032). In contrast to smokers, the p53 protein expression level in poorly-differentiated tumors was significantly higher compared with well-differentiated tumors in non-smokers (P=0.047; Table VI).

Table IV.

Clinical characteristics and overall survival time of patients with low rectal cancer.

Table IV.

Clinical characteristics and overall survival time of patients with low rectal cancer.

CharacteristicLow rectal cancer, nMortality, nMedian survival timeP-value
Sex30444 0.193
  Male1782938.504
  Female1261538.908
Age, years30444 0.827
  ≤601382039.656
  >601662438.362
TNM stage30344 3.246×10−10
  I–II181843.197
  III–IV1223633.081
Depth of infiltration30444 0.003
  T1+T287442.988
  T3+T42174037.261
Lymph node metastasis30344 2.406×10−11
  Negative193843.288
  Positive1103632.490
Histological type30444 4.1911×10−8
  Well-differentiated1951342.412
  Poorly differentiated1093132.060
Peripheral lymphocyte infiltration28341 0.619
  Negative24440.125
  Positive2593735.165
Peripheral ganglion violation26639 0.002
  Negative72438.586
  Positive1943532.952
Vascular cancer embolus29344 0.001
  Negative2222540.574
  Positive711933.467
Implantation in extra nodes26439 <0.001
  Negative2463035.886
  Positive18923.202

[i] TNM, Tumor-Node-Metastasis.

Table V.

Overall association analysis between p53 protein expression and characteristics of low rectal cancer.

Table V.

Overall association analysis between p53 protein expression and characteristics of low rectal cancer.

p53 protein expressionp53 protein expression level


Characteristic (n)Positive, nNegative, nP-value+++, n++, n+, n-, nP-value
Lymph node metastasis (n=346) 0.851 0.182
  Positive10039 6630439
  Negative14760 97331660
Histological type (n=347) 0.990 0.056
  Well-differentiated15863 114321163
  Poorly differentiated9036 5031936
TNM stage (n=347) 0.879 0.304
  III–IV10844 7231544
  I–II14055 92321555
Depth of infiltration (n=347) 0.254 0.165
  T3+T412757 8237757
  T1+T212247 83261342
Growth mode (n=347) 0.384 0.308
  Nested growth14352 9341952
  Infiltration growth10547 71221147
Vascular cancer embolus (n=336) 0.368 0.672
  Positive5827 3817327
  Negative18467 124451467
Extranodal implantation (n=305) 0.507 0.685
  Positive137 10307
  Negative20580 137521580
Ganglion violation (n=307) 0.595 0.260
  Positive16367 11143867
  Negative5720 3713720
Peripheral lymphatic infiltration (n=326) 0.454 0.829
  Positive21487 146521587
  Negative169 10519

[i] TNM, Tumor-Node-Metastasis.

Table VI.

Stratified association analysis between p53 protein expression and characteristics of low rectal cancer.

Table VI.

Stratified association analysis between p53 protein expression and characteristics of low rectal cancer.

A, Male sex

p53 protein expressionp53 protein expression level


CharacteristicPositive, nNegative, nP-value+++, n++, n+, n-, nP-value
Lymph node metastasis 0.412 0.567
  Positive5726 4214126
  Negative8831 6022531
Histological type 0.171 0.136
  Well-differentiated9732 7319432
  Poorly differentiated4925 3017225
TNM stage
  III–IV6228 4813128
  I–II8429 5523529
Depth of infiltration 0.755 0.317
  T3+T48133 5424233
  T1+T26524 4912424
Growth mode 0.857 0.057
  Nested growth8432 5726132
  Infiltration growth6225 4610525
Vascular cancer embolus 0.506 0.447
  Positive3516 2212116
  Negative10839 8023439
Extranodal implantation 0.786 0.934
  Positive94 7204
  Negative12045 8530445
Ganglion violation 0.335 0.335
  Positive9840 6827240
  Negative339 25629
Peripheral lymphatic infiltration 0.325 0.582
  Positive12649 916249
  Negative96 83046

B, Female sex

p53 protein expressionp53 protein expression level


CharacteristicPositive, nNegative, nP-value+++, n++, n+, n-, nP-value

Lymph node metastasis 0.210 0.054
  Positive4313 2416  313
  Negative5929 37111129
Histological type 0.112 0.104
  Well-differentiated6131 4113  731
  Poorly differentiated4111 2014  711
TNM stage
  III–IV4616 2418  416
  I–II5626 3791026
Depth of infiltration 0.155 0.458
  T3+T44524 2713  524
  T1+T25718 3414  918
Growth mode 0.262 0.717
  Nested growth5920 3615  820
  Infiltration growth4322 2512  622
Vascular cancer embolus 0.542 0.716
  Positive2311 165  211
  Negative7628 44221028
Extranodal implantation 0.442 0.773
  Positive43 31  03
  Negative8535 52221135
Ganglion violation 0.819 0.423
  Positive6527 4316  627
  Negative2411 127  511
Peripheral lymphatic infiltration 0.992 0.294
  Positive8838 55221138
  Negative73 24  13

C, Age ≥60 years

p53 protein expressionp53 protein expression level


CharacteristicPositive, nNegative, nP-value+++, n++, n+, n-, nP-value

Lymph node metastasis 0.212 0.166
  Positive5023 3316123
  Negative9529 6422929
Histological type 0.127 0.002
  Well-differentiated9628 7316728
  Poorly differentiated5024 2522324
TNM stage 0.073 0.049
  III–IV5527 3618127
  I–II staging9125 6220925
Depth of infiltration 0.130 0.034
  T3+T47232 4425332
  T1+T27420 5413720
  Growth mode 0.729 0.227
  Nested growth8331 5525331
  Infiltration growth6321 4313721
Vascular cancer embolus 0.158 0.482
  Positive2915 208115
  Negative11435 7729835
Extranodal implantation 0.199 0.529
  Positive54 3204
  Negative12542 8532842
Ganglion violation 0.107 0.205
  Positive9338 6326438
  Negative398 26948
Peripheral lymphatic infiltration 0.336 0.551
  Positive13046 9033746
  Negative64 4114

D, Age <60 years

p53 protein expressionp53 protein expression level


CharacteristicPositive, nNegative, nP-value+++, n++, n+, n-, nP-value

Lymph node metastasis 0.087 0.166
  Positive5016 3314316
  Negative5231 3311731
Histological type 0.103 0.184
  Well-differentiated6235 4116435
  Poorly differentiated4012 259612
TNM stage 0.073 0.245
  III–IV5317 3613417
  I–II4930 3012630
Depth of infiltration 0.977 0.760
  T3+T45425 3712425
  T1+T24822 2913622
Growth mode 0.107 0.375
  Nested growth6021 3816621
  Infiltration growth4226 289426
Vascular cancer embolus 0.805 0.855
  Positive2912 189212
  Negative2032 4716632
Extranodal implantation 0.737 0.585
  Positive83 7103
  Negative8038 5220738
Ganglion violation 0.270 0.358
  Positive7029 4817429
  Negative1812 114312
Peripheral lymphatic infiltration 0.967 0.554
  Positive8441 5619841
  Negative105 6405

E, Smoker

p53 protein expressionp53 protein expression level


CharacteristicPositive, nNegative, nP-value+++, n++, n+, n-, nP-value

Lymph node metastasis 0.032 0.095
  Positive2616 187116
  Negative5413 408513
  Histological type 0.198 0.608
  Well-differentiated5817 4310417
  Poorly differentiated2312 165212
TNM stage
  III–IV3116 246116
  I–II5013 359513
Depth of infiltration 0.135 0.375
  T3+T44019 307219
  T1+T24110 298410
Growth mode 0.608 0.381
  Nested growth4317 2911317
  Infiltration growth3812 304312
Vascular cancer embolus 0.882 0.114
  Positive186 10716
  Negative6122 488422
Extranodal implantation 0.226 0.578
  Positive40 3100
  Negative7026 5113526
Ganglion violation 0.625 0.392
  Positive5420 4011220
  Negative216 14436
Peripheral lymphatic infiltration 0.269 0.642
  Positive7726 5615526
  Negative22 2002

F, Non-smoker

p53 protein expressionp53 protein expression level


CharacteristicPositive, nNegative, nP-value+++, n++, n+, n-, nP-value

Lymph node metastasis 0.102 0.109
  Positive7423 4823  323
  Negative9347 57251147
Histological type 0.400 0.047
  Well-differentiated10046 7122  746
  Poorly-differentiated6724 3426  724
TNM stage
  III–IV7728 4825  428
  I–II9042 57231042
Depth of infiltration 0.695 0.237
  T3+T48638 5130  538
  T1+T28132 5418  932
Growth mode 0.161 0.284
  Nested growth10035 6430  635
  Infiltration growth6735 4118  835
Vascular cancer embolus 0.259 0.529
  Positive4021 2810  221
  Negative12345 76371045
Extranodal implantation 0.202 0.478
  Positive97 72  07
  Negative13554 86391054
Ganglion violation 0.774 0.676
  Positive10947 7132  647
  Negative3614 239  414
Peripheral lymphatic infiltration 0.812 0.912
  Positive13761 90371061
  Negative147 85  17

G, Alcohol consumption

p53 protein expressionp53 protein expression level


CharacteristicPositive, nNegative, nP-value+++, n++, n+, n-, nP-value

Lymph node metastasis 0.816 0.499
  Positive114 74  04
  Negative219 163  19
Histological type 0.458 0.243
  Well-differentiated248 19408
  Poorly differentiated95 5315
TNM stage
  III–IV124 8404
  I–II219 16319
Depth of infiltration 0.818 0.718
  T3+T4197 14407
  T1+T2146 10316
Growth mode 0.818 0.575
  Nested growth197 14507
  Infiltration growth146 10216
Vascular cancer embolus 0.452 0.363
  Positive82 5302
  Negative2311 183111
Extranodal implantation 0.220 0.496
  Positive30 2100
  Negative2513 194113
Ganglion violation 0.226 0.130
  Positive238 17508
  Negative65 5015
Peripheral lymphatic infiltration 0.314 0.613
  Positive2513 194113
  Negative20 2000

H, No alcohol consumption

p53 protein expressionp53 protein expression level


CharacteristicPositive, nNegative, nP-value+++, n++, n+, n-, nP-value

Lymph node metastasis 0.912 0.275
  Positive8935 5926  435
  Negative12651 81301551
Histological type 0.792 0.127
  Well-differentiated13455 95281155
  Poorly differentiated8131 4528  831
TNM stage
  III–IV9640 6427  540
  I–II11946 76291446
Depth of infiltration 0.189 0.166
  T3+T410750 6733  750
  T1+T210836 73231236
Growth mode 0.398 0.455
  Nested growth12445 7936  945
  Infiltration growth9141 61201041
Vascular cancer embolus 0.209 0.608
  Positive5025 3314  325
  Negative16156 106421356
Extranodal implantation 0.212 0.461
  Positive107 82  07
  Negative18067 118481467
Ganglion violation 0.277 0.349
  Positive14059 9438  859
  Negative5115 3213  615
Peripheral lymphatic infiltration 0.265 0.599
  Positive18974 127481474
  Negative149 85  19

[i] TNM, Tumor-Node-Metastasis.

p53 protein expression is associated with the prognosis of LRC

To further determine whether p53 protein expression is an independent prognostic factor for LRC, univariate and multivariate Cox proportional hazards regression analyses were conducted (Table VII). Univariate survival analysis revealed a significant association between the protein expression of p53 and the OS for LRC; the survival time of patients with low p53 expression was significantly longer compared with that of patients with high p53 expression [hazard ratio (HR), 2.071; 95% CI, 1.083–3.958; P=0.028]. However, the multivariate survival analysis revealed that the protein expression level of p53 was no longer associated with the survival time in all patients with LRC (HR, 1.580; 95% CI, 0.791–3.154; P=0.195) (Table VII). Following stratification of the patients according to risk factors of LRC, including sex, age, smoking status and drinking status, the results revealed that the survival time of patients with low p53 protein expression was significantly longer compared with patients with high p53 protein expression in female patients (HR, 3.280; 95% CI, 1.043–10.311; P=0.042) and non-smokers (HR, 2.724; 95% CI, 1.223–6.066; P=0.014). Multivariate analysis for patients with an age ≥60 years revealed that patients with low p53 protein expression had a longer survival time compared with patients with high p53 protein expression (P=0.021; HR, 3.425; 95% CI, 1.208–9.712).

Table VII.

Association analysis between p53 protein expression and the prognosis of low rectal cancer.

Table VII.

Association analysis between p53 protein expression and the prognosis of low rectal cancer.

A, Overall analysis

UnivariateMultivariate


p53 protein expressionLow rectal cancer, nMortality, nMedian survival time, monthsP-valueHR95% CIP-valueHR95% CI
Low expression1371341.235 1 (ref.) 1 (ref)
High expression1673137.1370.0282.0711.083–3.9580.1951.5800.791–3.154

B, Stratification analysis

Univariate Multivariate


p53 protein expressionLow rectal cancer, nMortality, nMedian survival time, monthsP-valueHR95% CIP-valueHR95% CI

Sex
  Male
    Low expression71939.821 1 (ref.) 1 (ref.)
    High expression1072036.8900.3121.5010.683–3.2980.7501.1530.481–2.764
  Female
    Low expression66440.939 1 (ref.) 1 (ref.)
    High expression601136.6940.0423.2801.043–10.3110.1392.8900.708–11.792
Age, years
  ≥60
    Low expression71640.783 1 (ref.) 1 (ref.)
    High expression951836.7340.0832.2680.900–5.7160.0213.4251.208–9.712
  <60
    Low expression66740.983 1 (ref.) 1 (ref.)
    High expression721336.8190.1821.8710.745–4.6960.8480.9080.339–2.431
Smoking status
  Smoker
    Low expression38538.281 1 (ref.) 1 (ref.)
    High expression56738.2170.8961.0790.342–3.4100.8150.8520.223–3.256
  Non-smoker
    Low expression99841.879 1 (ref.) 1 (ref.)
    High expression1112436.5640.0142.7241.223–6.0660.0812.1850.909–5.254
Alcohol consumption
  Consumption
    Low expression150 1 (ref.) 1 (ref.)
    High expression284 0.37141.0010.132–1.9871.0001.0000.094–10.593
  No consumption
    Low expression1221340.841 1 (ref.) 1 (ref.)
    High expression1392736.9140.0541.9180.990–3.7180.2241.5590.762–3.189

[i] HR, hazard ratio; CI, confidence interval; ref., reference.

Discussion

As a subtype of colorectal cancer at a special anatomical site, LRC is characterized by its specific biological behavior. TP53 is one of the most important cancer suppressor genes, and structural variation and abnormal expression of p53 have been identified to be associated with numerous cancer types (2225). However, the associations between TP53 gene polymorphisms and protein expression, and the association of p53 protein expression with the biological behavior and prognosis of LRC have not been clearly investigated. Understanding these associations is important for the preoperative assessment of LRC and the development of individualized treatments. The present study investigated the associations between TP53 gene polymorphisms and p53 protein expression, and the associations between p53 protein expression and the biological behavior and prognosis of LRC. The overall aim was to address the role of TP53 gene polymorphisms and p53 protein expression in the biological behavior and prognosis of LRC.

Genetic polymorphisms are a common genetic variation, which may affect the expression of proteins and protein function (2629). In the present study, the associations between the five most common TP53 SNPs (rs1042522, rs12947788, rs1625895, rs2909430 and rs12951053) and p53 protein expression were evaluated. The results revealed that the TP53 rs1042522 polymorphism was associated with p53 protein expression, which was evidenced by the significantly higher p53 protein expression in TP53 rs1042522 mutant carriers compared with that in the other genotypes. No associations were identified between p53 protein expression and the other TP53 SNPs. Among the five polymorphic loci selected in the present study, only rs1042522 was located in the exon region, whereas the other four polymorphic loci were located in the intron region. This indicated that the rs1042522 polymorphism may be present in the coding sequence of the TP53 gene, affecting therefore the protein expression of p53 (30). However, this does not indicate that other polymorphisms are not functionally important, since SNPs that are not located in protein coding regions may affect other processes, including gene splicing, which requires further investigation.

Although previous studies have been conducted to investigate the protein expression of p53 and its association with the clinical biological behavior and prognosis of colorectal cancer, results from these studies have been inconsistent. Furthermore, to the best of our knowledge, systematic studies focusing on LRC have not previously been performed. Therefore, the association between p53 expression and LRC at 6–8 cm from the anal margin was investigated in the present study. Overall analysis results revealed that there was no significant association between p53 protein expression and the clinicopathological parameters of LRC. However, following stratification analysis, an association was identified between lymphatic metastasis in smokers and p53 protein expression. Furthermore, histological type, TNM stage and tumor infiltration depth were associated with p53 expression level in patients ≥60 years old. In addition, p53 expression was markedly higher in poorly-differentiated, III–IV phase or T3-4 phase tumors, and a significant association was revealed between p53 expression level and TNM stage in female patients, which was evidently higher in III–IV phase female patients. Additionally, an association was identified between p53 expression and the histological type of LRC among non-smokers.

The survival time of patients with low p53 protein expression was significantly longer in females, non-smokers and patients ≥60 years old. These results indicate that p53 protein expression may be used as an indicator for the prognosis of LRC, particularly for patients ≥60 years old, non-smokers, patients with III–IV phase tumor or female patients with T3-4 phase tumors. Although the exact mechanism requires further exploration, the current findings indicate that p53 protein expression should be regularly screened in the aforementioned subgroups of patients to enable individualized treatments that improve clinical outcomes in future clinical practice.

In conclusion, the TP53 rs1042522 polymorphism affects the p53 protein expression in LRC, and p53 protein expression is associated with the biological behavior and prognosis of LRC. Therefore, the TP53 rs1042522 polymorphism and p53 protein expression may serve as indicators to predict the biological behavior and prognosis of LRC.

Acknowledgements

Not applicable.

Funding

The present study was supported by the National Science and Technology Support Program (grant no. 2015BAI13B07) and the National Key R&D Program (grant no. 2016YFC1303202).

Availability of data and materials

All data generated or analyzed during the present study are included in this published article.

Authors' contributions

YY designed the study. CX, GZ, ZW and LS collected the samples and performed the experiments. QX, ZL and JL performed the statistical analysis. GZ and QX drafted the manuscript. YY revised the manuscript. All authors approved final version of the manuscript.

Ethics approval and consent to participate

This study was approved by the Medical Ethics Committee of the First Hospital of China Medical University (Shenyang, China) and written informed consent was obtained from all participants.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Pachler J and Wille-Jørgensen P: Quality of life after rectal resection for cancer, with or without permanent colostomy. Cochrane Database Syst Rev. 12:CD0043232012.PubMed/NCBI

2 

Sarver AL, Li L and Subramanian S: MicroRNA miR-183 functions as an oncogene by targeting the transcription factor EGR1 and promoting tumor cell migration. Cancer Res. 70:9570–9580. 2010. View Article : Google Scholar : PubMed/NCBI

3 

Liu Y, Zhang H, Zhou K, Chen L, Xu Z, Zhong Y, Liu H, Li R, Shugart YY, Wei Q, et al: Tagging SNPs in non-homologous end-joining pathway genes and risk of glioma. Carcinogenesis. 28:1906–1913. 2007. View Article : Google Scholar : PubMed/NCBI

4 

Liu Y, Zhou K, Zhang H, Shugart YY, Chen L, Xu Z, Zhong Y, Liu H, Jin L, Wei Q, et al: Polymorphisms of LIG4 and XRCC4 involved in the NHEJ pathway interact to modify risk of glioma. Hum Mutat. 29:381–389. 2008. View Article : Google Scholar : PubMed/NCBI

5 

Liu Y, Shete S, Etzel CJ, Scheurer M, Alexiou G, Armstrong G, Tsavachidis S, Liang FW, Gilbert M, Aldape K, et al: Polymorphisms of LIG4, BTBD2, HMGA2, and RTEL1 genes involved in the double-strand break repair pathway predict glioblastoma survival. J Clin Oncol. 28:2467–2474. 2010. View Article : Google Scholar : PubMed/NCBI

6 

Soussi T and Béroud C: Assessing TP53 status in human tumours to evaluate clinical outcome. Nat Rev Cancer. 1:233–240. 2001. View Article : Google Scholar : PubMed/NCBI

7 

Bénard J, Douc-Rasy S and Ahomadegbe JC: TP53 family members and human cancers. Hum Mutat. 21:182–191. 2003. View Article : Google Scholar : PubMed/NCBI

8 

Li D, Suzuki H, Liu B, Morris J, Liu J, Okazaki T, Li Y, Chang P and Abbruzzese JL: DNA repair gene polymorphisms and risk of pancreatic cancer. Clin Cancer Res. 15:740–746. 2009. View Article : Google Scholar : PubMed/NCBI

9 

Liu H and Zhou M: Evaluation of p53 gene expression and prognosis characteristics in uveal melanoma cases. Onco Targets Ther. 10:3429–3434. 2017. View Article : Google Scholar : PubMed/NCBI

10 

Chava S, Mohan V, Shetty PJ, Manolla ML, Vaidya S, Khan IA, Waseem GL, Boddala P, Ahuja YR and Hasan Q: Immunohistochemical evaluation of p53, FHIT, and IGF2 gene expression in esophageal cancer. Dis Esophagus. 25:81–87. 2012. View Article : Google Scholar : PubMed/NCBI

11 

Vogelstein B, Lane D and Levine AJ: Surfing the p53 network. Nature. 408:307–310. 2000. View Article : Google Scholar : PubMed/NCBI

12 

Tefre T, Ryberg D, Haugen A, Nebert DW, Skaug V, Brøgger A and Børresen AL: Human CYP1A1 (cytochrome P (1)450) gene: Lack of association between the Msp I restriction fragment length polymorphism and incidence of lung cancer in a Norwegian population. Pharmacogenetics. 1:20–25. 1991. View Article : Google Scholar : PubMed/NCBI

13 

Slattery ML, Samowtiz W, Ma K, Murtaugh M, Sweeney C, Levin TR and Neuhausen S: CYP1A1, cigarette smoking, and colon and rectal cancer. Am J Epidemiol. 160:842–852. 2004. View Article : Google Scholar : PubMed/NCBI

14 

Kiyohara C, Washio M, Horiuchi T, Asami T, Ide S, Atsumi T, Kobashi G, Takahashi H and Tada Y; Kyushu Sapporo SLE (KYSS) Study Group, : Risk modification by CYP1A1 and GSTM1 polymorphisms in the association of cigarette smoking and systemic lupus erythematosus in a Japanese population. Scand J Rheumatol. 41:103–109. 2012. View Article : Google Scholar : PubMed/NCBI

15 

Goodman JE, Mechanic LE, Luke BT, Ambs S, Chanock S and Harris CC: Exploring SNP-SNP interactions and colon cancer risk using polymorphism interaction analysis. Int J Cancer. 118:1790–1797. 2006. View Article : Google Scholar : PubMed/NCBI

16 

Tan XL, Nieters A, Hoffmeister M, Beckmann L, Brenner H and Chang-Claude J: Genetic polymorphisms in Tp53, nonsteroidal anti-inflammatory drugs and the risk of colorectal cancer: Evidence for gene-environment interaction? Pharmacogenet Genomics. 17:639–645. 2007. View Article : Google Scholar : PubMed/NCBI

17 

Li XL, Zhou J, Chen ZR and Chng WJ: P53 mutations in colorectal cancer-molecular pathogenesis and pharmacological reactivation. World J Gastroenterol. 21:84–93. 2015. View Article : Google Scholar : PubMed/NCBI

18 

Kahlenberg MS, Stoler DL, Rodriguez-Bigas MA, Weber TK, Driscoll DL, Anderson GR and Petrelli NJ: p53 tumor suppressor gene mutations predict decreased survival of patients with sporadic colorectal carcinoma. Cancer. 88:1814–1819. 2000. View Article : Google Scholar : PubMed/NCBI

19 

Mulder JW, Baas IO, Polak MM, Goodman SN and Offerhaus GJ: Evaluation of p53 protein expression as a marker for long-term prognosis in colorectal carcinoma. Br J Cancer. 71:1257–1262. 1995. View Article : Google Scholar : PubMed/NCBI

20 

Erhan Y, Korkut MA, Kara E, Aydede H, Sakarya A and Ilkgü O: Value of p53 protein expression and its relationship with short-term prognosis in colorectal cancer. Ann Saudi Med. 22:377–380. 2002. View Article : Google Scholar : PubMed/NCBI

21 

Glimelius B, Tiret E, Cervantes A and Arnold D; ESMO Guidelines Working Group, : Rectal cancer: ESMO clinical practice guidelines for diagnosis, treatment and follow-up. Ann Oncol. 24 (Suppl 6):vi81–vi88. 2013. View Article : Google Scholar : PubMed/NCBI

22 

Albibas AA, Rose-Zerilli MJJ, Lai C, Pengelly RJ, Lockett GA, Theaker J, Ennis S, Holloway JW and Healy E: Subclonal evolution of cancer-related gene mutations in p53 immunopositive patches in human skin. J Invest Dermatol. 138:189–198. 2018. View Article : Google Scholar : PubMed/NCBI

23 

Duffy MJ, Synnott NC and Crown J: Mutant p53 as a target for cancer treatment. Eur J Cancer. 83:258–265. 2017. View Article : Google Scholar : PubMed/NCBI

24 

Jen J, Lin LL, Lo FY, Chen HT, Liao SY, Tang YA, Su WC, Salgia R, Hsu CL, Huang HC, et al: Oncoprotein ZNF322A transcriptionally deregulates alpha-adducin, cyclin D1 and p53 to promote tumor growth and metastasis in lung cancer. Oncogene. 36:52192017. View Article : Google Scholar : PubMed/NCBI

25 

Chaudhary R, Gryder B, Woods WS, Subramanian M, Jones MF, Li XL, Jenkins LM, Shabalina SA, Mo M, Dasso M, et al: Prosurvival long noncoding RNA PINCR regulates a subset of p53 targets in human colorectal cancer cells by binding to Matrin 3. Elife. 6(pii): e232442017. View Article : Google Scholar : PubMed/NCBI

26 

Jiang Z, Hennein L, Xu Y, Bao N, Coh P and Tao L: Elevated serum monocyte chemoattractant protein-1 levels and its genetic polymorphism is associated with diabetic retinopathy in Chinese patients with type 2 diabetes. Diabet Med. 33:84–690. 2016. View Article : Google Scholar : PubMed/NCBI

27 

Zlotorynski E: Cancer biology: A Neat target of p53. Nat Rev Mol Cell Biol. 18:5322017. View Article : Google Scholar : PubMed/NCBI

28 

Boiocchi C, Osera C, Monti MC, Ferraro OE, Govoni S, Cuccia M, Montomoli C, Pascale A and Bergamaschi R: Are Hsp70 protein expression and genetic polymorphism implicated in multiple sclerosis inflammation? J Neuroimmunol. 268:84–88. 2014. View Article : Google Scholar : PubMed/NCBI

29 

Yao C, Li G, Cai M, Qian Y, Wang L, Xiao L, Thaiss F and Shi B: Expression and genetic polymorphism of necroptosis related protein RIPK1 is correlated with severe hepatic ischemia-reperfusion injury and prognosis after hepatectomy in hepatocellular carcinoma patients. Cancer Biomark. 20:23–29. 2017. View Article : Google Scholar : PubMed/NCBI

30 

Naccarati A, Polakova V, Pardini B, Vodickova L, Hemminki K, Kumar R and Vodicka P: Mutations and polymorphisms in TP53 gene-an overview on the role in colorectal cancer. Mutagenesis. 27:211–218. 2012. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

December-2019
Volume 18 Issue 6

Print ISSN: 1792-1074
Online ISSN:1792-1082

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Zhang G, Xu Q, Wang Z, Sun L, Lv Z, Liu J, Xing C and Yuan Y: p53 protein expression affected by TP53 polymorphism is associated with the biological behavior and prognosis of low rectal cancer. Oncol Lett 18: 6807-6821, 2019
APA
Zhang, G., Xu, Q., Wang, Z., Sun, L., Lv, Z., Liu, J. ... Yuan, Y. (2019). p53 protein expression affected by TP53 polymorphism is associated with the biological behavior and prognosis of low rectal cancer. Oncology Letters, 18, 6807-6821. https://doi.org/10.3892/ol.2019.10999
MLA
Zhang, G., Xu, Q., Wang, Z., Sun, L., Lv, Z., Liu, J., Xing, C., Yuan, Y."p53 protein expression affected by TP53 polymorphism is associated with the biological behavior and prognosis of low rectal cancer". Oncology Letters 18.6 (2019): 6807-6821.
Chicago
Zhang, G., Xu, Q., Wang, Z., Sun, L., Lv, Z., Liu, J., Xing, C., Yuan, Y."p53 protein expression affected by TP53 polymorphism is associated with the biological behavior and prognosis of low rectal cancer". Oncology Letters 18, no. 6 (2019): 6807-6821. https://doi.org/10.3892/ol.2019.10999